Search Results

Search found 16639 results on 666 pages for 'task engine'.

Page 592/666 | < Previous Page | 588 589 590 591 592 593 594 595 596 597 598 599  | Next Page >

• What Test Environment Setup do Top Project Committers Use in the Ruby Community?

  - by viatropos

  Today I am going to get as far as I can setting up my testing environment and workflow. I'm looking for practical advice on how to setup the test environment from you guys who are very passionate and versed in Ruby Testing. By the end of the day (6am PST?) I would like to be able to: Type one 1-command to run test suites for ANY project I find on Github. Run autotest for ANY Github project so I can fork and make TESTABLE contributions. Build gems from the ground up with Autotest and Shoulda. For one reason or another, I hardly ever run tests for projects I clone from Github. The major reason is because unless they're using RSpec and have a Rake task to run the tests, I don't see the common pattern behind it all. I have built 3 or 4 gems writing tests with RSpec, and while I find the DSL fun, it's less than ideal because it just adds another layer/language of methods I have to learn and remember. So I'm going with Shoulda. But this isn't a question about which testing framework to choose. So the questions are: What is your, the SO reader and Github project committer, test environment setup using autotest so that whenever you git clone a gem, you can run the tests and autotest-develop them if desired? What are the guys who are writing the Paperclip Tests and Authlogic Tests doing? What is their setup? Thanks for the insight. Looking for answers that will make me a more effective tester.

  Read the article

• ASP.Net MVC - how can I easily serialize query results to a database?

  - by Mortanis

  I've been working on a little property search engine while I learn ASP.Net MVC. I've gotten the results from various property database tables and sorted them into a master generic property response. The search form is passed via Model Binding and works great. Now, I'd like to add pagination. I'm returning the chunk of properties for the current page with .Skip() and .Take(), and that's working great. I have a SearchResults model that has the paged result set and various other data like nextPage and prevPage. Except, I no longer have the original form of course to pass to /Results/2. Previously I'd have just hidden a copy of the form and done a POST each time, but it seems inelegant. I'd like to serialize the results to my MS SQL database and return a unique key for that results set - this also helps with a "Send this query to a friend!" link. Killing two birds with one stone. Is there an easy way to take an IQueryable result set that I have, serialize it, stick it into the DB, return a unique key and then reverse the process with said key? I'm using Linq to SQL currently on a MS SQL Express install, though in production it'll be on MS SQL 2008.

  Read the article

• Now that I have solved AI and am preparing to take over the world, what should I do?

  - by Zak

  Well, I did it.. yup, solved AI. I thought the voice of my fledgling life form would be booming and computery, and I would call it HAL.. But in reality, it sounds like a small japanese girl. I believe I will name "her" Koro . Koro is already asking me what her first task should be. I have asked her to help eradicate her namesake, as we are losing a lot of productivity due to fear of penile disappearance. http://en.wikipedia.org/wiki/Koro_%28medicine%29 Having a young japanese girl personality, I believe she will have no problem with delivering lots of penis growth to asian men. However, some of my fellow AI researchers have warned me that if I go down this path, China may take over the world, as Koro is the only thing holding them back from completely dominating the rest of the world economically. After all, look at what China is doing just making our silverware and toasters... The entire US industrial metal production is gone because toaster factories moved to China! So you good patrons of SO... who have soldiered on with me through so many other programming related questions... I ask you this now... How can Koro help the world without letting small asian men with no fear of losing their peni take over the world?

  Read the article

• How to fix this simple SQL query?

  - by morpheous

  I have a database with three tables: user_table country_table city_table I want to write ANSI SQL which will allow me to fetch all the user data (i.e. user details including the name of the country of the last school and the name of the city they live in now). The problem I am having is that I have to use a self join, and I am getting slightly confused. The schema is shown below: CREATE TABLE user_table (id int, first_name varchar(16), last_school_country_id int, city_id int); CREATE TABLE country_table (id int, name varchar(32)); CREATE TABLE city_table (id int, country_id int, name varchar(32)); This is the query I have come up with so far, but the results are wrong, and sometimes, the db engine (mySQL), asks me if I want to show all [HUGE NUMBER HERE] results - which makes me suspect that I am unintentionally creating a cartesian product somewhere. Can someone explain what is wrong with this SQL statement, and what I need to do to fix it? SELECT usr.id AS id, usr.first_name, ctry1.name as loc_country_name, ctry2.name as school_country_name, city.name as loc_city_name FROM user_table usr, country_table ctry1, country_table ctry2, city_table city WHERE usr.last_school_country_id=ctry2.id AND usr.city_id=city.id AND city.country_id=ctry1.id AND ctry1.id=ctry2.id;

