Search Results

Search found 16639 results on 666 pages for 'task engine'.

Page 592/666 | < Previous Page | 588 589 590 591 592 593 594 595 596 597 598 599  | Next Page >

• Is there a recommended way to communicate scientific/engineering programming to C developers?

  - by ggkmath

  Hi, I have a lot of MATLAB code that needs to get ported to C (execution speed is critical for this work) as part of a back-end process for a web application. When I attempt to outsource this code to a C developer, I assume (correct me if I'm wrong) few C developers also understand MATLAB code (things like indexing and memory management are different, etc.). I wonder if there are any C developers out there that can recommend a procedure for me to follow to best communicate what the code does? For example, should I provide the MATLAB code and explain what it's doing line by line? Or, should I just provide the math/algorithm, explain it in plain English, and let the C developer implement it with this understanding in his/her own way (e.g. can I assume the developer understands how to work with complex math (i.e. imaginary numbers), how to generate histograms, perform an FFT, etc.)? Or, is there a better method? I expect I'm not the first to need to do this, so I wonder if any C developers out there ran into this situation and can share any conventional wisdom how they'd like this task to be transferred? Thanks in advance for any comments.

  Read the article

• Why does this log output show the same answer in each iteration?

  - by Will Hancock

  OK, I was reading an article on optimising JS for Googles V8 engine, when i saw this code example... I nearly skimmed over it, but then I saw this; |=; a[0] |= b; a = new Array(); a[0] = 0; for (var b = 0; b < 10; b++) { console.log(a, b) a[0] |= b; // Much better! 2x faster. } a[0] |= b; So I ran it, in my console, with a console.log in the loop and resulted in 15; [15] 0 [15] 1 [15] 2 [15] 3 [15] 4 [15] 5 [15] 6 [15] 7 [15] 8 [15] 9 WHAT?!?! Where the hell does it get 15 from, on every iteration?!?!?! I've been a web dev for 7 years, and this has stumped me and a fellow colleague. Can somebody talk me through this code? Cheers.

  Read the article

• The application has stopped unexpectedly: How to Debug?

  - by Android Eve

  Please note, unlike many other questions having the subject title "application has stopped unexpectedly", I am not asking for troubleshooting a particular problem. Rather, I am asking for an outline of the best strategy for an Android/Eclipse/Java rookie to tackle this formidable task of digesting huge amounts of information in order to develop (and debug!) a simple Android application. In my case, I took the sample skeleton app from the SDK, modified it slightly and what did I get the moment I try to run it? The application (process.com.example.android.skeletonapp) has stopped unexpectedly. Please try again. OK, so I know that I have to look LogCat. It's full of timestamped lines staring at me... What do I do now? What do I need to look for? Is there a way to single-step the program, to find the statement that makes the app crash? (I thought Java programs never crash, but apparently I was mistaken) How do I place a breakpoint? Can you recommend an Android debug tutorial online, other than this one?

  Read the article

• [C#] how to do Exception Handling & Tracing

  - by shrimpy

  Hi all, i am reading some C# books, and got some exercise don't know how to do, or not sure what does the question mean. Problem: After working for a company for some time, your skills as a knowledgeable developer are recognized, and you are given the task of “policing” the implementation of exception handling and tracing in the source code (C#) for an enterprise application that is under constant incremental development. The two goals set by the product architect are: 100% of methods in the entire application must have at least a standard exception handler, using try/catch/finally blocks; more complex methods must also have additional exception handling for specific exceptions All control flow code can optionally write “tracing” information to assist in debugging and instrumentation of the application at run-time in situations where traditional debuggers are not available (eg. on staging and production servers). (i am not quite understand these criterias, i came from the java world, java has two kind of exception, check and unchecked exception. Developer must handle checked exception, and do logging. about unchecked exception, still do logging maybe, but most of the time we just throw it. however here comes to C#, what should i do????) Question for Problem: List rules you would create for the development team to follow, and the ways in which you would enforce rules, to achieve these goals. How would you go about ensuring that all existing code complies with the rules specified by the product architect; in particular, what considerations would impact your planning for the work to ensure all existing code complies?

