Search Results

Search found 57986 results on 2320 pages for 'breadth first search'.

Page 607/2320 | < Previous Page | 603 604 605 606 607 608 609 610 611 612 613 614  | Next Page >

  • Unable to install Ruby gems

    - by gemseeker
    I am trying for the first time to install some Ruby gems on Mac OS X Leopard. Please see the command and the output below. My question is how do I install a gem with dependencies? I tried installing individual dependency gems first from a locally downloaded files but I soon found out that there is no end to the rabbit hole :-) I also found out that there are circular dependencies that break even this tedious method. There must be a better way! I would really appreciate your help. sudo gem install oauth Updating metadata for 1 gems from http://gems.rubyforge.org . complete ERROR: Error installing oauth: oauth requires actionpack (>= 2.2.0, < 2.3.0)

    Read the article

  • Does anyone actually use the phrase DHTML anymore?

    - by lafoaug
    I'm not sure if this is exactly appropriate but I have what I think is a interesting question. Does anyone actually use the phrase DHTML anymore in a professional environment? I came across the the word the other day for the first time in years and shuddered at the thought of it. To me the acronym Dynamic HTML just sounds so 1999, it brings me back to the days when I first discovered programming and web development and thought it was awesome to have scripts which modified the status bar and made things fly around the page. I for one have never used the phrase recently and would never dream of saying it in a professional environment to clients or colleges as I feel there is an amateur and dated stigma attached to it. What are your thoughts?

    Read the article

  • $query returns results but not the ones i want: $query looks good to me :S

    - by Toni Michel Caubet
    I'll start again, Lets say My data is: Table element (id,name,....) 1, name element 1, .... 2, name element 2, .... 3, name element 3, .... Table tags (id,name,id_element, ....) 1, happy , 1 2, result, 1 3, very , 1 4, element, 2 5, another, 3 6, element, 1 7, happy, 2 So if search is 'very, happy,element,result': Results i would like 1) element with id = 2 because it has all tags 2) element with id = 1 because it has the tag 'element' and the tag 'happy' (only 2 less taggs) 3) .... (only 3 less taggs) So if search is 'happy,element': Results i would like 1) element with id = 1 because it has all tags (and no more) 2) element with id = 2 because it has the tag 'element' and the tag 'happy' (and two more tags) 3) .... and 3 more tags This is an echo to my query: (it doesn't fit al requirements i wrote, but its first test to find with matched tags) SELECT element.id as id_deseada,tagg.* FROM element,tagg WHERE tagg.id_element = element.id AND tagg.nombre IN ('happy','tagg','result') GROUP BY tagg.id_element ORDER BY element.votos This returns 10 duplicated elements... :S and doen't even have all taggs (and on database there are taggs with 'happy' results) if it helps, thats how i get the elements of a tag (by name and with only one tagg) $query = "SELECT element.id FROM element,tagg WHERE tagg.nombre = '$nombre_tagg' AND tagg.id_element = element.id AND lan = '$lan' GROUP BY tagg.id_element"; I hope it's a bit easier to understand now, excuse my english.. :) Thanks a lot for you possible aportation!

    Read the article

  • rails gem share_counts GET method on object?

    - by jaqbyte
    created the first rails app! excinting! for two weeks now I did Zombie, rubymonk etc. I love it! I used scaffold form url:string and included the gem share_counts. rails c: f = form.first ShareCounts.twitter f.url works! but... I have trouble to write the controller and the view! For you experienced railies this is probably a silly question, and probably only 5 lines of code, but for me thats a big step learning RoR! I am very thankful if someone could help how I can show the count next to the "url" field. Thank you so much!!! joh

