Search Results

Search found 19603 results on 785 pages for 'variable length'.

Page 609/785 | < Previous Page | 605 606 607 608 609 610 611 612 613 614 615 616  | Next Page >

  • Why are my attempts to open a file using open for writing failing? Ada 95

    - by mat_geek
    When I attempt to open a file to write to I get an Ada.IO_Exceptions.Name_Error. The procedure call is Ada.Text_IO.Open The file name is "C:\CC_TEST_LOG.TXT". This file does not exist. This is on Windows XP on an NTFS partition. The user has permissions to create and write to the directory. The filename is well under the WIN32 max path length. name_2 : String := "C:\CC_TEST_LOG.TXT" if name_2'last > name_2'first then begin Ada.Text_IO.Open(file, Ada.Text_IO.Out_File, name_2); Ada.Text_IO.Put_Line( "CC_Test_Utils: LogFile: ERROR: Open, File " & name_2); return; exception when The_Error : others => Ada.Text_IO.Put_Line( "CC_Test_Utils: LogFile: ERROR: Open Failed; " & Ada.Exceptions.Exception_Name(The_Error) & ", File " & name_2); end; end if;

    Read the article

  • How can I display the users profile pic using the facebook graph api?

    - by kielie
    Hi, I would like to display the users profile picture inside of my applications canvas page, is there a way to do that using the graph api? I know I can do it using FBML but I would also like to pass the profile pic to a flash game I am making, so I would have to get the profile pic from the api and send it as a variable, here is the code I have thus far, $facebook = new Facebook(array( 'appId' => FACEBOOK_APP_ID, 'secret' => FACEBOOK_SECRET_KEY, 'cookie' => true, 'domain' => 'myurl/facebook-test' )); $session = $facebook->getSession(); $uid = $facebook->getUser(); $me = $facebook->api('/me'); $updated = date("l, F j, Y", strtotime($me['updated_time'])); echo "Hello " . $me['name'] . $me['picture'] . "<br />"; echo "<div style=\"background:url(images/bg.jpg); width:760px; height:630px;\">" . "You last updated your profile on " . $updated . "</div>" . "<br /> your uid is" . $uid; Thanx in advance!

    Read the article

  • Valgrind says "stack allocation," I say "heap allocation"