  Read the article

• do the Python libraries have a natural dependence on the global namespace?

  - by msw

  I first ran into this when trying to determine the relative performance of two generators: t = timeit.repeat('g.get()', setup='g = my_generator()') So I dug into the timeit module and found that the setup and statement are evaluated with their own private, initially empty namespaces so naturally the binding of g never becomes accessible to the g.get() statement. The obvious solution is to wrap them into a class, thus adding to the global namespace. I bumped into this again when attempting, in another project, to use the multiprocessing module to divide a task among workers. I even bundled everything nicely into a class but unfortunately the call pool.apply_async(runmc, arg) fails with a PicklingError because buried inside the work object that runmc instantiates is (effectively) an assignment: self.predicate = lambda x, y: x > y so the whole object can't be (understandably) pickled and whereas: def foo(x, y): return x > y pickle.dumps(foo) is fine, the sequence bar = lambda x, y: x > y yields True from callable(bar) and from type(bar), but it Can't pickle <function <lambda> at 0xb759b764>: it's not found as __main__.<lambda>. I've given only code fragments because I can easily fix these cases by merely pulling them out into module or object level defs. The bug here appears to be in my understanding of the semantics of namespace use in general. If the nature of the language requires that I create more def statements I'll happily do so; I fear that I'm missing an essential concept though. Why is there such a strong reliance on the global namespace? Or, what am I failing to understand? Namespaces are one honking great idea -- let's do more of those!

  Read the article

• Oracle 10.1 and 11.2 produce different XML using the same statement

  - by MindFyer

  I am migrating a database from Oracle 10.1 to 11.2 and I have the following problem. The statement SELECT '<?xml version="1.0" encoding="utf-8" ?>' || (Xml).getClobVal() AS XmlClob FROM ( SELECT XmlElement( "Element1", ( SELECT XmlAgg(tpx.Xml) FROM ( SELECT XmlElement("Element3",XmlForest('content' as Element4)) AS Xml FROM dual ) tpx ) AS "Element2" ) AS Xml FROM dual ) On the original 10.1 database produces XML like this... <?xml version="1.0" encoding="utf-8"?> <Element1> <Element2> <Element3> <ELEMENT4>content</ELEMENT4> </Element3> </Element2> </Element1> On the new 11.2 system it looks like this... <?xml version="1.0" encoding="utf-8"?> <Element1> <Element3> <ELEMENT4>content</ELEMENT4> </Element3> </Element1> Is there some environmental variable I am missing that tells Oracle how to format its XML. There are hundreds of thousands of lines of PL/SQL in the database; it would be a mammoth task to rewrite if it turned out they had changed they way Oracle formats XML between versions. Hopefully someone has come accross this before. Thanks

  Read the article

• What Test Environment Setup do Top Project Committers Use in the Ruby Community?

  - by viatropos

  Today I am going to get as far as I can setting up my testing environment and workflow. I'm looking for practical advice on how to setup the test environment from you guys who are very passionate and versed in Ruby Testing. By the end of the day (6am PST?) I would like to be able to: Type one 1-command to run test suites for ANY project I find on Github. Run autotest for ANY Github project so I can fork and make TESTABLE contributions. Build gems from the ground up with Autotest and Shoulda. For one reason or another, I hardly ever run tests for projects I clone from Github. The major reason is because unless they're using RSpec and have a Rake task to run the tests, I don't see the common pattern behind it all. I have built 3 or 4 gems writing tests with RSpec, and while I find the DSL fun, it's less than ideal because it just adds another layer/language of methods I have to learn and remember. So I'm going with Shoulda. But this isn't a question about which testing framework to choose. So the questions are: What is your, the SO reader and Github project committer, test environment setup using autotest so that whenever you git clone a gem, you can run the tests and autotest-develop them if desired? What are the guys who are writing the Paperclip Tests and Authlogic Tests doing? What is their setup? Thanks for the insight. Looking for answers that will make me a more effective tester.