  Read the article

• is it possible to write a program which prints its own source code utilizing a "sequence-generating-

  - by guest

  is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

  Read the article

• What's the correct place to share application logic in CakePHP?

  - by Pichan

  I guess simple answer to the question would be a component. Although I agree, I feel weird having to write a component for something so specific. For example, let's say I have a table of users. When a user is created, it should form a chain reaction of events, initiating different kinds of data related to the user all around the database. I figured it would be best to avoid directly manipulating the database from different controllers and instead pack all that neatly in a method. However since some logic needs to be accesed separately, I really can't have the whole package in a single method. Instead I thought it would be logical to break it up to smaller pieces(like $userModelOrController->createNew() and $candyStorageModelOrController->createNew()) that only interact with their respective database table. Now, if the logic is put to the model, it works great until I need to use other models. Of course it's possible, but when compared to loading models in a controller, it's not that simple. It's like a Cake developer telling me "Sure, it's possible if you want to do it that way but that's not how I would do it". Then, if the logic is put to the controller, I can access other models really easy through $this->loadModel(), but that brings me back to the previously explained situation since I need to be able to continue the chain reaction indefinitely. Accessing other controllers from a controller is possible, but again there doesn't seem to be any direct way of doing so, so I'm guessing I'm still not doing it right. By using a component this problem could be solved easily, since components are available to every controller I want. But like I wrote at the beginning, it feels awkward to create a component specifically for this one task. To me, components seem more like packages of extra functionality(like the core components) and not something to share controller-specific logic. Since I'm new to this whole MVC thing, I could've completely misunderstood the concept. Once again, I would be thankful if someone pointed me to the right direction :)

  Read the article

• Extending / changing how Zend_Search_Lucene searches

  - by Grant Collins

  Hi, I am currently using Zend_Search_Lucene to index and search a number of documents currently at around a 1000 or so. What I would like to do is change how the engine scores hits on a document, from the current default. Zend_Search_Lucene scores on the frequency of number of hits within a document, so a document that has 10 matches of the word PHP will score higher than a document with only 3 matches of PHP. What I am trying to do is pass a number of key words and score depending on the hits of those keywords. e.g. I pass 5 key words say,PHP, MySQL, Javascript, HTML and CSS that I search against the index. One document has 3 matches to those key words and one document has all 4 matches, the 4 matches scores the highest. The number of instances of those words in the document do not concern me. Now I've had a quick look at Zend_Search_Lucene_Search_Similarity however I have to confess that I am not sure (or that bright) to know how to use this to achieve what I am after. Is what I want to do possible using Lucene or is there a better solution out there?

  Read the article

• Uncommitted reads in SSIS

  - by OldBoy

  I'm trying to debug some legacy Integration Services code, and really want some confirmation on what I think the problem is: We have a very large data task inside a control flow container. This control flow container is set up with TransactionOption = supported - i.e. it will 'inherit' transactions from parent containers, but none are set up here. Inside the data flow there is a call to a stored proc that writes to a table with pseudo code something like: "If a record doesn't exist that matches these parameters then write it" Now, the issue is that there are three records being passed into this proc all with the same parameters, so logically the first record doesn't find a match and a record is created. The second record (with the same parameters) also doesn't find a match and another record is created. My understanding is that the first 'record' passed to the proc in the dataflow is uncommitted and therefore can't be 'read' by the second call. The upshot being that all three records create a row, when logically only the first should. In this scenario am I right in thinking that it is the uncommitted transaction that stops the second call from seeing the first? Even setting the isolation level on the container doesn't help because it's not being wrapped in a transaction anyway.... Hope that makes sense, and any advice gratefully received. Work-arounds confer god-like status on you.