    - by Joel J. Adamson
    Dear Friends, I am trying to trace a segfault with valgrind. I get the following message from valgrind: ==3683== Conditional jump or move depends on uninitialised value(s) ==3683== at 0x4C277C5: sparse_mat_mat_kron (sparse.c:165) ==3683== by 0x4C2706E: rec_mating (rec.c:176) ==3683== by 0x401C1C: age_dep_iterate (age_dep.c:287) ==3683== by 0x4014CB: main (age_dep.c:92) ==3683== Uninitialised value was created by a stack allocation ==3683== at 0x401848: age_dep_init_params (age_dep.c:131) ==3683== ==3683== Conditional jump or move depends on uninitialised value(s) ==3683== at 0x4C277C7: sparse_mat_mat_kron (sparse.c:165) ==3683== by 0x4C2706E: rec_mating (rec.c:176) ==3683== by 0x401C1C: age_dep_iterate (age_dep.c:287) ==3683== by 0x4014CB: main (age_dep.c:92) ==3683== Uninitialised value was created by a stack allocation ==3683== at 0x401848: age_dep_init_params (age_dep.c:131) However, here's the offending line: /* allocate mating table */ age_dep_data->mtable = malloc (age_dep_data->geno * sizeof (double *)); if (age_dep_data->mtable == NULL) error (ENOMEM, ENOMEM, nullmsg, __LINE__); for (int j = 0; j < age_dep_data->geno; j++) { 131=> age_dep_data->mtable[j] = calloc (age_dep_data->geno, sizeof (double)); if (age_dep_data->mtable[j] == NULL) error (ENOMEM, ENOMEM, nullmsg, __LINE__); } What gives? I thought any call to malloc or calloc allocated heap space; there is no other variable allocated here, right? Is it possible there's another allocation going on (the offending stack allocation) that I'm not seeing? You asked to see the code, here goes: /* Copyright 2010 Joel J. Adamson <[email protected]> $Id: age_dep.c 1010 2010-04-21 19:19:16Z joel $ age_dep.c:main file Joel J. Adamson -- http://www.unc.edu/~adamsonj Servedio Lab University of North Carolina at Chapel Hill CB #3280, Coker Hall Chapel Hill, NC 27599-3280 This file is part of an investigation of age-dependent sexual selection. This code is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This software is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with haploid. If not, see <http://www.gnu.org/licenses/>. */ #include "age_dep.h" /* global variables */ extern struct argp age_dep_argp; /* global error message variables */ char * nullmsg = "Null pointer: %i"; /* error message for conversions: */ char * errmsg = "Representation error: %s"; /* precision for formatted output: */ const char prec[] = "%-#9.8f "; const size_t age_max = AGEMAX; /* maximum age of males */ static int keep_going_p = 1; int main (int argc, char ** argv) { /* often used counters: */ int i, j; /* read the command line */ struct age_dep_args age_dep_args = { NULL, NULL, NULL }; argp_parse (&age_dep_argp, argc, argv, 0, 0, &age_dep_args); /* set the parameters here: */ /* initialize an age_dep_params structure, set the members */ age_dep_params_t * params = malloc (sizeof (age_dep_params_t)); if (params == NULL) error (ENOMEM, ENOMEM, nullmsg, __LINE__); age_dep_init_params (params, &age_dep_args); /* initialize frequencies: this initializes a list of pointers to initial frqeuencies, terminated by a NULL pointer*/ params->freqs = age_dep_init (&age_dep_args); params->by = 0.0; /* what range of parameters do we want, and with what stepsize? */ /* we should go from 0 to half-of-theta with a step size of about 0.01 */ double from = 0.0; double to = params->theta / 2.0; double stepsz = 0.01; /* did you think I would spell the whole word? */ unsigned int numparts = floor(to / stepsz); do { #pragma omp parallel for private(i) firstprivate(params) \ shared(stepsz, numparts) for (i = 0; i < numparts; i++) { params->by = i * stepsz; int tries = 0; while (keep_going_p) { /* each time through, modify mfreqs and mating table, then go again */ keep_going_p = age_dep_iterate (params, ++tries); if (keep_going_p == ERANGE) error (ERANGE, ERANGE, "Failure to converge\n"); } fprintf (stdout, "%i iterations\n", tries); } /* for i < numparts */ params->freqs = params->freqs->next; } while (params->freqs->next != NULL); return 0; } inline double age_dep_pmate (double age_dep_t, unsigned int genot, double bp, double ba) { /* the probability of mating between these phenotypes */ /* the female preference depends on whether the female has the preference allele, the strength of preference (parameter bp) and the male phenotype (age_dep_t); if the female lacks the preference allele, then this will return 0, which is not quite accurate; it should return 1 */ return bits_isset (genot, CLOCI)? 1.0 - exp (-bp * age_dep_t) + ba: 1.0; } inline double age_dep_trait (int age, unsigned int genot, double by) { /* return the male trait, a function of the trait locus, age, the age-dependent scaling parameter (bx) and the males condition genotype */ double C; double T; /* get the male's condition genotype */ C = (double) bits_popcount (bits_extract (0, CLOCI, genot)); /* get his trait genotype */ T = bits_isset (genot, CLOCI + 1)? 1.0: 0.0; /* return the trait value */ return T * by * exp (age * C); } int age_dep_iterate (age_dep_params_t * data, unsigned int tries) { /* main driver routine */ /* number of bytes for female frequencies */ size_t geno = data->age_dep_data->geno; size_t genosize = geno * sizeof (double); /* female frequencies are equal to male frequencies at birth (before selection) */ double ffreqs[geno]; if (ffreqs == NULL) error (ENOMEM, ENOMEM, nullmsg, __LINE__); /* do not set! Use memcpy (we need to alter male frequencies (selection) without altering female frequencies) */ memmove (ffreqs, data->freqs->freqs[0], genosize); /* for (int i = 0; i < geno; i++) */ /* ffreqs[i] = data->freqs->freqs[0][i]; */ #ifdef PRMTABLE age_dep_pr_mfreqs (data); #endif /* PRMTABLE */ /* natural selection: */ age_dep_ns (data); /* normalized mating table with new frequencies */ age_dep_norm_mtable (ffreqs, data); #ifdef PRMTABLE age_dep_pr_mtable (data); #endif /* PRMTABLE */ double * newfreqs; /* mutate here */ /* i.e. get the new frequency of 0-year-olds using recombination; */ newfreqs = rec_mating (data->age_dep_data); /* return block */ { if (sim_stop_ck (data->freqs->freqs[0], newfreqs, GENO, TOL) == 0) { /* if we have converged, stop the iterations and handle the data */ age_dep_sim_out (data, stdout); return 0; } else if (tries > MAXTRIES) return ERANGE; else { /* advance generations */ for (int j = age_max - 1; j < 0; j--) memmove (data->freqs->freqs[j], data->freqs->freqs[j-1], genosize); /* advance the first age-class */ memmove (data->freqs->freqs[0], newfreqs, genosize); return 1; } } } void age_dep_ns (age_dep_params_t * data) { /* calculate the new frequency of genotypes given additive fitness and selection coefficient s */ size_t geno = data->age_dep_data->geno; double w[geno]; double wbar, dtheta, ttheta, dcond, tcond; double t, cond; /* fitness parameters */ double mu, nu; mu = data->wparams[0]; nu = data->wparams[1]; /* calculate fitness */ for (int j = 0; j < age_max; j++) { int i; for (i = 0; i < geno; i++) { /* calculate male trait: */ t = age_dep_trait(j, i, data->by); /* calculate condition: */ cond = (double) bits_popcount (bits_extract(0, CLOCI, i)); /* trait-based fitness term */ dtheta = data->theta - t; ttheta = (dtheta * dtheta) / (2.0 * nu * nu); /* condition-based fitness term */ dcond = CLOCI - cond; tcond = (dcond * dcond) / (2.0 * mu * mu); /* calculate male fitness */ w[i] = 1 + exp(-tcond) - exp(-ttheta); } /* calculate mean fitness */ /* as long as we calculate wbar before altering any values of freqs[], we're safe */ wbar = gen_mean (data->freqs->freqs[j], w, geno); for (i = 0; i < geno; i++) data->freqs->freqs[j][i] = (data->freqs->freqs[j][i] * w[i]) / wbar; } } void age_dep_norm_mtable (double * ffreqs, age_dep_params_t * params) { /* this function produces a single mating table that forms the input for recombination () */ /* i is female genotype; j is male genotype; k is male age */ int i,j,k; double norm_denom; double trait; size_t geno = params->age_dep_data->geno; for (i = 0; i < geno; i++) { double norm_mtable[geno]; /* initialize the denominator: */ norm_denom = 0.0; /* find the probability of mating and add it to the denominator */ for (j = 0; j < geno; j++) { /* initialize entry: */ norm_mtable[j] = 0.0; for (k = 0; k < age_max; k++) { trait = age_dep_trait (k, j, params->by); norm_mtable[j] += age_dep_pmate (trait, i, params->bp, params->ba) * (params->freqs->freqs)[k][j]; } norm_denom += norm_mtable[j]; } /* now calculate entry (i,j) */ for (j = 0; j < geno; j++) params->age_dep_data->mtable[i][j] = (ffreqs[i] * norm_mtable[j]) / norm_denom; } } My current suspicion is the array newfreqs: I can't memmove, memcpy or assign a stack variable then hope it will persist, can I? rec_mating() returns double *.