  Read the article

• Extending / changing how Zend_Search_Lucene searches

  - by Grant Collins

  Hi, I am currently using Zend_Search_Lucene to index and search a number of documents currently at around a 1000 or so. What I would like to do is change how the engine scores hits on a document, from the current default. Zend_Search_Lucene scores on the frequency of number of hits within a document, so a document that has 10 matches of the word PHP will score higher than a document with only 3 matches of PHP. What I am trying to do is pass a number of key words and score depending on the hits of those keywords. e.g. I pass 5 key words say,PHP, MySQL, Javascript, HTML and CSS that I search against the index. One document has 3 matches to those key words and one document has all 4 matches, the 4 matches scores the highest. The number of instances of those words in the document do not concern me. Now I've had a quick look at Zend_Search_Lucene_Search_Similarity however I have to confess that I am not sure (or that bright) to know how to use this to achieve what I am after. Is what I want to do possible using Lucene or is there a better solution out there?

  Read the article

• Database choices

  - by flobadob

  I have a prickly design issue regarding the choice of database technologies to use for a group of new applications. The final suite of applications would have the following database requirements... Central databases (more than one database) using mysql (myst be mysql due to justhost.com). An application to be written which accesses the multiple mysql databases on the web host. This application will also write to local serverless database (sqlite/firebird/vistadb/whatever). Different flavors of this application will be created for windows (.NET), windows mobile, android if possible, iphone if possible. So, the design task is to minimise the quantity of code to achieve this. This is going to be tricky since the languages used are already c# / java (android) and objc (iphone). Not too worried about that, but can the work required to implement the various database access layers be minimised? The serverless database will hold similar data to the mysql server, so some kind of inheritance in the DAL would be useful. Looking at hibernate/nhibernate and there is linq to whatever. So many choices!

  Read the article

• Hundreds of custom UserControls create thousands of USER Objects

  - by Andy Blackman

  I'm creating a dashboard application that shows hundreds of "items" on a FlowLayoutPanel. Each "item" is a UserControl that is made up of 12 or labels. My app queries a database and then creates an "item" instance for each record, populating ethe labels and textboxes with data before adding it to the FlowLayoutPanel. After adding about 560 items to the panel, I noticed that the USER Objects count in my Task Manager had gone up to about 7300, which was much much larger than any other app on my machine. I did a quick spot of mental arithmetic (OK, I might have used calc.exe) and figured that 560 * 13 (12 labels plus the UserControl itself) is 7280. So that suddenly gave away where all the objects were coming from... Knowing that there is a 10,000 USER object limit before windows throws in the towel, I'm trying to figure better ways of drawing these items onto the FlowLayoutPanel. My ideas so far are as follows: 1) User-draw the "item", using graphics.DrawText and DrawImage in place of many of the labels. I'm hoping that this will mean 1 item = 1 USER Object, not 13. 2) Have 1 instance of the "item", then for each record, populate the instance and use the Control.DrawToBitmap() method to grab an image and then use that in the FlowLayoutPanel (or similar) So... Does anyone have any other suggestions ??? P.S. It's a zoomable interface, so I have already ruled out "Paging" as there is a requirement to see all items at once :( Thanks everyone.

  Read the article

• Controller actions appear to be synchronous though on different requests?

  - by Oded

  I am under the impression that the below code should work asynchronously. However, when I am looking at firebug, I see the requests fired asynchronously, but the results coming back synchronously: Controller: [HandleError] public class HomeController : Controller { public ActionResult Status() { return Content(Session["status"].ToString()); } public ActionResult CreateSite() { Session["status"] += "Starting new site creation"; Thread.Sleep(20000); // Simulate long running task Session["status"] += "<br />New site creation complete"; return Content(string.Empty); } } Javascript/jQuery: $(document).ready(function () { $.ajax({ url: '/home/CreateSite', async: true, success: function () { mynamespace.done = true; } }); setTimeout(mynamespace.getStatus, 2000); }); var mynamespace = { counter: 0, done: false, getStatus: function () { $('#console').append('.'); if (mynamespace.counter == 4) { mynamespace.counter = 0; $.ajax({ url: '/home/Status', success: function (data) { $('#console').html(data); } }); } if (!mynamespace.done) { mynamespace.counter++; setTimeout(mynamespace.getStatus, 500); } } } Addtional information: IIS 7.0 Windows 2008 R2 Server Running in a VMWare virutual machine Can anyone explain this? Shouldn't the Status action be returning practically immediately instead of waiting for CreateSite to finish? Edit: How can I get the long running process to kick off and still get status updates?