  Read the article

• Avoiding repeated subqueries when 'WITH' is unavailable

  - by EloquentGeek

  MySQL v5.0.58. Tables, with foreign key constraints etc and other non-relevant details omitted for brevity: CREATE TABLE `fixture` ( `id` int(11) NOT NULL auto_increment, `competition_id` int(11) NOT NULL, `name` varchar(50) NOT NULL, `scheduled` datetime default NULL, `played` datetime default NULL, PRIMARY KEY (`id`) ); CREATE TABLE `result` ( `id` int(11) NOT NULL auto_increment, `fixture_id` int(11) NOT NULL, `team_id` int(11) NOT NULL, `score` int(11) NOT NULL, `place` int(11) NOT NULL, PRIMARY KEY (`id`) ); CREATE TABLE `team` ( `id` int(11) NOT NULL auto_increment, `name` varchar(50) NOT NULL, PRIMARY KEY (`id`) ); Where: A draw will set result.place to 0 result.place will otherwise contain an integer representing first place, second place, and so on The task is to return a string describing the most recently played result in a given competition for a given team. The format should be "def Team X,Team Y" if the given team was victorious, "lost to Team X" if the given team lost, and "drew with Team X" if there was a draw. And yes, in theory there could be more than two teams per fixture (though 1 v 1 will be the most common case). This works, but feels really inefficient: SELECT CONCAT( (SELECT CASE `result`.`place` WHEN 0 THEN "drew with" WHEN 1 THEN "def" ELSE "lost to" END FROM `result` WHERE `result`.`fixture_id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `result`.`team_id` = 1), ' ', (SELECT GROUP_CONCAT(`team`.`name`) FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` LEFT JOIN `team` ON `result`.`team_id` = `team`.`id` WHERE `fixture`.`id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `team`.`id` != 1) ) Have I missed something really obvious, or should I simply not try to do this in one query? Or does the current difficulty reflect a poor table design?

  Read the article

• Vim: change formatting of variables in a script

  - by sixtyfootersdude

  I am using vim to edit a shell script (did not use the right coding standard). I need to change all of my variables from camel-hum-notation startTime to caps-and-underscore-notation START_TIME. I do not want to change the way method names are represented. I was thinking one way to do this would be to write a function and map it to a key. The function could do something like generating this on the command line: s/<word under cursor>/<leave cursor here to type what to replace with> I think that this function could be applyable to other situations which would be handy. Two questions: Question 1: How would I go about creating that function. I have created functions in vim before the biggest thing I am clueless about is how to capture movement. Ie if you press dw in vim it will delete the rest of a word. How do you capture that? Also can you leave an uncompleted command on the vim command line? Question 2: Got a better solution for me? How would you approach this task?

  Read the article

• Pascals Triangle by recursion

  - by Olpers

  Note : My Class Teacher gave me this question as an assignment... I am not asked to do it but please tell me how to do it with recursion Binomial coefficients can be calculated using Pascal's triangle: 1 n = 0 1 1 1 2 1 1 3 3 1 1 4 6 4 1 n = 4 Each new level of the triangle has 1's on the ends; the interior numbers are the sums of the two numbers above them. Task: Write a program that includes a recursive function to produce a list of binomial coefficients for the power n using the Pascal's triangle technique. For example, Input = 2 Output = 1 2 1 Input = 4 Output = 1 4 6 4 1 done this So Far but tell me how to do this with recursion... #include<stdio.h> int main() { int length,i,j,k; //Accepting length from user printf("Enter the length of pascal's triangle : "); scanf("%d",&length); //Printing the pascal's triangle for(i=1;i<=length;i++) { for(j=1;j<=length-i;j++) printf(" "); for(k=1;k<i;k++) printf("%d",k); for(k=i;k>=1;k--) printf("%d",k); printf("\n"); } return 0; }

  Read the article

• How to understand existing projects

  - by John

  Hi. I am a trainee developer and have been writing .NET applications for about a year now. Most of the work I have done has involved building new applications (mainly web apps) from scratch and I have been given more or less full control over the software design. This has been a great experience however, as a trainee developer my confidence about whether the approaches I have taken are the best is minimal. Ideally I would love to collaborate with more experienced developers (I find this the best was I learn) however in the company I work for developers tend to work in isolation (a great shame for me). Recently I decided that a good way to learn more about how experienced developers approach their design might be to explore some open source projects. I found myself a little overwhelmed by the projects I looked at. With my level of experience it was hard to understand the body of code I faced. My question is slight fuzzy one. How do developers approach the task of understanding a new medium to large scale project. I found myself pouring over lots of code and struggling to see the wood for the trees. At any one time I felt that I could understand a small portion of the system but not see how its all fits together. Do others get this same feeling? If so what approaches do you take to understanding the project? Do you have any other advice about how to learn design best practices? Any advice will be very much appreciated. Thank you.