    Read the article

  • osCommerce custom PHP page

    - by Afrosimon
    Hello! One of my client has an old osCommerce website and while working on it I have to implement what I would call "custom php page", i.e. a page which query a MySQL table, not related to osCommerce, and list the result. I'm not sure of the version, this trick I have seen a lot didn't gave me any result : http://www.clubosc.com/how-to-know-what-version-of-oscommerce-you-are-using.html . And I'm having a hard time doing this seemingly simple task, since osCommerce doesn't allow any php code in the page creation, and I didn't find any module giving me this possibility (not that it is easy to search in this mess : http://addons.oscommerce.com/). At this point I figured it would be easier to just hack'n slash through the code and come up with a custom page : I copied the index.php (the entry point in the application) : <?php require('includes/application_top.php'); if(!$smarty->is_cached($sContentPage, $sCachingGroup)) { //we switch on the content recognition require('includes/pages/' . $sContentClass . '.php'); } $smarty->display($sContentPage, $sCachingGroup); require(DIR_WS_INCLUDES . 'application_bottom.php'); ?> Here I gave a specific value to $sContentClass (with or without the if makes no difference) and customize the corresponding PHP file so it show my custom content but also initialize the same variable than those other PHP file in the pages/ folder. But alas, all of this curious and dubious code simply return me the home page. So here I am, is there an osCommerce Guru around here, or would anyone has a better idea (oh and I also posted on the osCommerce forum, but I'm still waiting for a response...)? Thanks a lot in advance.