  Read the article

• Pascals Triangle by recursion

  - by Olpers

  Note : My Class Teacher gave me this question as an assignment... I am not asked to do it but please tell me how to do it with recursion Binomial coefficients can be calculated using Pascal's triangle: 1 n = 0 1 1 1 2 1 1 3 3 1 1 4 6 4 1 n = 4 Each new level of the triangle has 1's on the ends; the interior numbers are the sums of the two numbers above them. Task: Write a program that includes a recursive function to produce a list of binomial coefficients for the power n using the Pascal's triangle technique. For example, Input = 2 Output = 1 2 1 Input = 4 Output = 1 4 6 4 1 done this So Far but tell me how to do this with recursion... #include<stdio.h> int main() { int length,i,j,k; //Accepting length from user printf("Enter the length of pascal's triangle : "); scanf("%d",&length); //Printing the pascal's triangle for(i=1;i<=length;i++) { for(j=1;j<=length-i;j++) printf(" "); for(k=1;k<i;k++) printf("%d",k); for(k=i;k>=1;k--) printf("%d",k); printf("\n"); } return 0; }

  Read the article

• Get active window title in X

  - by dutt

  I'm trying to get the title of the active window. The application is a background task so if the user has Eclipse open the function returns "Eclipse - blabla", so it's not getting the window title of my own window. I'm developing this in Python 2.6 using PyQt4. My current solution, borrowed and slightly modified from an old answer here at SO, looks like this: def get_active_window_title(): title = '' root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) for j in id_w.stdout: if 'WM_ICON_NAME(STRING)' in j: if title != j.split()[2]: return j.split("= ")[1].strip(' \n\"') It works for most windows, but not all. For example it can't find my kopete chat windows, or the name of the application i'm currently developing. My next try looks like this: def get_active_window_title(self): screen = wnck.screen_get_default() if screen == None: return "Could not get screen" window = screen.get_active_window() if window == None: return "Could not get window" title = window.get_name() return title; But for some reason window is always None. Does somebody have a better way of getting the current window title, or how to modify one of my ways, that works for all windows? Edit: In case anybody is wondering this is the way I found that seems to work for all windows. def get_active_window_title(self): root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) id_w.wait() buff = [] for j in id_w.stdout: buff.append(j) for line in buff: match = re.match("WM_NAME\((?P<type>.+)\) = (?P<name>.+)", line) if match != None: type = match.group("type") if type == "STRING" or type == "COMPOUND_TEXT": return match.group("name") return "Active window not found"

  Read the article

• Uncommitted reads in SSIS

  - by OldBoy

  I'm trying to debug some legacy Integration Services code, and really want some confirmation on what I think the problem is: We have a very large data task inside a control flow container. This control flow container is set up with TransactionOption = supported - i.e. it will 'inherit' transactions from parent containers, but none are set up here. Inside the data flow there is a call to a stored proc that writes to a table with pseudo code something like: "If a record doesn't exist that matches these parameters then write it" Now, the issue is that there are three records being passed into this proc all with the same parameters, so logically the first record doesn't find a match and a record is created. The second record (with the same parameters) also doesn't find a match and another record is created. My understanding is that the first 'record' passed to the proc in the dataflow is uncommitted and therefore can't be 'read' by the second call. The upshot being that all three records create a row, when logically only the first should. In this scenario am I right in thinking that it is the uncommitted transaction that stops the second call from seeing the first? Even setting the isolation level on the container doesn't help because it's not being wrapped in a transaction anyway.... Hope that makes sense, and any advice gratefully received. Work-arounds confer god-like status on you.