    Read the article

  • Need help with a Linq XML conditional grouping query

    - by FiveTools
    I have the following xml fragment: <BANNER ID="Banner 2" ROW_WIDTH="200"> <BANNER_TEXTS ID="BANNER_TEXTS"> <BANNER_TEXT UNDERLINE="false" SPAN_COL="1" WIDTHT="78px"></BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="3" WIDTHT="234px">Years In Practice</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="3" WIDTHT="234px">Internet Usage</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="4" WIDTHT="312px">Sales Reps Seen / Week</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="3" WIDTHT="234px">Prescription Volume</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="3" WIDTHT="222px">Patient Load</BANNER_TEXT> </BANNER_TEXTS> <BANNER_TEXTS ID="COLUMN_TEXTS"> <BANNER_TEXT UNDERLINE="true" SPAN_COL="1" WIDTHT="78px">Total</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="1" WIDTHT="78px">&#60; 11 years</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="1" WIDTHT="78px">11-20 years</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="1" WIDTHT="78px">21-30 years</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="1" WIDTHT="78px">Light 1-5 hrs</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="1" WIDTHT="78px">Medium 6-10 hrs</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="1" WIDTHT="78px">Heavy &#62;10 hrs</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="1" WIDTHT="78px">0</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="1" WIDTHT="78px">1-2</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="1" WIDTHT="78px">3-5</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="1" WIDTHT="78px">&#62;5</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="1" WIDTHT="78px">1-100</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="1" WIDTHT="78px">101-150</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="1" WIDTHT="78px">&#62;150</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="1" WIDTHT="74px">1-100</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="1" WIDTHT="74px">101-200</BANNER_TEXT> <BANNER_TEXT UNDERLINE="true" SPAN_COL="1" WIDTHT="74px">&#62;200</BANNER_TEXT> </BANNER_TEXTS> <BANNER_TEXTS ID="COLUMN_TEXTS"> <COLUMN_TEXT UNDERLINE="false" SPAN_COL="1">(A)</COLUMN_TEXT> <COLUMN_TEXT UNDERLINE="false" SPAN_COL="1">(B)</COLUMN_TEXT> <COLUMN_TEXT UNDERLINE="false" SPAN_COL="1">(C)</COLUMN_TEXT> <COLUMN_TEXT UNDERLINE="false" SPAN_COL="1">(D)</COLUMN_TEXT> <COLUMN_TEXT UNDERLINE="false" SPAN_COL="1">(E)</COLUMN_TEXT> <COLUMN_TEXT UNDERLINE="false" SPAN_COL="1">(F)</COLUMN_TEXT> <COLUMN_TEXT UNDERLINE="false" SPAN_COL="1">(G)</COLUMN_TEXT> <COLUMN_TEXT UNDERLINE="false" SPAN_COL="1">(H)</COLUMN_TEXT> <COLUMN_TEXT UNDERLINE="false" SPAN_COL="1">(I)</COLUMN_TEXT> <COLUMN_TEXT UNDERLINE="false" SPAN_COL="1">(J)</COLUMN_TEXT> <COLUMN_TEXT UNDERLINE="false" SPAN_COL="1">(K)</COLUMN_TEXT> <COLUMN_TEXT UNDERLINE="false" SPAN_COL="1">(L)</COLUMN_TEXT> <COLUMN_TEXT UNDERLINE="false" SPAN_COL="1">(M)</COLUMN_TEXT> <COLUMN_TEXT UNDERLINE="false" SPAN_COL="1">(N)</COLUMN_TEXT> <COLUMN_TEXT UNDERLINE="false" SPAN_COL="1">(O)</COLUMN_TEXT> <COLUMN_TEXT UNDERLINE="false" SPAN_COL="1">(P)</COLUMN_TEXT> <COLUMN_TEXT UNDERLINE="false" SPAN_COL="1">(Q)</COLUMN_TEXT> </BANNER_TEXTS> </BANNER> I would like to group all the 'BANNER_TEXT' in the second sequence using the first sequence 'BANNER_TEXT' as the key (only include elements where string is not null or empty). The span_col attribute in the first 'BANNER_TEXT' sequence indicates which elements by position in the 2nd sequence are related. An example: 'Years in Practice' would be the first key and the attribute SPAN_COL=3 for that element indicates it would contain '< 11 years', '11-20 years', '21-30 years' (the first grouping of string.empty = Total would be skipped).