    Read the article

  • Clustering on WebLogic exception on Failover

    - by Markos Fragkakis
    Hi all, I deploy an application on a WebLogic 10.3.2 cluster with two nodes, and a load balancer in front of the cluster. I have set the <core:init distributable="true" debug="true" /> My Session and Conversation classes implement Serializable. I start using the application being served by the first node. The console shows that the session replication is working. <Jun 17, 2010 11:43:50 AM EEST> <Info> <Cluster> <BEA-000128> <Updating 5903057688359791237S:xxx.yyy.gr:[7002,7002,-1,-1,-1,-1,-1]:xxx.yyy.gr:7002,xxx.yyy.gr:7002:prs_domain:PRS_Server_2 in the cluster.> <Jun 17, 2010 11:43:50 AM EEST> <Info> <Cluster> <BEA-000128> <Updating 5903057688359791237S:xxx.yyy.gr:[7002,7002,-1,-1,-1,-1,-1]:xxx.yyy.gr:7002,xxx.yyy.gr:7002:prs_domain:PRS_Server_2 in the cluster.> When I shutdown the first node from the Administration console, I get this in the other node: <Jun 17, 2010 11:23:46 AM EEST> <Error> <Kernel> <BEA-000802> <ExecuteRequest failed java.lang.NullPointerException. java.lang.NullPointerException at org.jboss.seam.intercept.JavaBeanInterceptor.callPostActivate(JavaBeanInterceptor.java:165) at org.jboss.seam.intercept.JavaBeanInterceptor.invoke(JavaBeanInterceptor.java:73) at com.myproj.beans.SortingFilteringBean_$$_javassist_seam_2.sessionDidActivate(SortingFilteringBean_$$_javassist_seam_2.java) at weblogic.servlet.internal.session.SessionData.notifyActivated(SessionData.java:2258) at weblogic.servlet.internal.session.SessionData.notifyActivated(SessionData.java:2222) at weblogic.servlet.internal.session.ReplicatedSessionData.becomePrimary(ReplicatedSessionData.java:231) at weblogic.cluster.replication.WrappedRO.changeStatus(WrappedRO.java:142) at weblogic.cluster.replication.WrappedRO.ensureStatus(WrappedRO.java:129) at weblogic.cluster.replication.LocalSecondarySelector$ChangeSecondaryInfo.run(LocalSecondarySelector.java:542) at weblogic.work.SelfTuningWorkManagerImpl$WorkAdapterImpl.run(SelfTuningWorkManagerImpl.java:516) at weblogic.work.ExecuteThread.execute(ExecuteThread.java:201) at weblogic.work.ExecuteThread.run(ExecuteThread.java:173) > What am I doing wrong? This is the SortingFilteringBean: import java.util.HashMap; import java.util.LinkedHashMap; import org.jboss.seam.ScopeType; import org.jboss.seam.annotations.Name; import org.jboss.seam.annotations.Scope; import com.myproj.model.crud.Filtering; import com.myproj.model.crud.Sorting; import com.myproj.model.crud.SortingOrder; /** * Managed bean aggregating the sorting and filtering values for all the * application's lists. A light-weight bean to always keep in the session with * minimum impact. */ @Name("sortingFilteringBean") @Scope(ScopeType.SESSION) public class SortingFilteringBean extends BaseManagedBean { private static final long serialVersionUID = 1L; private Sorting applicantProductListSorting; private Filtering applicantProductListFiltering; private Sorting homePageSorting; private Filtering homePageFiltering; /** * Creates a new instance of SortingFilteringBean. */ public SortingFilteringBean() { // ********************** // Applicant Product List // ********************** // Sorting LinkedHashMap<String, SortingOrder> applicantProductListSortingValues = new LinkedHashMap<String, SortingOrder>(); applicantProductListSortingValues.put("applicantName", SortingOrder.ASCENDING); applicantProductListSortingValues.put("applicantEmail", SortingOrder.ASCENDING); applicantProductListSortingValues.put("productName", SortingOrder.ASCENDING); applicantProductListSortingValues.put("productEmail", SortingOrder.ASCENDING); applicantProductListSorting = new Sorting( applicantProductListSortingValues); // Filtering HashMap<String, String> applicantProductListFilteringValues = new HashMap<String, String>(); applicantProductListFilteringValues.put("applicantName", ""); applicantProductListFilteringValues.put("applicantEmail", ""); applicantProductListFilteringValues.put("productName", ""); applicantProductListFilteringValues.put("productEmail", ""); applicantProductListFiltering = new Filtering( applicantProductListFilteringValues); // ********* // Home page // ********* // Sorting LinkedHashMap<String, SortingOrder> homePageSortingValues = new LinkedHashMap<String, SortingOrder>(); homePageSortingValues.put("productName", SortingOrder.ASCENDING); homePageSortingValues.put("productId", SortingOrder.ASCENDING); homePageSortingValues.put("productAtcCode", SortingOrder.UNSORTED); homePageSortingValues.put("productEmaNumber", SortingOrder.UNSORTED); homePageSortingValues.put("productOrphan", SortingOrder.UNSORTED); homePageSortingValues.put("productRap", SortingOrder.UNSORTED); homePageSortingValues.put("productCorap", SortingOrder.UNSORTED); homePageSortingValues.put("applicationTypeDescription", SortingOrder.ASCENDING); homePageSortingValues.put("applicationId", SortingOrder.ASCENDING); homePageSortingValues .put("applicationEmaNumber", SortingOrder.UNSORTED); homePageSortingValues .put("piVersionImportDate", SortingOrder.ASCENDING); homePageSortingValues.put("piVersionId", SortingOrder.ASCENDING); homePageSorting = new Sorting(homePageSortingValues); // Filtering HashMap<String, String> homePageFilteringValues = new HashMap<String, String>(); homePageFilteringValues.put("productName", ""); homePageFilteringValues.put("productAtcCode", ""); homePageFilteringValues.put("productEmaNumber", ""); homePageFilteringValues.put("applicationTypeId", ""); homePageFilteringValues.put("applicationEmaNumber", ""); homePageFilteringValues.put("piVersionImportDate", ""); homePageFiltering = new Filtering(homePageFilteringValues); } /** * @return the applicantProductListFiltering */ public Filtering getApplicantProductListFiltering() { return applicantProductListFiltering; } /** * @param applicantProductListFiltering * the applicantProductListFiltering to set */ public void setApplicantProductListFiltering( Filtering applicantProductListFiltering) { this.applicantProductListFiltering = applicantProductListFiltering; } /** * @return the applicantProductListSorting */ public Sorting getApplicantProductListSorting() { return applicantProductListSorting; } /** * @param applicantProductListSorting * the applicantProductListSorting to set */ public void setApplicantProductListSorting( Sorting applicantProductListSorting) { this.applicantProductListSorting = applicantProductListSorting; } /** * @return the homePageSorting */ public Sorting getHomePageSorting() { return homePageSorting; } /** * @param homePageSorting * the homePageSorting to set */ public void setHomePageSorting(Sorting homePageSorting) { this.homePageSorting = homePageSorting; } /** * @return the homePageFiltering */ public Filtering getHomePageFiltering() { return homePageFiltering; } /** * @param homePageFiltering * the homePageFiltering to set */ public void setHomePageFiltering(Filtering homePageFiltering) { this.homePageFiltering = homePageFiltering; } /** * For convenience to view in the Seam Debug page. * * @see java.lang.Object#toString() */ @Override public String toString() { StringBuilder sb = new StringBuilder(""); sb.append("\n\n"); sb.append("applicantProductListSorting"); sb.append(applicantProductListSorting); sb.append("\n\n"); sb.append("applicantProductListFiltering"); sb.append(applicantProductListFiltering); sb.append("\n\n"); sb.append("homePageSorting"); sb.append(homePageSorting); sb.append("\n\n"); sb.append("homePageFiltering"); sb.append(homePageFiltering); return sb.toString(); } } And this is the BaseManagedBean, inheriting the AbstractMutable. import java.io.IOException; import java.io.OutputStream; import java.util.List; import javax.faces.application.FacesMessage; import javax.faces.application.FacesMessage.Severity; import javax.faces.context.FacesContext; import javax.servlet.http.HttpServletResponse; import org.apache.commons.lang.ArrayUtils; import org.jboss.seam.core.AbstractMutable; import org.slf4j.Logger; import org.slf4j.LoggerFactory; import com.myproj.common.exceptions.WebException; import com.myproj.common.util.FileUtils; import com.myproj.common.util.StringUtils; import com.myproj.web.messages.Messages; public abstract class BaseManagedBean extends AbstractMutable { private static final Logger logger = LoggerFactory .getLogger(BaseManagedBean.class); private FacesContext facesContext; /** * Set a message to be displayed for a specific component. * * @param resourceBundle * the resource bundle where the message appears. Either base or * id may be used. * @param summaryResourceId * the id of the resource to be used as summary. For the detail * of the element, the element to be used will be the same with * the suffix {@code _detail}. * @param parameters * the parameters, in case the string is parameterizable * @param severity * the severity of the message * @param componentId * the component id for which the message is destined. Note that * an appropriate JSF {@code <h:message for="myComponentId">} tag * is required for the to appear, or alternatively a {@code * <h:messages>} tag. */ protected void setMessage(String resourceBundle, String summaryResourceId, List<Object> parameters, Severity severity, String componentId, Messages messages) { FacesContext context = getFacesContext(); FacesMessage message = messages.getMessage(resourceBundle, summaryResourceId, parameters); if (severity != null) { message.setSeverity(severity); } context.addMessage(componentId, message); } /** * Copies a byte array to the response output stream with the appropriate * MIME type and content disposition. The response output stream is closed * after this method. * * @param response * the HTTP response * @param bytes * the data * @param filename * the suggested file name for the client * @param mimeType * the MIME type; will be overridden if the filename suggests a * different MIME type * @throws IllegalArgumentException * if the data array is <code>null</code>/empty or both filename * and mimeType are <code>null</code>/empty */ protected void printBytesToResponse(HttpServletResponse response, byte[] bytes, String filename, String mimeType) throws WebException, IllegalArgumentException { if (response.isCommitted()) { throw new WebException("HTTP response is already committed"); } if (ArrayUtils.isEmpty(bytes)) { throw new IllegalArgumentException("Data buffer is empty"); } if (StringUtils.isEmpty(filename) && StringUtils.isEmpty(mimeType)) { throw new IllegalArgumentException( "Filename and MIME type are both null/empty"); } // Set content type (mime type) String calculatedMimeType = FileUtils.getMimeType(filename); // not among the known ones String newMimeType = mimeType; if (calculatedMimeType == null) { // given mime type passed if (mimeType == null) { // none available put default mime-type newMimeType = "application/download"; } else { if ("application/octet-stream".equals(mimeType)) { // small modification newMimeType = "application/download"; } } } else { // calculated mime type has precedence over given mime type newMimeType = calculatedMimeType; } response.setContentType(newMimeType); // Set content disposition and other headers String contentDisposition = "attachment;filename=\"" + filename + "\""; response.setHeader("Content-Disposition", contentDisposition); response.setHeader("Expires", "0"); response.setHeader("Cache-Control", "max-age=30"); response.setHeader("Pragma", "public"); // Set content length response.setContentLength(bytes.length); // Write bytes to response OutputStream out = null; try { out = response.getOutputStream(); out.write(bytes); } catch (IOException e) { throw new WebException("Error writing data to HTTP response", e); } finally { try { out.close(); } catch (Exception e) { logger.error("Error closing HTTP stream", e); } } } /** * Retrieve a session-scoped managed bean. * * @param sessionBeanName * the session-scoped managed bean name * @return the session-scoped managed bean */ protected Object getSessionBean(String sessionBeanName) { Object sessionScopedBean = FacesContext.getCurrentInstance() .getExternalContext().getSessionMap().get(sessionBeanName); if (sessionScopedBean == null) { throw new IllegalArgumentException("No such object in Session"); } else { return sessionScopedBean; } } /** * Set a session-scoped managed bean * * @param sessionBeanName * the session-scoped managed bean name * @return the session-scoped managed bean */ protected boolean setSessionBean(String sessionBeanName, Object sessionBean) { Object sessionScopedBean = FacesContext.getCurrentInstance() .getExternalContext().getSessionMap().get(sessionBeanName); if (sessionScopedBean == null) { FacesContext.getCurrentInstance().getExternalContext() .getSessionMap().put(sessionBeanName, sessionBean); } else { throw new IllegalArgumentException( "This session-scoped bean was already initialized"); } return true; } /** * For testing (enables mock of FacesContext) * * @return the faces context */ public FacesContext getFacesContext() { if (facesContext == null) { return FacesContext.getCurrentInstance(); } return facesContext; } /** * For testing (enables mocking of FacesContext). * * @param aFacesContext * a - possibly mock - faces context. */ public void setFacesContext(FacesContext aFacesContext) { this.facesContext = aFacesContext; } }