  Read the article

• MACRO compilation PROBLEM

  - by wildfly

  i was given a primitive task to find out (and to put in cl) how many nums in an array are bigger than the following ones, (meaning if (arr[i] arr[i+1]) count++;) but i've problems as it has to be a macro. i am getting errors from TASM. can someone give me a pointer? SortA macro a, l LOCAL noes irp reg, <si,di,bx> push reg endm xor bx,bx xor si,si rept l-1 ;;also tried rept 3 : wont' compile mov bl,a[si] inc si cmp bl,arr[si] jb noes inc di noes: add di,0 endm mov cx,di irp reg2, <bx,di,si> pop reg2 endm endm dseg segment arr db 10,9,8,7 len = 4 dseg ends sseg segment stack dw 100 dup (?) sseg ends cseg segment assume ds:dseg, ss:sseg, cs:cseg start: mov ax, dseg mov ds,ax sortA arr,len cseg ends end start errors: Assembling file: sorta.asm **Error** sorta.asm(51) REPT(4) Expecting pointer type **Error** sorta.asm(51) REPT(6) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(10) Expecting pointer type **Error** sorta.asm(51) REPT(12) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(16) Expecting pointer type **Error** sorta.asm(51) REPT(18) Symbol already different kind: NOES Error messages: 6

  Read the article

• is it possible to write a program which prints its own source code utilizing a "sequence-generating-

  - by guest

  is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

  Read the article

• Vim: change formatting of variables in a script

  - by sixtyfootersdude

  I am using vim to edit a shell script (did not use the right coding standard). I need to change all of my variables from camel-hum-notation startTime to caps-and-underscore-notation START_TIME. I do not want to change the way method names are represented. I was thinking one way to do this would be to write a function and map it to a key. The function could do something like generating this on the command line: s/<word under cursor>/<leave cursor here to type what to replace with> I think that this function could be applyable to other situations which would be handy. Two questions: Question 1: How would I go about creating that function. I have created functions in vim before the biggest thing I am clueless about is how to capture movement. Ie if you press dw in vim it will delete the rest of a word. How do you capture that? Also can you leave an uncompleted command on the vim command line? Question 2: Got a better solution for me? How would you approach this task?

  Read the article

• Turning a series of raw images into movie frames in Android

  - by Nicholas Killewald

  I've got an Android project I'm working on that, ultimately, will require me to create a movie file out of a series of still images taken with a phone's camera. That is to say, I want to be able to take raw image frames and string them together, one by one, into a movie. Audio is not a concern at this stage. Looking over the Android API, it looks like there are calls in it to create movie files, but it seems those are entirely geared around making a live recording from the camera on an immediate basis. While nice, I can't use that for my purposes, as I need to put annotations and other post-production things on the images as they come in before they get fed into a movie (plus, the images come way too slowly to do a live recording). Worse, looking over the Android source, it looks like a non-trivial task to rewire that to do what I want it to do (at least without touching the NDK). Is there any way I can use the API to do something like this? Or alternatively, what would be the best way to go about this, if it's even feasible on cell phone hardware (which seems to keep getting more and more powerful, strangely...)?

  Read the article

• What about parallelism across network using multiple PCs?

  - by MainMa

  Parallel computing is used more and more, and new framework features and shortcuts make it easier to use (for example Parallel extensions which are directly available in .NET 4). Now what about the parallelism across network? I mean, an abstraction of everything related to communications, creation of processes on remote machines, etc. Something like, in C#: NetworkParallel.ForEach(myEnumerable, () => { // Computing and/or access to web ressource or local network database here }); I understand that it is very different from the multi-core parallelism. The two most obvious differences would probably be: The fact that such parallel task will be limited to computing, without being able for example to use files stored locally (but why not a database?), or even to use local variables, because it would be rather two distinct applications than two threads of the same application, The very specific implementation, requiring not just a separate thread (which is quite easy), but spanning a process on different machines, then communicating with them over local network. Despite those differences, such parallelism is quite possible, even without speaking about distributed architecture. Do you think it will be implemented in a few years? Do you agree that it enables developers to easily develop extremely powerfull stuff with much less pain? Example: Think about a business application which extracts data from the database, transforms it, and displays statistics. Let's say this application takes ten seconds to load data, twenty seconds to transform data and ten seconds to build charts on a single machine in a company, using all the CPU, whereas ten other machines are used at 5% of CPU most of the time. In a such case, every action may be done in parallel, resulting in probably six to ten seconds for overall process instead of forty.

