Search Results

Search found 57986 results on 2320 pages for 'breadth first search'.

Page 607/2320 | < Previous Page | 603 604 605 606 607 608 609 610 611 612 613 614  | Next Page >

• Learning rails and AJAX. How do I load a div via ajax and then toggle hiding/showing it?

  - by Kevin L.

  I'm doing my first Ruby on Rails project. I am working on a project where the user can add a new message. Then they can add updates to this message like a thread. I've got it all written and now I'm going back and applying some AJAX. I want to show just the main message when the page first loads. Then when I click a link I want an AJAX event to fire that populates a div with all the updates to the message. Then I want this same link to toggle hiding and showing the div. I've made a submit button to fire the ajax and get back the updates using form_remote_tag. I've also created a separate link to toggle the hiding using $(div_id).toggle();. But now I'm stuck on how to combine these two things into one all purpose link. Thanks.

  Read the article

• Database layout for an application with geocoding features using geokit

  - by vooD

  I'm developing a real estate web catalogue and want to geocode every ad using geokit gem. My question is what would be the best database layout from the performance point if i want to make search by country, city of the selected country, administrative area or nearest metro station of the selected city. Available countries, cities, administrative areas and metro sations should be defined by the administrator of catalogue and must be validated by geocoding. I came up with single table: create_table "geo_locations", :force => true do |t| t.integer "geo_location_id" #parent geo location (ex. country is parent geo location of city t.string "country", :null => false #necessary for any geo location t.string "city", #not null for city geo location and it's children t.string "administrative_area" #not null for administrative_area geo location and it's children t.string "thoroughfare_name" #not null for metro station or street name geo location and it's children t.string "premise_number" #house number t.float "lng", :null => false t.float "lat", :null => false t.float "bound_sw_lat", :null => false t.float "bound_sw_lng", :null => false t.float "bound_ne_lat", :null => false t.float "bound_ne_lng", :null => false t.integer "mappable_id" t.string "mappable_type" t.string "type" #country, city, administrative area, metro station or address end Final geo location is address it contains all neccessary information to put marker of the real estate ad on the map. But i'm still stuck on search functionality. Any help would be highly appreciated.

  Read the article

• how to handle empty selection in a jface bound combobox?

  - by guido

  I am developing a search dialog in my eclipse-rcp application. In the search dialog I have a combobox as follows: comboImp = new CCombo(grpColSpet, SWT.BORDER | SWT.READ_ONLY); comboImp.setBounds(556, 46, 184, 27); comboImpViewer = new ComboViewer(comboImp); comboImpViewer.setContentProvider(new ArrayContentProvider()); comboImpViewer.setInput(ImpContentProvider.getInstance().getImps()); comboImpViewer.setLabelProvider(new LabelProvider() { @Override public String getText(Object element) { return ((Imp)element).getImpName(); } }); Imp is a database entity, ManyToOne to the main entity which is searched, and ImpContentProvider is the model class which speaks to embedded sqlite database via jpa/hibernate. This combobox is supposed to contain all instances of Imp, but to also let empty selection; it's value is bound to a service bean as follows: IObservableValue comboImpSelectionObserveWidget = ViewersObservables.observeSingleSelection(comboImpViewer); IObservableValue filterByImpObserveValue = BeansObservables.observeValue(searchPrep, "imp"); bindingContext.bindValue(comboImpSelectionObserveWidget, filterByImpObserveValue , null, null); As soon as the user clicks on the combo, a selection (first element) is made: I can see the call to a selectionlistener i added on the viewer. My question is: after a selection has been made, how do I let the user change his mind and have an empty selection in the combobox? should I add a "fake" empty instance of Imp to the List returned by the ImpContentProvider? or should I implement an alternative to ArrayContentProvider? and one additional related question is: why calling deselectAll() and clearSelection() on the combo does NOT set a null value to the bound bean?

  Read the article

• To trigger everytime with .click()?