    Read the article

  • "echo" in functions or "echo" all page?

    - by jasmine
    Is this a good method to save to all index in a variable and then echo this? for example <?php $txt='<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=iso-8859-9" /> <link rel="stylesheet" type="text/css" href="css/style.css"/> <title>Untitled Document</title> </head> <body> <div class="wrapper"> <div class="header"> <h2>'.heaf_func().'</h2> </div> <div class="content">content</div> <div class="footer">footer</div> </div> </body> </html>'; echo $txt; ?>

    Read the article

  • Scalaz: request for use case for Cokleisli composition

    - by oxbow_lakes
    This question isn't meant as flame-bait! As it might be apparent, I've been looking at Scalaz recently. I'm trying to understand why I need some of the functionality that the library provides. Here's something: import scalaz._ import Scalaz._ type NEL[A] = NonEmptyList[A] val NEL = NonEmptyList I put some println statements in my functions to see what was going on (aside: what would I have done if I was trying to avoid side effects like that?). My functions are: val f: NEL[Int] => String = (l: NEL[Int]) => {println("f: " + l); l.toString |+| "X" } val g: NEL[String] => BigInt = (l: NEL[String]) => {println("g: " + l); BigInt(l.map(_.length).sum) } Then I combine them via a cokleisli and pass in a NEL[Int] val k = cokleisli(f) =>= cokleisli(g) println("RES: " + k( NEL(1, 2, 3) )) What does this print? f: NonEmptyList(1, 2, 3) f: NonEmptyList(2, 3) f: NonEmptyList(3) g: NonEmptyList(NonEmptyList(1, 2, 3)X, NonEmptyList(2, 3)X, NonEmptyList(3)X) RES: 57 The RES value is the character count of the (String) elements in the final NEL. Two things occur to me: How could I have known that my NEL was going to be reduced in this manner from the method signatures involved? (I wasn't expecting the result at all) What is the point of this? Can a reasonably simple and easy-to-follow use case be distilled for me? This question is a thinly-veiled plea for some lovely person like retronym to explain how this powerful library actually works.

    Read the article

  • Singleton with inheritance, Derived class is not able to get instantiated in parent?

    - by yesraaj
    Below code instantiates a derived singleton object based on environment variable. The compiler errors saying error C2512: 'Dotted' : no appropriate default constructor. I don't understand what the compiler is complaining about. #include <stdlib.h> #include <iostream> #include <string> using namespace std; class Dotted; class Singleton{ public: static Singleton instant(){ if (!instance_) { char * style = getenv("STYLE"); if (!style){ if (strcmp(style,"dotted")==0) { instance_ = new Dotted(); return *instance_; } } else{ instance_ = new Singleton(); return *instance_; } } return *instance_; } void print(){cout<<"Singleton";} ~Singleton(){}; protected: Singleton(){}; private: static Singleton * instance_; Singleton(const Singleton & ); void operator=(const Singleton & ); }; class Dotted:public Singleton{ public: void print(){cout<<"Dotted";} protected: Dotted(); }; Dotted::Dotted():Singleton(){} int main(){ Singleton::instant().print(); cin.get(); }

    Read the article

  • Getting minimum - Min() - for DateTime column in a DataTable using LINQ to DataSets?

    - by Jay Stevens
    I need to get the minimum DateTime value of a column in a DataTable. The DataTable is generated dynamically from a CSV file, therefore I don't know the name of that column until runtime. Here is code I've got that doesn't work... private DateTime GetStartDateFromCSV(string inputFile, string date_attr) { EnumerableRowCollection<DataRow> table = CsvStreamReader.GetDataTableFromCSV(inputFile, "input", true).AsEnumerable(); DateTime dt = table.Select(record => record.Field<DateTime>(date_attr)).Min(); return dt; } The variable table is broken out just for clarity. I basically need to find the minimum value as a DateTime for one of the columns (to be chosen at runtime and represented by date_attr). I have tried several solutions from SO (most deal with known columns and/or non-DateTime fields). What I've got throws an error at runtime telling me that it can't do the DateTime conversion (that seems to be a problem with Linq?) I've confirmed that the data for the column name that is in the string date_attr is a date value.