    Read the article

  • iPhone: Grouping records in multiple UITableView views

    - by Nic Hubbard
    Let me first say, I know how to create sections and group records within a UITableView. What I am wanting to do is something similar to creating a photo album. So, I have all my data objects coming from core data, and, I want to be able to create a custom group, such as "My Trip to Mexico" and "First Birthday". Then, the user should be able to add objects/records into new sections/albums. So, basically the user is creating custom sections with their own custom names, and then choosing what records should go into that section/album. So, I am just wondering what is the best way to do this? I am thinking that I would just create some extra attributes for my core data model. Or, would I create a whole new "Album Section" object, and somehow use that? Point me in the right direction. :)

    Read the article

  • how to handle empty selection in a jface bound combobox?

    - by guido
    I am developing a search dialog in my eclipse-rcp application. In the search dialog I have a combobox as follows: comboImp = new CCombo(grpColSpet, SWT.BORDER | SWT.READ_ONLY); comboImp.setBounds(556, 46, 184, 27); comboImpViewer = new ComboViewer(comboImp); comboImpViewer.setContentProvider(new ArrayContentProvider()); comboImpViewer.setInput(ImpContentProvider.getInstance().getImps()); comboImpViewer.setLabelProvider(new LabelProvider() { @Override public String getText(Object element) { return ((Imp)element).getImpName(); } }); Imp is a database entity, ManyToOne to the main entity which is searched, and ImpContentProvider is the model class which speaks to embedded sqlite database via jpa/hibernate. This combobox is supposed to contain all instances of Imp, but to also let empty selection; it's value is bound to a service bean as follows: IObservableValue comboImpSelectionObserveWidget = ViewersObservables.observeSingleSelection(comboImpViewer); IObservableValue filterByImpObserveValue = BeansObservables.observeValue(searchPrep, "imp"); bindingContext.bindValue(comboImpSelectionObserveWidget, filterByImpObserveValue , null, null); As soon as the user clicks on the combo, a selection (first element) is made: I can see the call to a selectionlistener i added on the viewer. My question is: after a selection has been made, how do I let the user change his mind and have an empty selection in the combobox? should I add a "fake" empty instance of Imp to the List returned by the ImpContentProvider? or should I implement an alternative to ArrayContentProvider? and one additional related question is: why calling deselectAll() and clearSelection() on the combo does NOT set a null value to the bound bean?

    Read the article

  • Android programming: Authentication and data exchange with Java EE

    - by Konsumierer
    I am having a Java application running in a Tomcat server using Spring, Hibernate, etc. and a two web interfaces, one implemented in Tapestry 5 and the other one using Flex with BlazeDS and Spring-BlazeDS. In my first android application I would now like to log in to the server and retrieve some data. I´m wondering how I could achieve this in a secure way. First of all I need to know which technology is the best to retrieve data from the server and how can I restrict the access to users only that have been successfully authenticated. With what I read until now I would try to implement a HTTPServlet on the server and make server calls via HTTP Client. In the servlet I could probably use the HTTPSession to check if the request comes from an authenticated user. And the data I would try to send serialized (JSON). Unfortunately, I´ve never done those things and maybe I´m on the wrong way and there are more comfortable solutions.

    Read the article

  • How does cast in C#/.NET 3.5 work for types with '?'

    - by Inez
    This is my code which works public decimal? Get() { var res = ... return res.Count() > 0 ? res.First() : (decimal?) null; } and this one doesn't work public decimal? Get() { var res = ... return res.Count() > 0 ? res.First() : null; } giving the compiler error: Error 1 Type of conditional expression cannot be determined because there is no implicit conversion between 'decimal' and '<null>' I wonder why? any ideas?