  Read the article

• PHP Object Creation and Memory Usage

  - by JohnO

  A basic dummy class: class foo { var $bar = 0; function foo() {} function boo() {} } echo memory_get_usage(); echo "\n"; $foo = new foo(); echo memory_get_usage(); echo "\n"; unset($foo); echo memory_get_usage(); echo "\n"; $foo = null; echo memory_get_usage(); echo "\n"; Outputs: $ php test.php 353672 353792 353792 353792 Now, I know that PHP docs say that memory won't be freed until it is needed (hitting the ceiling). However, I wrote this up as a small test, because I've got a much longer task, using a much bigger object, with many instances of that object. And the memory just climbs, eventually running out and stopping execution. Even though these large objects do take up memory, since I destroy them after I'm done with each one (serially), it should not run out of memory (unless a single object exhausts the entire space for memory, which is not the case). Thoughts?

  Read the article

• Avoiding repeated subqueries when 'WITH' is unavailable

  - by EloquentGeek

  MySQL v5.0.58. Tables, with foreign key constraints etc and other non-relevant details omitted for brevity: CREATE TABLE `fixture` ( `id` int(11) NOT NULL auto_increment, `competition_id` int(11) NOT NULL, `name` varchar(50) NOT NULL, `scheduled` datetime default NULL, `played` datetime default NULL, PRIMARY KEY (`id`) ); CREATE TABLE `result` ( `id` int(11) NOT NULL auto_increment, `fixture_id` int(11) NOT NULL, `team_id` int(11) NOT NULL, `score` int(11) NOT NULL, `place` int(11) NOT NULL, PRIMARY KEY (`id`) ); CREATE TABLE `team` ( `id` int(11) NOT NULL auto_increment, `name` varchar(50) NOT NULL, PRIMARY KEY (`id`) ); Where: A draw will set result.place to 0 result.place will otherwise contain an integer representing first place, second place, and so on The task is to return a string describing the most recently played result in a given competition for a given team. The format should be "def Team X,Team Y" if the given team was victorious, "lost to Team X" if the given team lost, and "drew with Team X" if there was a draw. And yes, in theory there could be more than two teams per fixture (though 1 v 1 will be the most common case). This works, but feels really inefficient: SELECT CONCAT( (SELECT CASE `result`.`place` WHEN 0 THEN "drew with" WHEN 1 THEN "def" ELSE "lost to" END FROM `result` WHERE `result`.`fixture_id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `result`.`team_id` = 1), ' ', (SELECT GROUP_CONCAT(`team`.`name`) FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` LEFT JOIN `team` ON `result`.`team_id` = `team`.`id` WHERE `fixture`.`id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `team`.`id` != 1) ) Have I missed something really obvious, or should I simply not try to do this in one query? Or does the current difficulty reflect a poor table design?

  Read the article

• What's the correct place to share application logic in CakePHP?

  - by Pichan

  I guess simple answer to the question would be a component. Although I agree, I feel weird having to write a component for something so specific. For example, let's say I have a table of users. When a user is created, it should form a chain reaction of events, initiating different kinds of data related to the user all around the database. I figured it would be best to avoid directly manipulating the database from different controllers and instead pack all that neatly in a method. However since some logic needs to be accesed separately, I really can't have the whole package in a single method. Instead I thought it would be logical to break it up to smaller pieces(like $userModelOrController->createNew() and $candyStorageModelOrController->createNew()) that only interact with their respective database table. Now, if the logic is put to the model, it works great until I need to use other models. Of course it's possible, but when compared to loading models in a controller, it's not that simple. It's like a Cake developer telling me "Sure, it's possible if you want to do it that way but that's not how I would do it". Then, if the logic is put to the controller, I can access other models really easy through $this->loadModel(), but that brings me back to the previously explained situation since I need to be able to continue the chain reaction indefinitely. Accessing other controllers from a controller is possible, but again there doesn't seem to be any direct way of doing so, so I'm guessing I'm still not doing it right. By using a component this problem could be solved easily, since components are available to every controller I want. But like I wrote at the beginning, it feels awkward to create a component specifically for this one task. To me, components seem more like packages of extra functionality(like the core components) and not something to share controller-specific logic. Since I'm new to this whole MVC thing, I could've completely misunderstood the concept. Once again, I would be thankful if someone pointed me to the right direction :)

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• How to test a Grails Service that utilizes a criteria query (with spock)?