    Read the article

  • funny behavior of jquery code

    - by user253530
    Funny thing is that if i delete the comment for alert(data[i].id) the code works. As it is in the example, the string is not concatenated thus i have no options in the select box. Hints? Help? var bookmarkingSites = ''; $.getJSON("php/socialbookmark-get-bookmarking-sites.php",function(data){ for(var i = 0; i < data.length; i++){ //alert( data[i].id); bookmarkingSites += '<option value = \"' + data[i].id + '\">' + data[i].title + '</option>'; } }); <some more code> -------> toAppend += '<td><select name="sb2" id="sb2">'+ '<option value="'+ data.results[i].bookmark +'">' + data.results[i].bookmark +'</option>' + bookmarkingSites + '</select></td>'; <some more code>

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • System.OutOfMemoryException was thrown. at Go60505(RegexRunner ) at System.Text.RegularExpressions.C

    - by Deanvr
    Hi All, I am a c# dev working on some code for a website in vb.net. We use a lot of caching on a 32bit iss 6 win 2003 box and in some cases run into OutOfMemoryException exceptions. This is the code I trace it back to and would like to know if anyone else has has this... Public Sub CreateQueryStringNodes() 'Check for nonstandard characters' Dim key As String Dim keyReplaceSpaces As String Dim r As New Regex("^[-a-zA-Z0-9_]+$", RegexOptions.Compiled) For Each key In HttpContext.Current.Request.Form If Not IsNothing(key) Then keyReplaceSpaces = key.Replace(" ", "_") If r.IsMatch(keyReplaceSpaces) Then CreateNode(keyReplaceSpaces, HttpContext.Current.Request(key)) End If End If Next For Each key In HttpContext.Current.Request.QueryString If Not IsNothing(key) Then keyReplaceSpaces = key.Replace(" ", "_") If r.IsMatch(keyReplaceSpaces) Then CreateNode(keyReplaceSpaces, HttpContext.Current.Request(key).Replace("--", "-")) End If End If Next End Sub .NET Framework Version:2.0.50727.3053; ASP.NET Version:2.0.50727.3053 error: Exception of type 'System.OutOfMemoryException' was thrown. at Go60505(RegexRunner ) at System.Text.RegularExpressions.CompiledRegexRunner.Go() at System.Text.RegularExpressions.RegexRunner.Scan(Regex regex, String text, Int32 textbeg, Int32 textend, Int32 textstart, Int32 prevlen, Boolean quick) at System.Text.RegularExpressions.Regex.Run(Boolean quick, Int32 prevlen, String input, Int32 beginning, Int32 length, Int32 startat) at System.Text.RegularExpressions.Regex.IsMatch(String input) at Xcite.Core.XML.Write.CreateQueryStringNodes() at Xcite.Core.XML.Write..ctor(String IncludeSessionAndPostedData) at mysite._Default.Page_Load(Object sender, EventArgs e) at System.Web.UI.Control.OnLoad(EventArgs e) at System.Web.UI.Control.LoadRecursive() at thanks

    Read the article

  • Listing all possible values for SOAP enumeration with Python SUDS

    - by bdk
    I'm connecting with a SUDS client to a SOAP Server whose wsdl contains manu enumerations like the following: </simpleType> <simpleType name="FOOENUMERATION"> <restriction base="xsd:string"> <enumeration value="ALPHA"><!-- enum const = 0 --> <enumeration value="BETA"/><!-- enum const = 1 --> <enumeration value="GAMMA"/><!-- enum const = 2 --> <enumeration value="DELTA"/><!-- enum const = 3 --> </restriction> </simpleType> In my client I am receiving sequences which contain elements of these various enumeration types. My need is that given a member variable, I need to know all possible enumeration values. Basically I need a function which takes an instance of one of these enums and returns a list of strings which are all the possible values. When I have an instance, running: print type(foo.enumInstance) I get: <class 'suds.sax.text.Text'> I'm not sure how to get the actual simpleType name from this, and then get the possible values from that short of parsing the WSDL myself.

    Read the article

  • Accessing the selected element inside a templated textblock bound to a wpf listbox

    - by black sensei
    Hello good people , i'm trying to achieve a functionality but i'm don't know how to start it. I'm using vs 2008 sp1 and i'm consuming a webservice which returns a collection (is contactInfo[]) that i bind to a ListBox with little datatemplate on it. <ListBox Margin="-146,-124,-143,-118.808" Name="contactListBox" MaxHeight="240" MaxWidth="300" MinHeight="240" MinWidth="300"> <ListBox.ItemTemplate> <DataTemplate> <TextBlock> <CheckBox Name="contactsCheck" Uid="{Binding fullName}" Checked="contacts_Checked" /><Label Content="{Binding fullName}" FontSize="15" FontWeight="Bold"/> <LineBreak/> <Label Content="{Binding mobile}" FontSize="10" FontStyle="Italic" Foreground="DimGray" /> <Label Content="{Binding email}" FontStyle="Italic" FontSize="10" Foreground="DimGray"/> </TextBlock> </DataTemplate> </ListBox.ItemTemplate> </ListBox> Every works fine so far. so When a checkbox is checked i'll like to access the information of the labels (either the) belonging to the same row or attached to it and append the information to a global variable for example (for each checkbox checked). My problem right now is that i don't know how to do that. Can any one shed some light on how to do that? if you notice Checked="contacts_Checked" that's where i planned to perform the operations. thanks for reading and helping out

    Read the article

  • SoundManager / Jquery : Get SoundID sID

    - by j-man86
    So I am trying to access a jquery soundmanager variable from one script (wpaudio.js – from the wp-audio plugin) inside of another (init.js – my own javascript). I am creating an alternate pause/play button higher up on the page and need to resume the current soundID, which is contained as part of a class name in the DOM. Here is the code that creates that class name in wpaudio.js: function wpaButtonCheck() { if (!this.playState || this.paused) jQuery('#' + this.sID + '_play').attr('src', wpa_url + '/wpa_play.png'); else jQuery('#' + this.sID + '_play').attr('src', wpa_url + '/wpa_pause.png'); } Here is the output: <img src="http://24.232.185.173/wordpress/wp-content/plugins/wpaudio-mp3-player/wpa_play.png" class="wpa_play" id="wpa0_play"> where wpa0 would be the sID of the sound I need. My current script in init.js is: $('.mixesSidebar #currentSong .playBtn').toggle(function() { soundManager.pauseAll(); $(this).addClass('paused'); }, function() { soundManager.resumeAll(); $(this).removeClass('paused'); }); I need to change resumeAll to "resume(this.sID)", but I need to somehow store the sID onclick and call it in the above function. Alternately, I think a regular expression that could get the class name of the current play button and either parse the string up to the "_play" or use a trim function to get rid of "_play"– but I'm not sure how to do this. Thanks for your help!