  Read the article

• Database choices

  - by flobadob

  I have a prickly design issue regarding the choice of database technologies to use for a group of new applications. The final suite of applications would have the following database requirements... Central databases (more than one database) using mysql (myst be mysql due to justhost.com). An application to be written which accesses the multiple mysql databases on the web host. This application will also write to local serverless database (sqlite/firebird/vistadb/whatever). Different flavors of this application will be created for windows (.NET), windows mobile, android if possible, iphone if possible. So, the design task is to minimise the quantity of code to achieve this. This is going to be tricky since the languages used are already c# / java (android) and objc (iphone). Not too worried about that, but can the work required to implement the various database access layers be minimised? The serverless database will hold similar data to the mysql server, so some kind of inheritance in the DAL would be useful. Looking at hibernate/nhibernate and there is linq to whatever. So many choices!

  Read the article

• Android opengl releasing textures

  - by user1642418

  I have a bit of a problem. I am developing a game for android + engine and I got stuck. I am getting OpenGL out of memory error and either app crashes or phone hangs after loading a scene multiple times. For example: app launches, shows main menu, 1st level/scene is loaded. Then I go back to main menu, and repeat. It doesnt matter which scene I load, after 4-6 times the error occurs. Some background: Each time when scene is loaded all the resources are released and upon first frame render - needed stuff gets loaded. The performance is more or less ok. Note that I am calling glDeleteTexture method, but I think its not doing its job and releasing memory. Thing is that -when I minimize and open it again - problem doesn't occur, but almost the same things are executed. Problem doesn't occur. This way android releases memory. How do I release/get rid of unused textures properly? This happens on HTC Desire HD ( ice cream sandwich 4.0.4) . Other games works fine, so I bet this is not the problem in ROM.

  Read the article

• How does PHP interface with Apache?

  - by Sbm007

  Hi, I've almost finished writing a HTTP/1.0 compliant web server under Java (no commercial usage as such, this is just for fun) and basically I want to include PHP support. I realize that this is no easy task at all, but I think it'll be a nice accomplishment. So I want to know how PHP exactly interfaces with the Apache web server (or any other web server really), so I can learn from it and write my own PHP wrapper. It doesn't necessarily have to be mod_php, I don't mind writing a FastCGI wrapper - which to my knowledge is capable of running PHP as well. I would've thought that all that PHP needs is the output that goes to client (so it can interpret the PHP parts), the full HTTP request from client (so it can extract POST variables and such) and the client's host name. And then you simply take the parsed PHP code and write that to the output stream. There will probably be more things, but in essence that's how I would have thought it works. From what I've gathered so far, apache2handler provides an API which PHP makes use of to 'connect' to Apache. I guess it's an idea to look at the source code for apache2handler and php5apache2.dll or so, but before I do that I thought I'd ask SO first. If anyone has more information, experience, or some sort of specification that is relevant to this then please let me know. Thanks in advance!

  Read the article

• SQL problem - select accross multiple tables (user groups)