    Read the article

  • how to update multiple tables in oracle DB?

    - by murali
    hi, i am using two tables in my oracle 10g. the first table having the keyword,count,id(primary key) and my second table having id, timestamp.. but i am doing any chages in the first table(keyword,count) it will reflect on the my second table timestamp.. i am using id as reference for both the tables... table1: CREATE TABLE Searchable_Keywords (KEYWORD_ID NUMBER(18) PRIMARY KEY, KEYWORD VARCHAR2(255) NOT NULL, COUNT NUMBER(18) NOT NULL, CONSTRAINT Searchable_Keywords_unique UNIQUE(KEYWORD) ); table2: CREATE TABLE Keywords_Tracking_Report (KEYWORD_ID NUMBER(18), PROCESS_TIMESTAMP TIMESTAMP(8) ); how can update one table with reference of another table.. help me plz...

    Read the article

  • jQuery child selector expression

    - by Saiful
    <div id="div"> <div> <!-- first level --> <div> <!-- second level --> <div>1.1</div> <!-- third level --> <div>1.2</div> </div> <div> <div></div> <div>2.2</div> </div> </div> </div> What are the jQuery selector expressions for selecting the followings: 1. div commented by first level 2. divs commented by second level 3. divs commented by third level

    Read the article

  • visual studio 2010 add reference version missing

    - by Noel
    In VS2008 when I add a reference to a dll e.g log4Net I get the following in csproj <Reference Include="log4net, Version=1.2.10.0, Culture=neutral, PublicKeyToken=1b44e1d426115821, processorArchitecture=MSIL"> <SpecificVersion>False</SpecificVersion> <HintPath>..\..\lib\log4net\log4net.dll</HintPath> </Reference> In VS2010 when I add a reference to a dll for the first time e.g log4Net I get the following in csproj (i.e no version number etc) <Reference Include="log4net"> <HintPath>..\..\lib\log4net\log4net.dll</HintPath> </Reference> If I remove reference and add a second time the same details as in VS2008 is there (Version etc) Anyone know why version number etc not present the first time I add a reference and why it is present on secound time reference added?

    Read the article

  • PgJDBC: "no suitable driver found" when following tutorial, why?

    - by Celeritas
    I'm writing a Java program that queries a PostgreSQL database. I'm following this example and have trouble here: connection = DriverManager.getConnection( "jdbc:postgresql://127.0.0.1:5432/testdb", "mkyong", "123456"); According to the JavaDoc for DriverManager the first string is "a database url of the form jdbc:subprotocol:subname. When I connect to the server I type in psql -h dataserv.abc.company.com -d app -U emp24 and give the password qwe123 (for example sake). What should the first argument of getConnection be? I've tried connection = DriverManager.getConnection( "jdbc:postgresql://dataserv.abc.company.com", "emp24", "qwe123"); and get the run time error: no suitable driver found. I've download JDBC4 Postgresql Driver, Version 9.2-1000.

    Read the article

  • To trigger everytime with .click()?

    - by Dejan.S
    I tried to have a .click() on a <a> to find out it wont trigger every time I click, what it suppose to do is open a dialog. That is not the only problem I would need to pass a value to my jquery to. I just cant figure this one out. I need it to be a <a> because it's gone be in a dropdown menu. Do you got any suggestions? this is the code I use so far $(document).ready(function() { $('a').click(function() { var first = "<iframe style='width: 100%; height: 100%;' src='" + need to put value here + "'</iframe>'"; $('.iframe').html(first); $('#dialog').dialog({ bgiframe: true, modal: true, height: 600, width: 1000 }); }); }); thanks guys

    Read the article

  • Optimizing NSNumber numberWithInt:

    - by Riviera
    I am profiling an iPhone app and I noticed a strange pattern. In a certain block of code that's called quite frequently... [item setQuadrant:[NSNumber numberWithInt:a]]; [item setIndex:[NSNumber numberWithInt:b]]; [item setTimestamp:[NSNumber numberWithInt:c]]; [item setState:[NSNumber numberWithInt:d]]; [item setCompletionPercentage:[NSNumber numberWithInt:e]]; [item setId_:[NSNumber numberWithInt:f]]; ...the first call to [NSNumber numberWithInt:] takes an inordinate amount of time, in the order of 10-15x that of the remaining calls. I've verified that the results are consistent if I shuffle the lines (the first line is always the slow one, by the same ratio). Is there something going on that I'm not aware of? Perhaps this happens because this block is inside a try/catch?

    Read the article

  • Fill 4 input with one textarea

    - by Patrice Poliquin
    I have a question for the community. My problem is that I have 4 input files with a maxlength of 60 caracters for a total of 240 caracters. Because the "backend" of the customer's system, it need to be 4 differents inputs max to be inserted and they say it is not user-friendly to fill 4 fields. My solution I want to make a textarea and when you fill it, il complete the 4 fields. [input text #1] max60 [input text #2] max60 [input text #3] max60 [input text #4] max60 [textarea max 240] What I am trying to do is to make by javascript/jQuery to fill up the four field while typing in. At the moment, here is my code. $(document).ready(function() { // My text area $("#inf_notes").bind('keydown', function () { var maxLength = 240; if ($(this).val().length <= 60) { // The first 60 caracters $('#inf_notes_1').val($(this).val()); } if ($(this).val().length > 60 && $(this).val().length <= 120) { // If more then 60, fill the second field $('#inf_notes_2').val($(this).val()); } // If 121 - 180 ... // If 181 - 240 ... if($(this).val().length == 240) { $(this).val($(this).val().substring(0, maxLength)); $('.alert_textarea').show(); // Simple alert else { $('.alert_textarea').hide(); } }); }); It actually works for the first one, but I would like to have some feedbacks to help me complete the script to fill the 3 nexts. Any guess to complete it? -- EDIT #1 I found a way that could maybe work! When the first input is completly filled, it will jump to the next field with a .focus() $(".inf_notes").bind('keydown', function () { var notes1 = $('#inf_notes_1').val(); var notes2 = $('#inf_notes_2').val(); var notes3 = $('#inf_notes_3').val(); if (notes1.length == 60) { $('#inf_notes_2').focus(); } if (notes2.length == 60) { $('#inf_notes_3').focus(); } if (notes3.length == 60) { $('#inf_notes_4').focus(); } });

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Possible to fire asp.net validation from jQuery?

    - by Abe Miessler
    I have a form with several text boxes on it. I only want to accept floats, but it is likely that users will enter a dollar sign. I'm using the following code to remove dollar signs and validate the content: jQuery: $("#<%= tb.ClientID %>").change(function() { var ctrl = $("#<%= tb.ClientID %>"); ctrl.val(ctrl.val().replace('$','')) }); asp.net validation: <asp:CompareValidator ID="CompareValidator4" runat="server" Type="Double" ControlToValidate="tb" Operator="DataTypeCheck" ValidationGroup="vld_Page" ErrorMessage="Some error" /> My problem is that when someone enters a dollar sign in the TextBox "tb" and changes focus the validation happens first and THEN the jQuery removes the dollar sign. Is it possible to have the jQuery run first or to force the validation to run again after the jQuery executes?

    Read the article

  • How can I fix this touch event / draw loop "deadlock"?