    Read the article

  • Custom Validation Attribute with Custom Model Binder in MVC 2

    - by griegs
    I apologise for the amount of code I have included. I've tried to keep it to a minimum. I'm trying to have a Custom Validator Attribute on my model as well as a Custom Model binder. The Attribute and the Binder work great seperately but if I have both, then the Validation Attribute no longer works. Here is my code snipped for readability. If I leave out the code in global.asax the custom validation fires but not if I have the custom binder enabled. Validation Attribute; public class IsPhoneNumberAttribute : ValidationAttribute { public override bool IsValid(object value) { //do some checking on 'value' here return true; } } Useage of the attribute in my model; [Required(ErrorMessage = "Please provide a contact number")] [IsPhoneNumberAttribute(ErrorMessage = "Not a valid phone number")] public string Phone { get; set; } Custom Model Binder; public class CustomContactUsBinder : DefaultModelBinder { protected override void OnModelUpdated(ControllerContext controllerContext, ModelBindingContext bindingContext) { ContactFormViewModel contactFormViewModel = bindingContext.Model as ContactFormViewModel; if (!String.IsNullOrEmpty(contactFormViewModel.Phone)) if (contactFormViewModel.Phone.Length > 10) bindingContext.ModelState.AddModelError("Phone", "Phone is too long."); } } Global asax; System.Web.Mvc.ModelBinders.Binders[typeof(ContactFormViewModel)] = new CustomContactUsBinder();

    Read the article

  • PHP, We have sessions, and cookies....I love cookies, but they are blowing my mind right now.

    - by Matt
    I am not sure how to go about accessing the variable I need to set on a cookie... I was thinking about using the $_POST global but I dont know how based on my design if it will work. I am using a master page type design seperating index.php from my function includes and database information and individual pages (that will be returned to an include in index.php based on a $_GET) Okay so back to my question. What is the most efficient way to set a cookie on a design that has a main page that everything will branch from. How would I pull the value. Is $_POST a good enough way to go about it? Also...by saying it must be the first thing sent...does that mean I cannot run any serverside scripts before that? I could definately utilize a login query I think but I dont want to write code just to be dissapointed based on my lack of time and knowledge. I did search for answers...I know this most likely feels like a generic question that could be answered in a difference place...but I know I will get an accurate and professional answer here...so I dont want to bet on the half answers I found otherwise. Of course I will sanitize everything and not store any sensitive information (passwords,address,phone,or anything really for that matter besides some kind of session ID and the username) If this is confusing I am sorry but I am on a gov computer...and they lock these tighter than ft knox...so getting my code on here will be a chore until I get back to my room. Thanks, Matt

    Read the article

  • JAVASCRIPT changing on click

    - by Webby
    Hello, Id like some help changing this javascript onclick event to just load the data on page the page load... Preferably not using the body on load tag... So obviously I'd pre set the var for term inside the script term rather than the excisting on click event.. Hope that made sense <p><a id="keywordlink" href="?term=wombats">Get keywords for wombats</a></p> <script type="text/javascript" src="keywords.js"></script> <script type="text/javascript"> var x = document.getElementById('keywordlink'); if(x){ x.onclick = function(){ var term = this.href.split('=')[1]; this.innerHTML += ' (loading...)'; KEYWORDS.get(term,seed); return false; } } function seed(o){ var div = document.createElement('div'); var head = document.createElement('h2'); head.innerHTML = 'Keywords for '+o.term; div.appendChild(head); var p = document.createElement('p'); p.innerHTML = o.toplist; div.appendChild(p); var head = document.createElement('h3'); head.innerHTML = 'Details:'; div.appendChild(head); var list = document.createElement('ol'); for(var i=0,j=o.keywords.length;i<j;i++){ var li = document.createElement('li'); li.innerHTML = o.keywords[i].term + '('+o.keywords[i].amount+')'; list.appendChild(li); } div.appendChild(list); x.parentNode.replaceChild(div,x); } </script>

    Read the article

  • Java: volatile guarantees and out-of-order execution

    - by WizardOfOdds
    Note that this question is solely about the volatile keyword and the volatile guarantees: it is not about the synchronized keyword (so please don't answer "you must use synchronize" for I don't have any issue to solve: I simply want to understand the volatile guarantees (or lack of guarantees) regarding out-of-order execution). Say we have an object containing two volatile String references that are initialized to null by the constructor and that we have only one way to modify the two String: by calling setBoth(...) and that we can only set their references afterwards to non-null reference (only the constructor is allowed to set them to null). For example (it's just an example, there's no question yet): public class SO { private volatile String a; private volatile String b; public SO() { a = null; b = null; } public void setBoth( @NotNull final String one, @NotNull final String two ) { a = one; b = two; } public String getA() { return a; } public String getB() { return b; } } In setBoth(...), the line assigning the non-null parameter "a" appears before the line assigning the non-null parameter "b". Then if I do this (once again, there's no question, the question is coming next): if ( so.getB() != null ) { System.out.println( so.getA().length ); } Am I correct in my understanding that due to out-of-order execution I can get a NullPointerException? In other words: there's no guarantee that because I read a non-null "b" I'll read a non-null "a"? Because due to out-of-order (multi)processor and the way volatile works "b" could be assigned before "a"? volatile guarantees that reads subsequent to a write shall always see the last written value, but here there's an out-of-order "issue" right? (once again, the "issue" is made on purpose to try to understand the semantics of the volatile keyword and the Java Memory Model, not to solve a problem).

    Read the article

  • How do you create a non-Thread-based Guice custom Scope?

    - by Russ
    It seems that all Guice's out-of-the-box Scope implementations are inherently Thread-based (or ignore Threads entirely): Scopes.SINGLETON and Scopes.NO_SCOPE ignore Threads and are the edge cases: global scope and no scope. ServletScopes.REQUEST and ServletScopes.SESSION ultimately depend on retrieving scoped objects from a ThreadLocal<Context>. The retrieved Context holds a reference to the HttpServletRequest that holds a reference to the scoped objects stored as named attributes (where name is derived from com.google.inject.Key). Class SimpleScope from the custom scope Guice wiki also provides a per-Thread implementation using a ThreadLocal<Map<Key<?>, Object>> member variable. With that preamble, my question is this: how does one go about creating a non-Thread-based Scope? It seems that something that I can use to look up a Map<Key<?>, Object> is missing, as the only things passed in to Scope.scope() are a Key<T> and a Provider<T>. Thanks in advance for your time.