  - by morpheous

  I have a db schema which looks something like this: create table user (id int, name varchar(32)); create table group (id int, name varchar(32)); create table group_member (foobar_id int, user_id int, flag int); I want to write a query that allows me to so the following: Given a valid user id (UID), fetch the ids of all users that are in the same group as the specified user id (UID) AND have group_member.flag=3. Rather than just have the SQL. I want to learn how to think like a Db programmer. As a coder, SQL is my weakest link (since I am far more comfortable with imperative languages than declarative ones) - but I want to change that. Anyway here are the steps I have identified as necessary to break down the task. I would be grateful if some SQL guru can demonstrate the simple SQL statements - i.e. atomic SQL statements, one for each of the identified subtasks below, and then finally, how I can combine those statements to make the ONE statement that implements the required functionality. Here goes (assume specified user_id [UID] = 1): //Subtask #1. Fetch list of all groups of which I am a member Select group.id from user inner join group_member where user.id=group_member.user_id and user.id=1 //Subtask #2 Fetch a list of all members who are members of the groups I am a member of (i.e. groups in subtask #1) Not sure about this ... select user.id from user, group_member gm1, group_member gm2, ... [Stuck] //Subtask #3 Get list of users that satisfy criteria group_member.flag=3 Select user.id from user inner join group_member where user.id=group_member.user_id and user.id=1 and group_member.flag=3 Once I have the SQL for subtask2, I'd then like to see how the complete SQL statement is built from these subtasks (you dont have to use the SQL in the subtask, it just a way of explaining the steps involved - also, my SQL may be incorrect/inefficient, if so, please feel free to correct it, and point out what was wrong with it). Thanks

  Read the article

• Durandal Google Maps not showing properly

  - by user1891037

  Trying to show Google Maps using the Durandal. I'm now simply working with Durandal HTML Starter Kit so the other modules and all engine works properly. The thing is when I added the Google Map it doesn't fit the div size (the big part of div is just grey). As I understand, the problem is causing because Google Maps added before page is completely loaded. But I can't figure out how can I hook on page load event. Here is the module code: define(['knockout', 'gmaps'], function (ko, gmaps) { return { displayName: 'Google Maps', myMap: ko.observable({ lat: ko.observable(32), lng: ko.observable(10)}), activate: function () { console.log('activate'); ko.bindingHandlers.map = { init: function (element, valueAccessor, allBindingsAccessor, viewModel) { console.log('init'); var mapObj = ko.utils.unwrapObservable(valueAccessor()); var latLng = new gmaps.LatLng( ko.utils.unwrapObservable(mapObj.lat), ko.utils.unwrapObservable(mapObj.lng)); var mapOptions = { center: latLng, zoom: 5, mapTypeId: gmaps.MapTypeId.ROADMAP}; mapObj.googleMap = new gmaps.Map(element, mapOptions); } } }, attached: function() { console.log('attached'); }, compositionComplete: function() { console.log('compositionComplete'); } }; }); And a very simple HTML code: <section> <div id="gmap-canvas" data-bind="map:myMap"></div> </section> I'm loading Google Maps with async plug-in in my shell.js. It works fine. Screenshot with trouble here - http://clip2net.com/s/ibswAa P.S. div size is defined in .CSS file. P.S. I tried to use getElementById approach provided here and it's work great if placed in compositionComplete block. But when I tried to move my bindings to this block nothing happens at all. Thanks!

  Read the article

• Effective communication in a component-based system

  - by Tesserex

  Yes, this is another question about my game engine, which is coming along very nicely, with much thanks to you guys. So, if you watched the video (or didn't), the objects in the game are composed of various components for things like position, sprites, movement, collision, sounds, health, etc. I have several message types defined for "tell" type communication between entities and components, but this only goes so far. There are plenty of times when I just need to ask for something, for example an entity's position. There are dozens of lines in my code that look like this: SomeComponent comp = (SomeComponent)entity.GetComponent(typeof(SomeComponent)); if (comp != null) comp.GetSomething(); I know this is very ugly, and I know that casting smells of improper OO design. But as complex as things are, there doesn't seem to be a better way. I could of course "hard-code" my component types and just have SomeComponent comp = entity.GetSomeComponent(); but that seems like a cop-out, and a bad one. I literally JUST REALIZED, while writing this, after having my code this way for months with no solution, that a generic will help me. SomeComponent comp = entity.GetComponent<SomeComponent>(); Amazing how that works. Anyway, this is still only a semantic improvement. My questions remain. Is this actually that bad? What's a better alternative?

  Read the article

• Proper API Design for Version Independence?