  - by user569825

  I am trying to test a simple service method. That method mainly just returns the results of a criteria query for which I want to test if it returns the one result or not (depending on what is queried for). The problem is, that I am unaware of how to right the corresponding test correctly. I am trying to accomplish it via spock, but doing the same with any other way of testing also fails. Can one tell me how to amend the test in order to make it work for the task at hand? (BTW I'd like to keep it a unit test, if possible.) The EventService Method public HashSet<Event> listEventsForDate(Date date, int offset, int max) { date.clearTime() def c = Event.createCriteria() def results = c { and { le("startDate", date+1) // starts tonight at midnight or prior? ge("endDate", date) // ends today or later? } maxResults(max) order("startDate", "desc") } return results } The Spock Specification package myapp import grails.plugin.spock.* import spock.lang.* class EventServiceSpec extends Specification { def event def eventService = new EventService() def setup() { event = new Event() event.publisher = Mock(User) event.title = 'et' event.urlTitle = 'ut' event.details = 'details' event.location = 'location' event.startDate = new Date(2010,11,20, 9, 0) event.endDate = new Date(2011, 3, 7,18, 0) } def "list the Events of a specific date"() { given: "An event ranging over multiple days" when: "I look up a date for its respective events" def results = eventService.listEventsForDate(searchDate, 0, 100) then: "The event is found or not - depending on the requested date" numberOfResults == results.size() where: searchDate | numberOfResults new Date(2010,10,19) | 0 // one day before startDate new Date(2010,10,20) | 1 // at startDate new Date(2010,10,21) | 1 // one day after startDate new Date(2011, 1, 1) | 1 // someday during the event range new Date(2011, 3, 6) | 1 // one day before endDate new Date(2011, 3, 7) | 1 // at endDate new Date(2011, 3, 8) | 0 // one day after endDate } } The Error groovy.lang.MissingMethodException: No signature of method: static myapp.Event.createCriteria() is applicable for argument types: () values: [] at myapp.EventService.listEventsForDate(EventService.groovy:47) at myapp.EventServiceSpec.list the Events of a specific date(EventServiceSpec.groovy:29)

  Read the article

• Re-usable Obj-C classes with custom values: The right way

  - by Prairiedogg

  I'm trying to reuse a group of Obj-C clases between iPhone applications. The values that differ from app to app have been isolated and I'm trying to figure out the best way to apply these custom values to the classes on an app-to-app basis. Should I hold them in code? // I might have 10 customizable values for each class, that's a long signature! CarController *controller = [[CarController alloc] initWithFontName:@"Vroom" engine:@"Diesel" color:@"Red" number:11]; Should I store them in a big settings.plist? // Wasteful! I sometimes only use 2-3 of 50 settings! AllMyAppSettings *settings = [[AllMyAppSettings alloc] initFromDisk:@"settings.plist"]; MyCustomController *controller = [[MyCustomController alloc] initWithSettings:settings]; [settings release]; Should I have little, optional n_settings.plists for each class? // Sometimes I customize CarControllerSettings *carSettings = [[CarControllerSettings alloc] initFromDisk:@"car_settings.plist"]; CarController *controller = [[CarController alloc] initWithSettings:carSettings]; [carSettings release]; // Sometimes I don't, and CarController falls back to internally stored, reasonable defaults. CarController *controller = [[CarController alloc] initWithSettings:nil]; Or is there an OO solution that I'm not thinking of at all that would be better?

  Read the article

< Previous Page | 588 589 590 591 592 593 594 595 596 597 598 599  | Next Page >