  - by Dejan.S

  I tried to have a .click() on a <a> to find out it wont trigger every time I click, what it suppose to do is open a dialog. That is not the only problem I would need to pass a value to my jquery to. I just cant figure this one out. I need it to be a <a> because it's gone be in a dropdown menu. Do you got any suggestions? this is the code I use so far $(document).ready(function() { $('a').click(function() { var first = "<iframe style='width: 100%; height: 100%;' src='" + need to put value here + "'</iframe>'"; $('.iframe').html(first); $('#dialog').dialog({ bgiframe: true, modal: true, height: 600, width: 1000 }); }); }); thanks guys

  Read the article

• C static variables and intialization

  - by yCalleecharan

  Hi, If I have a global static variable x like in this code #include <stdio.h> #include <stdio.h> static int x; int main(void) { DO SOMETHING WITH x HERE x++; } What will be difference if I opted to initialize x to a value first say as in static int x = 0; before entering "main"? In my first case where I didn't assign a value to x, does the compiler implicitly know that x is to be set to zero as it's a static variable? I heard that we can do this with static variables. Thanks a lot...

  Read the article

• Android programming: Authentication and data exchange with Java EE

  - by Konsumierer

  I am having a Java application running in a Tomcat server using Spring, Hibernate, etc. and a two web interfaces, one implemented in Tapestry 5 and the other one using Flex with BlazeDS and Spring-BlazeDS. In my first android application I would now like to log in to the server and retrieve some data. I´m wondering how I could achieve this in a secure way. First of all I need to know which technology is the best to retrieve data from the server and how can I restrict the access to users only that have been successfully authenticated. With what I read until now I would try to implement a HTTPServlet on the server and make server calls via HTTP Client. In the servlet I could probably use the HTTPSession to check if the request comes from an authenticated user. And the data I would try to send serialized (JSON). Unfortunately, I´ve never done those things and maybe I´m on the wrong way and there are more comfortable solutions.

  Read the article

• Problem with Wicket and SignInExample in IE8

  - by KJQ

  I have an interesting problem with Wicket. I'm basically duplicating the 'authentication' example from the v1.4.x in SVN. It works fine in FireFox and Chrome but not in IE8. When in IE8, after I click the submit button it returns with a 404 error but i can manually paste the "destination" url in and it goes there fine (as an authenticated user). Another scenario is, I try to login, it gives me a 404, I hit refresh (looking at the html source I see the page version incremented), relogin and it works fine. So to summarize: I login the first time in IE8 and it returns a 404 error, hit refresh and ogin again and it works fine. I login the first time in IE8 and it returns a 404 error, manually paste the destination url in the browser and it goes there fine as if im logged in. I've compared everything between IE8 and FireFox from the rendered source and the code is not doing anything special but I cannot figure out what the differences are? Thanks. KJQ

  Read the article

• Call static properties within another class in php

  - by ali A

  I have problem about calling a static property of a class inside another class. Class A { public $property; public function __construct( $prop ) { $this->property = $prop; } public function returnValue(){ return static::$this->property; } } Class B extends A { public static $property_one = 'This is first property'; public static $property_two = 'This is second property'; } $B = new B( 'property_one' ); $B->returnValue(); I expect to return This is first property But the Output is just the name a parameter input in __construct; When I print_r( static::$this->property ); the output is just property_one

  Read the article

• Matatag mainly used in SEO

  - by PHP-Prabhu

  Can any one tell me, do i need to use all the MATA Tags for web pages for bringing up the site in google's first page

  Read the article

• Where exactly should I attach script in HTML

  - by bzxcv7

  I have read about several ways to embed Javascript in HTML document. First, in head section: <head> ... <script src="abc.js"></script> </head> Second, in the end of document's body: <body> <!-- content --> <script src="abc.js"></script> </body> First way is more esthetic, but second version assures that all the items in DOM are loaded. I use HTML5 (but probably it doesn't matters) Which way is better and why?

  Read the article

• What would be the best language in which to write an ESB?

  - by Zubair

  My first thoughts are Erlang, or Java, but I wanted to know from others experiences.

  Read the article

• PgJDBC: "no suitable driver found" when following tutorial, why?

  - by Celeritas

  I'm writing a Java program that queries a PostgreSQL database. I'm following this example and have trouble here: connection = DriverManager.getConnection( "jdbc:postgresql://127.0.0.1:5432/testdb", "mkyong", "123456"); According to the JavaDoc for DriverManager the first string is "a database url of the form jdbc:subprotocol:subname. When I connect to the server I type in psql -h dataserv.abc.company.com -d app -U emp24 and give the password qwe123 (for example sake). What should the first argument of getConnection be? I've tried connection = DriverManager.getConnection( "jdbc:postgresql://dataserv.abc.company.com", "emp24", "qwe123"); and get the run time error: no suitable driver found. I've download JDBC4 Postgresql Driver, Version 9.2-1000.