    - by Josh
    Just want to start out by saying this seems like a great site, hope you guys can help! I'm trying to use the structure laid out in LunarLander to create a simple game in which the user can drag some bitmaps around on the screen (the actual game is more complex, but that's not important). I ripped out the irrelevant parts of LanderLander, and set up my own bitmap drawing, something like BoardThread (an inner class of BoardView): run() { while(mRun) { canvas = lockSurfaceHolder... syncronized(mSurfaceHolder) { /* drawStuff using member position fields in BoardView */ } unlockSurfaceHolder } } My drawStuff simply walks through some arrays and throws bitmaps onto the canvas. All that works fine. Then I wanted to start handling touch events so that when the user presses a bitmap, it is selected, when the user unpresses a bitmap, it is deselected, and if a bitmap is selected during a touch move event, the bitmap is dragged. I did this stuff by listening for touch events in the BoardView's parent, BoardActivity, and passing them down into the BoardView. Something like In BoardView handleTouchEvent(MotionEvent e) { synchronized(mSurfaceHolder) { /* Modify shared member fields in BoardView so BoardThread can render the bitmaps */ } } This ALSO works fine. I can drag my tiles around the screen no problem. However, every once in a while, when the app first starts up and I trigger my first touch event, the handleTouchEvent stops executing at the synchronized line (as viewed in DDMS). The drawing loop is active during this time (I can tell because a timer changes onscreen), and it usually takes several seconds or more before a bunch of touch events come through the pipeline and everything is fine again. This doesn't seem like deadlock to me, since the draw loop is constantly going in and out of its syncronized block. Shouldn't this allow the event handling thread to grab a lock on mSurfaceHolder? What's going on here? Anyone have suggestions for improving how I've structured this? Some other info. This "hang" only ever occurs on first touch event after activity start. This includes on orientation change after restoreState has been called. Also, I can remove EVERYTHING within the syncronized block in the event handler, and it will still get hung up at the syncronized call. Thanks!

    Read the article

  • How can I add a border to all the elements that share a class when the mouse has hovered over one of

    - by Siracuse
    I have a generated HTML file which has large blocks of text with span's sprinkled throughout it with generated class names: This <span class="21232">an example</span> of what <span class="332423"> I'm talking</span> about. There are span's with <span class="21232"> generated ID's </span>. Now, what I'm seeking to do, is if I hover over any of my spans, they will add a border to not only that span, but all other spans that share that same class. So, if I were to hover over the first span, it would wrap a border around "an example" and "generated ID's" because the first and third span share the same class name. I was pretty sure I couldn't do it in straight CSS. Is this possible using jQuery? If so, can anyone point me in the right direction for doing this as simply as possible?

    Read the article

  • Rails 3 remote resubmit form with dynamic fields

    - by montrealmike
    I have a form which has remote => true. When i submit it the first time everything works well. If there are any errors i want to add new fields to this form. I did this with update.js.erb. The problem is that when i resubmit this form, the result js file is rendered as html (ie i see the js file text on the screen). This is the same update.js.erb file that was rendered as js the first time... Any idea what i'm missing?

    Read the article

  • php multidimensional array problem

    - by ntan
    Hi to all, i am trying to setup a multidimensional array but my problem is that i can not get the right order from incoming data. Explain $x[1][11]=11; $x[1]=1; var_dump($x); In the above code i get only x[1]. To right would be $x[1]=1; $x[1][11]=11; var_dump($x); But in my case i can dot ensure that x[1] will come first, and x[1][11] will come after. Is there any way that i can use the first example and get right the array. Keep in mind that the array depth is large. Thats

    Read the article

  • What lessons have you learned about using a wiki as a development tool?

    - by Vivek Kodira
    I'd asked a question a while back about ways to encourage my team to collaborate. The tool we use is a wiki. Since this is the first time we are using the wiki (formally and as a team), we are learning by committing mistakes. One of the lessons has been that a wiki isn't suitable for tracking activities. It is better to use a tool built for-the-job (will elaborate if necessary). Are there other such anti-patterns? What development tasks would you NOT recommend using a wiki for (even though it may seem suitable at first glance)? Edit: Making this a community-wiki since it is probably unlikely that there will be 'one' right answer.

    Read the article

< Previous Page | 603 604 605 606 607 608 609 610 611 612 613 614  | Next Page >