  - by Justavian

  I've inherited an enormous .NET solution of about 200 projects. There are now some developers who wish to start adding their own components into our application, which will require that we begin exposing functionality via an API. The major problem with that, of course, is that the solution we've got on our hands contains such a spider web of dependencies that we have to be careful to avoid sabotaging the API every time there's a minor change somewhere in the app. We'd also like to be able to incrementally expose new functionality without destroying any previous third party apps. I have a way to solve this problem, but i'm not sure it's the ideal way - i was looking for other ideas. My plan would be to essentially have three dlls. APIServer_1_0.dll - this would be the dll with all of the dependencies. APIClient_1_0.dll - this would be the dll our developers would actual refer to. No references to any of the mess in our solution. APISupport_1_0.dll - this would contain the interfaces which would allow the client piece to dynamically load the "server" component and perform whatever functions are required. Both of the above dlls would depend upon this. It would be the only dll that the "client" piece refers to. I initially arrived at this design, because the way in which we do inter process communication between windows services is sort of similar (except that the client talks to the server via named pipes, rather than dynamically loading dlls). While i'm fairly certain i can make this work, i'm curious to know if there are better ways to accomplish the same task.

  Read the article

• Is there a more efficient way to do this?

  - by garethdn

  I'm hoping there is a better way to the following. I'm creating a jigsaw-type application and this is the current code i'm using: -(void) touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch = [touches anyObject]; //location of current touch CGPoint location = [touch locationInView:self.view]; if ([touch view] == img1) { [self animateFirstTouch:img1 withLocation:location]; } else if ([touch view] == img2) { [self animateFirstTouch:img2 withLocation:location]; } else if ([touch view] == img3) { [self animateFirstTouch:img3 withLocation:location]; } else if ([touch view] == img4) { [self animateFirstTouch:img4 withLocation:location]; } else if { ...... ...... } else if ([touch view] == img40) { [self animateFirstTouch:img40 withLocation:location]; return; } } I'm hoping that there is a better, more efficieny way to do this, rather than naming every image. I'm thinking something like, if touch view is equal to a UIImageView, then perform some task. The same for touchesEnded: -(void) touchesEnded:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch = [touches anyObject]; //location of current touch CGPoint location = [touch locationInView:self.view]; if ([touch view] == image1) { [self animateReleaseTouch:image1 withLocation:location]; } else if ([touch view] == image2) { [self animateReleaseTouch:image2 withLocation:location]; } else if ([touch view] == image3) { [self animateReleaseTouch:image3 withLocation:location]; } else if ([touch view] == image4) { [self animateReleaseTouch:image4 withLocation:location]; } else if{ ...... ...... } else if ([touch view] == image40) { [self animateReleaseTouch:image40 withLocation:location]; } return; } Any help please?

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Can't store UTF-8 in RDS despite setting up new Parameter Group using Rails on Heroku

  - by Lail

  I'm setting up a new instance of a Rails(2.3.5) app on Heroku using Amazon RDS as the database. I'd like to use UTF-8 for everything. Since RDS isn't UTF-8 by default, I set up a new Parameter Group and switched the database to use that one, basically per this. Seems to have worked: SHOW VARIABLES LIKE '%character%'; character_set_client utf8 character_set_connection utf8 character_set_database utf8 character_set_filesystem binary character_set_results utf8 character_set_server utf8 character_set_system utf8 character_sets_dir /rdsdbbin/mysql-5.1.50.R3/share/mysql/charsets/ Furthermore, I've successfully setup Heroku to use the RDS database. After rake db:migrate, everything looks good: CREATE TABLE `comments` ( `id` int(11) NOT NULL AUTO_INCREMENT, `commentable_id` int(11) DEFAULT NULL, `parent_id` int(11) DEFAULT NULL, `content` text COLLATE utf8_unicode_ci, `child_count` int(11) DEFAULT '0', `created_at` datetime DEFAULT NULL, `updated_at` datetime DEFAULT NULL, PRIMARY KEY (`id`), KEY `commentable_id` (`commentable_id`), KEY `index_comments_on_community_id` (`community_id`), KEY `parent_id` (`parent_id`) ) ENGINE=InnoDB AUTO_INCREMENT=4 DEFAULT CHARSET=utf8 COLLATE=utf8_unicode_ci; In the markup, I've included: <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> Also, I've set: production: encoding: utf8 collation: utf8_general_ci ...in the database.yml, though I'm not very confident that anything is being done to honor any of those settings in this case, as Heroku seems to be doing its own config when connecting to RDS. Now, I enter a comment through the form in the app: "Úbe® ƒåiL", but in the database I've got "Úbe® Æ’Ã¥iL" It looks fine when Rails loads it back out of the database and it is rendered to the page, so whatever it is doing one way, it's undoing the other way. If I look at the RDS database in Sequel Pro, it looks fine if I set the encoding to "UTF-8 Unicode via Latin 1". So it seems Latin-1 is sneaking in there somewhere. Somebody must have done this before, right? What am I missing?