    Read the article

  • Using both chunked transfer encoding and gzip

    - by RadiantHeart
    I recently started using gzip on my site and it worked like charm on all browsers except Opera which gives an error saying it could not decompress the content due to damaged data. From what I can gather from testing and googling it might be a problem with using both gzip and chunked transfer encoding. The fact that there is no error when requesting small files like css-files also points in that direction. Is this a known issue or is there something else that I havent thought about? Someone also mentioned that it could have something to do with sending a Content-Length header. Here is a simplified version of the most relevant part of my code: $contents = ob_get_contents(); ob_end_clean(); header('Content-Encoding: '.$encoding); print("\x1f\x8b\x08\x00\x00\x00\x00\x00"); $size = strlen($contents); $contents = gzcompress($contents, 9); $contents = substr($contents, 0, $size); print($contents); exit();

    Read the article

  • problems with infinite loop

    - by Tom
    function addAds($n) { for ($i=0;$i<=$n;$i++) { while($row=mysql_fetch_array(mysql_query("SELECT * FROM users"))) { $aut[]=$row['name']; } $author=$aut[rand(0,mysql_num_rows(mysql_query("SELECT * FROM users")))]; $name="pavadinimas".rand(0,3600); $rnd=rand(0,1); if($rnd==0) { $type="siulo"; } else { $type="iesko"; } $text="tekstas".md5("tekstas".rand(0,8000)); $time=time()-rand(3600,86400); $catid=rand(1,9); switch ($catid) { case 1: $subid=rand(1,8); break; case 2: $subid=rand(9,16); break; case 3: $subid=rand(17,24); break; case 4: $subid=rand(25,32); break; case 5: $subid=rand(33,41); break; case 6: $subid=rand(42,49); break; case 7: $subid=rand(50,56); break; case 8: $subid=rand(57,64); break; case 9: $subid=rand(65,70); break; } mysql_query("INSERT INTO advert(author,name,type,text,time,catid,subid) VALUES('$author','$name','$type','$text','$time','$catid','$subid')") or die(mysql_error()); } echo "$n adverts successfully added."; } The problem with this function, is that it never loads. As I noticed, my while loop causes it. If i comment it, everything is ok. It has to get random user from my db and set it to variable $author.

    Read the article

  • CURL & web.py: transfer closed with outstanding read data remaining

    - by Richard J
    Hi Folks, I have written a web.py POST handler, thus: import web urls = ('/my', 'Test') class Test: def POST(self): return "Here is your content" app = web.application(urls, globals()) if __name__ == "__main__": app.run() When I interact with it using Curl from the command line I get different responses depending on whether I post it any data or not: curl -i -X POST http://localhost:8080/my HTTP/1.1 200 OK Transfer-Encoding: chunked Date: Thu, 06 Jan 2011 16:42:41 GMT Server: CherryPy/3.1.2 WSGI Server Here is your content (Posting of no data to the server gives me back the "Here is your content" string) curl -i -X POST --data-binary "@example.zip" http://localhost:8080/my HTTP/1.1 100 Content-Length: 0 Content-Type: text/plain HTTP/1.1 200 OK Transfer-Encoding: chunked Date: Thu, 06 Jan 2011 16:43:47 GMT Server: CherryPy/3.1.2 WSGI Server curl: (18) transfer closed with outstanding read data remaining (Posting example.zip to the server results in this error) I've scoured the web.py documentation (what there is of it), and can't find any hints as to what might be going on here. Possibly something to do with 100 continue? I tried writing a python client which might help clarify: h1 = httplib.HTTPConnection('localhost:8080') h1.request("POST", "http://localhost:8080/my", body, headers) print h1.getresponse() body = the contents of the example.zip, and headers = empty dictionary. This request eventually timed out without printing anything, which I think exonerates curl from being the issue, so I believe something is going on in web.py which isn't quite right (or at least not sufficiently clear) Any web.py experts got some tips? Cheers, Richard

    Read the article

  • JQuery traverse DOM and extract node value

    - by Alex
    I have the following DOM: <div class="qtip qtip-light qtip-active"> <div class="qtip-wrapper"> <div class="qtip-borderTop"></div> <div class="qtip-contentWrapper"> <div class="qtip-title"> <div class="qtip-button"></div> **Text I need to extract** </div> <div class="qtip-content"> <div class="tooltip"> <div class="button-container"> <script type="text/javascript"> var link = null; var link = $('.qtip-active > .qtip-title').val(); $('.qtip-active > #button-container').append('<a href=\"mailto:' + link + '\">' + link + '</a>'); </script> </div> </div> </div> </div> <div class="qtip-borderBottom"></div> </div> </div> But the variable link is always undefined when I would expect it to return the text the node specified. I've been reading the jquery documentation for a few hours but I must be missing something with my logic (or lack there of). Any help appreciated...

    Read the article

  • How do I DRY up my CouchDB views?

    - by James A. Rosen
    What can I do to share code among views in CouchDB? Example 1 -- utility methods Jesse Hallett has some good utility methods, including function dot(attr) { return function(obj) { return obj[attr]; } } Array.prototype.map = function(func) { var i, r = [], for (i = 0; i < this.length; i += 1) { r[i] = func(this[i]); } return r; }; ... Where can I put this code so every view can access it? Example 2 -- constants Similarly for constants I use in my application. Where do I put MyApp = { A_CONSTANT = "..."; ANOTHER_CONSTANT = "..."; }; Example 3 -- filter of a filter: What if I want a one view that filters by "is this a rich person?": function(doc) { if (doc.type == 'person' && doc.net_worth > 1000000) { emit(doc.id, doc); } } and another that indexes by last name: function(doc) { if (doc.last_name) { emit(doc.last_name, doc); } } How can I combine them into a "rich people by last name" view? I sort of want the equivalent of the Ruby my_array.select { |x| x.person? }.select { |x| x.net_worth > 1,000,000 }.map { |x| [x.last_name, x] } How can I be DRYer?

    Read the article

< Previous Page | 605 606 607 608 609 610 611 612 613 614 615 616  | Next Page >