  Read the article

• php multidimensional array problem

  - by ntan

  Hi to all, i am trying to setup a multidimensional array but my problem is that i can not get the right order from incoming data. Explain $x[1][11]=11; $x[1]=1; var_dump($x); In the above code i get only x[1]. To right would be $x[1]=1; $x[1][11]=11; var_dump($x); But in my case i can dot ensure that x[1] will come first, and x[1][11] will come after. Is there any way that i can use the first example and get right the array. Keep in mind that the array depth is large. Thats

  Read the article

• Clojure multimethod dispatching on functions and values

  - by Josh Glover

  I have a function that returns the indexes in seq s at which value v exists: (defn indexes-of [v s] (map first (filter #(= v (last %)) (zipmap (range) s)))) What I'd like to do is extend this to apply any arbitrary function for the existence test. My idea is to use a multimethod, but I'm not sure exactly how to detect a function. I want to do this: (defmulti indexes-of ???) (defmethod indexes-of ??? [v s] ;; v is a function (map first (filter v (zipmap (range) s)))) (defmethod indexes-of ??? [v s] ;; v is not a function (indexes-of #(= v %) s)) Is a multimethod the way to go here? If so, how can I accomplish what I'm trying to do?

  Read the article

• Reducing unnecessary same values in Class member variables ....

  - by Freshblood

  class A { public int a; public int c; } i will create 10 instances from A.Then i will create 15 instances from A again... go on. first 10 instance will have same value for a variable and next 15 instances will have again same value for a.But I don't mean that both group has same values for a .Problem is create same a value 10 times in first group and 15 times in second group on memory unnecessary. What would be Best solution or solutions for reduce unnecessary datas in this situation?

  Read the article

• python len calculation

  - by n00bz0r

  I'm currently trying to build a RDP client in python and I came across the following issue with a len check; From: http://msdn.microsoft.com/en-us/library/cc240836%28v=prot.10%29.aspx "81 2a - ConnectData::connectPDU length = 298 bytes Since the most significant bit of the first byte (0x81) is set to 1 and the following bit is set to 0, the length is given by the low six bits of the first byte and the second byte. Hence, the value is 0x12a, which is 298 bytes." This sounds weird. For normal len checks, I'm simply using : struct.pack("h",len(str(PacketLen))) but in this case, I really don't see how I can calculate the len as described above. Any help on this would be greatly appreciated !

  Read the article

• Which cms or script for social network wiki?

  - by Jason

  Hi, I am building a social network. I need a cms that will allow users to contribute content. Each content item will need to have a google map, list of features, ratings, comments, etc. And the content must be editable by other users with revision control. Also, each user should have a profile with their bookmarked content items, contributed items, comments, etc. It's very important that I can create a template for the wiki/content entries so that each item looks uniform. (and as a kick in the teeth, I would like to be able to search for wiki items using a radial search or map) Joomla was my first choice, as I've used it for many projects, but the wiki functionality is not there. I was also setting up a grou.ps site, but the wiki is so-so - not feature rich and it really doesn't have the option I need. Additionally, I know someone out there will mention Drupal. I may consider it if I can see it put to use without and overabundance of custom programming (I don't mind initial coding, but drupal requires constant coding & recoding - with this site, I dont' have that time commitment) I thought about using mediawiki with buddypress, but i'm not sure if that's the way to go. Thoughts?

  Read the article

• How does cast in C#/.NET 3.5 work for types with '?'

  - by Inez

  This is my code which works public decimal? Get() { var res = ... return res.Count() > 0 ? res.First() : (decimal?) null; } and this one doesn't work public decimal? Get() { var res = ... return res.Count() > 0 ? res.First() : null; } giving the compiler error: Error 1 Type of conditional expression cannot be determined because there is no implicit conversion between 'decimal' and '<null>' I wonder why? any ideas?

  Read the article

• rails gem share_counts GET method on object?