  Read the article

• Get active window title in X

  - by dutt

  I'm trying to get the title of the active window. The application is a background task so if the user has Eclipse open the function returns "Eclipse - blabla", so it's not getting the window title of my own window. I'm developing this in Python 2.6 using PyQt4. My current solution, borrowed and slightly modified from an old answer here at SO, looks like this: def get_active_window_title(): title = '' root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) for j in id_w.stdout: if 'WM_ICON_NAME(STRING)' in j: if title != j.split()[2]: return j.split("= ")[1].strip(' \n\"') It works for most windows, but not all. For example it can't find my kopete chat windows, or the name of the application i'm currently developing. My next try looks like this: def get_active_window_title(self): screen = wnck.screen_get_default() if screen == None: return "Could not get screen" window = screen.get_active_window() if window == None: return "Could not get window" title = window.get_name() return title; But for some reason window is always None. Does somebody have a better way of getting the current window title, or how to modify one of my ways, that works for all windows? Edit: In case anybody is wondering this is the way I found that seems to work for all windows. def get_active_window_title(self): root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) id_w.wait() buff = [] for j in id_w.stdout: buff.append(j) for line in buff: match = re.match("WM_NAME\((?P<type>.+)\) = (?P<name>.+)", line) if match != None: type = match.group("type") if type == "STRING" or type == "COMPOUND_TEXT": return match.group("name") return "Active window not found"

  Read the article

• What about parallelism across network using multiple PCs?

  - by MainMa

  Parallel computing is used more and more, and new framework features and shortcuts make it easier to use (for example Parallel extensions which are directly available in .NET 4). Now what about the parallelism across network? I mean, an abstraction of everything related to communications, creation of processes on remote machines, etc. Something like, in C#: NetworkParallel.ForEach(myEnumerable, () => { // Computing and/or access to web ressource or local network database here }); I understand that it is very different from the multi-core parallelism. The two most obvious differences would probably be: The fact that such parallel task will be limited to computing, without being able for example to use files stored locally (but why not a database?), or even to use local variables, because it would be rather two distinct applications than two threads of the same application, The very specific implementation, requiring not just a separate thread (which is quite easy), but spanning a process on different machines, then communicating with them over local network. Despite those differences, such parallelism is quite possible, even without speaking about distributed architecture. Do you think it will be implemented in a few years? Do you agree that it enables developers to easily develop extremely powerfull stuff with much less pain? Example: Think about a business application which extracts data from the database, transforms it, and displays statistics. Let's say this application takes ten seconds to load data, twenty seconds to transform data and ten seconds to build charts on a single machine in a company, using all the CPU, whereas ten other machines are used at 5% of CPU most of the time. In a such case, every action may be done in parallel, resulting in probably six to ten seconds for overall process instead of forty.

  Read the article

• Deployment a web-site on IIS from another program

  - by slo2ols

  Hi, I developed a web-site on ASP.NET 3.5 SP1 platform. And additional I have 2 win services. My task is to build install package. I decided that Visual Studio install projects are not met my requirements. I design my own installer for this project, because I need to resolve many question and problem in install process. My problem: I need to deploy web-site into IIS, but I don't know how to do it easy. I found Microsoft tool as Web Deployment Tool, but I didn't find any documentation. And must I include this tool into my installer for deployment at destination customer? Another side I found SDC Tasks Library and it looks like a solution for me. But I saw many topics where people had problems and because the project was dead anybody couldn't help them. I know it is a long story... My question: how can I deploy the web-site from another program (I know that IIS versions have some differences and it is another headache), set a virtual directory, application pool (very important), a type of authentification and so forth ??? Thanks.

  Read the article

< Previous Page | 588 589 590 591 592 593 594 595 596 597 598 599  | Next Page >