  - by jaqbyte

  created the first rails app! excinting! for two weeks now I did Zombie, rubymonk etc. I love it! I used scaffold form url:string and included the gem share_counts. rails c: f = form.first ShareCounts.twitter f.url works! but... I have trouble to write the controller and the view! For you experienced railies this is probably a silly question, and probably only 5 lines of code, but for me thats a big step learning RoR! I am very thankful if someone could help how I can show the count next to the "url" field. Thank you so much!!! joh

  Read the article

• Does AsEnumerable() cache all result (LINQ)

  - by Akshay

  When we call a query operator on a sequence, a sequence-specific operator gets called. I mean if i call Where<>() operator on IEnumerable<>, the operator that will be called will be defined in Enumerable class and if it's called on IQueryable<>, the one defined in Queryable class will be called. Consider the operator Reverse, defined in the Enumerable class. If i want to call it on Iqueryable<> then I must use the AsEnumerable<>() operator to first convert it into IEnumerable<>. db.Countries.OrderBy(cntry=>cntry.CountryName).AsEnumerable().Reverse() But the Reverse operator got to have all records at the same time so that it can reverse them. In the above code do all the records get loaded in memory first and then the Reverse() operator is reversing it ?

  Read the article

• Django. default=datetime.now() problem

  - by Shamanu4

  Hello. I've such db model: from datetime import datetime class TermPayment(models.Model): dev_session = models.ForeignKey(DeviceSession, related_name='payments') user_session = models.ForeignKey(UserSession, related_name='payment') date = models.DateTimeField(default=datetime.now(),blank=True) sum = models.FloatField(default=0) cnt = models.IntegerField(default=0) class Meta: db_table = 'term_payments' ordering = ['-date'] and here new instance is added: # ... tp = TermPayment() tp.dev_session = self.conn.session # device session hash tp.user_session = self.session # user session hash tp.sum = sum tp.cnt = cnt tp.save() But i've a problem: all records in database have the same value in date field - the date of the first payment. After server restart - one record have new date and others have the same as first after restart. It's look like some data cache is using but I can't found where. database: mysql 5.1.25 django v1.1.1

  Read the article

• Initializing and accessing a pointer from an array of pointers

  - by idealistikz

  Suppose I have the following: void **Init(int numElems) { //What is the best way to intialize 'ptrElems' to store an array of void *'s? void **ptrElems = malloc(numElems * sizeof(void *)); return ptrElems; } //What is the best way to return a pointer pointing at the index passed as a parameter? void **GetPtr(void **ptrElems, int index) { void **elem = elems + (index * sizeof(void *)); return elem; } First, what is the best way to intialize 'ptrElems' to store an array of pointers? I use malloc because assigning it to an array will not persist after the end of the function. Second, what is the best way to point to the pointer at the specified index? I tried typecasting the first line of the 'GetPtr' function to ensure proper pointer arithmetic, but I receive the warning, 'initialization from incompatible pointer type'. Is it necessary to typecast?

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Hooking a synchronous event handler on a form submit button in JS

  - by Xzhsh

  Hi, I'm working on a security project in javascript (something I honestly have not used), and I'm having some trouble with EventListeners. My code looks something like this: function prevclick(evt) { evt.preventDefault(); document.loginform.submitbtn.removeEventListener('click',prevclick,false); var req = new XMLHttpRequest(); req.open("GET","testlog.php?submission=complete",false); req.send(); document.loginform.submitbtn.click(); //tried this and loginform.submit() } document.loginform.submitbtn.addEventListener('click',prevclick,false); But the problem is, the submit button doesn't submit the form on the first click (it does, however, send the http request on the first click), and on the second click of the submit button, it works as normal. I think there is a problem with the synchronization, but I do need to have the request processed before forwarding the user to the next page. Any ideas on this would be great. Thanks in advance.

  Read the article

• when a sql server agent job is created and sheduled should we start running the job manaully for the

  - by amritha

  hi i have created a sql server agent job and scheduled it for every 10 mins. for the first time, when it runs should we need to run the job manually once before it starts with scheduled time. Basically how does the job run for the first time. Also when the job is created the owner of the job is in disabled state. will this effect the schedule of the job? Appreciate quick help. Thanks.

  Read the article

< Previous Page | 603 604 605 606 607 608 609 610 611 612 613 614  | Next Page >