miss spider - Page 61 - Developer IT

Loading a RSA private key from memory using libxmlsec

- by ereOn

Hello, I'm currently using libxmlsec into my C++ software and I try to load a RSA private key from memory. To do this, I searched trough the API and found this function. It takes binary data, a size, a format string and several PEM-callback related parameters. When I call the function, it just stucks, uses 100% of the CPU time and never returns. Quite annoying, because I have no way of finding out what is wrong. Here is my code: d_xmlsec_dsig_context->signKey = xmlSecCryptoAppKeyLoadMemory( reinterpret_cast<const xmlSecByte*>(data), static_cast<xmlSecSize>(datalen), xmlSecKeyDataFormatBinary, NULL, NULL, NULL ); data is a const char* pointing to the raw bytes of my RSA key (using i2d_RSAPrivateKey(), from OpenSSL) and datalen the size of data. My test private key doesn't have a passphrase so I decided not to use the callbacks for the time being. Has someone already done something similar ? Do you guys see anything that I could change/test to get forward on this problem ? I just discovered the library on yesterday, so I might miss something obvious here; I just can't see it. Thank you very much for your help.

Read the article

How would you answer Joel's sample programming questions?

- by Khorkrak

I recently interviewed a candidate for a new position here. I wish though that I'd read Joel's Guerrilla Guide to Interviewing prior to that interview - naturally I happened upon it the night afterwards :P http://www.joelonsoftware.com/articles/GuerrillaInterviewing3.html So I tried answering the easy questions myself - yeah I used the python interpreter to type stuff in and tested the results a bit - I didn't look up any solutions beforehand though and I also thought about how long it took me to come up with answers for each one and what I'd look for the next time I interview someone. I'd let them type stuff into the interpreter and see how did used python's introspection capabilities too to find out things like what's the re module's method for building a regex etc. Here are my answers - these are in python of course - what are yours in your favourite language? Do you see any issues with the answers I came up with - i.e. how could they be improved upon - what did I miss? Joel's example questions: Write a function that determines if a string starts with an upper-case letter A-Z. import re upper_regex = re.compile("^[A-Z]") def starts_with_upper(text): return upper_regex.match(text) is not None Write a function that determines the area of a circle given the radius. from math import pi def area(radius): return pi * radius**2 Add up all the values in an array. sum([1, 2, 3, 4, 5]) Harder Question: Write an example of a recursive function - so how about the classic factorial one: def factorial(num): if num > 1: return num * factorial(num - 1) else: return 1

Read the article

iPhone: UIImagePickerController Randomly Fails to Take Picture

- by pion

I use a UIPickerViewController to take picture. It works 80% but seemingly at random it fails to take a picture. In tracing the code I found out that it occasionally goes to -PinRecordNewTableViewController:viewDidUnload. That is where it fails because it set nil to all ivars. @interface PinRecordNewTableViewController : UITableViewController { } ... @implementation PinRecordNewTableViewController ... - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { ... PinRecordNewPicture *pinRecordNewPicture = [[PinRecordNewPicture alloc] initWithNibName:@"PinRecordNewPicture" bundle:nil]; pinRecordNewPicture.delegate = self; [self.navigationController pushViewController:pinRecordNewPicture animated:YES]; [pinRecordNewPicture release]; ... } @interface PinRecordNewPicture : UIViewController ... @implementation PinRecordNewPicture ... - (void)picturePicker:(UIImagePickerControllerSourceType)theSource { UIImagePickerController *picker = [[UIImagePickerController alloc] init]; picker.delegate = self; picker.sourceType = theSource; picker.allowsEditing = YES; [self presentModalViewController:picker animated:YES]; [picker release]; } - (IBAction) takePicture:(id)sender { UIImagePickerControllerSourceType source = UIImagePickerControllerSourceTypeCamera; if ([UIImagePickerController isSourceTypeAvailable:source]) { [self picturePicker:source]; } What did I do wrong? Did I miss something that causes it to behave "randomly"? Thanks in advance for your help.

Read the article

Passing Control's Value to Modal Popup

- by Sherwin Valdez

Hello, Just would like know how to pass textbox value to a modal popup after clicking a button using ModalPopUpExtender in ASP.NET, I've tried these codes but seems that I have no luck :( <script runat="server"> protected void Page_Load(object sender, EventArgs e) { Button1.Attributes.Add("onclick", "showModalPopup(); return false;"); } </script> <asp:ScriptManager ID="ScriptManager1" runat="server"> </asp:ScriptManager> <asp:TextBox ID="TextBox1" runat="server"></asp:TextBox> <asp:Button ID="Button1" runat="server" Text="Button" OnClick='showModalPopup(); return false;' /> <cc1:ModalPopupExtender ID="ModalPopupExtender1" runat="server" TargetControlID="Button1" PopupControlID="Panel1" CancelControlID="btnCancel" OkControlID="btnOkay" BackgroundCssClass="ModalPopupBG"> </cc1:ModalPopupExtender> <asp:Panel ID="Panel1" Style="display: none" runat="server"> <div class="HellowWorldPopup"> <div class="PopupHeader" id="PopupHeader"> Header</div> <div class="PopupBody"> <asp:Label ID="Label1" runat="server"></asp:Label> </div> <div class="Controls"> <input id="btnOkay" type="button" value="Done" /> <input id="btnCancel" type="button" value="Cancel" /> </div> </div> </asp:Panel> javascript function showModalPopup() { //show the ModalPopupExtender var value; value = document.getElementById("TextBox1").value; $get("<%=Label1.ClientID %>").value = value; $find("<%=ModalPopupExtender1.ClientID %>").show(); } I wonder what I miss out :(, Thanks and I hope someone could help me :)

Read the article

Groovlet not working in GWT project, container : embedded Jetty in google plugin

- by user325284

Hi, I am working on a GWT application which uses GWT-RPC. I just made a test groovlet to see if it worked, but ran into some problems here's my groovlet package groovy.servlet; print "testing the groovlet"; Every tutorial said we don't need to subclass anything, and just a simple script would act as a servlet. my web.xml looks like this -  <servlet> <servlet-name>testGroovy</servlet-name> <servlet-class>groovy.servlet.testGroovy</servlet-class> </servlet> <servlet-mapping> <servlet-name>testGroovy</servlet-name> <url-pattern>*.groovy</url-pattern> </servlet-mapping When I Run as - web application, i get the following error from jetty : [WARN] failed testGroovy javax.servlet.UnavailableException: Servlet class groovy.servlet.testGroovy is not a javax.servlet.Servlet at org.mortbay.jetty.servlet.ServletHolder.checkServletType(ServletHolder.java:377) at org.mortbay.jetty.servlet.ServletHolder.doStart(ServletHolder.java:234) at org.mortbay.component.AbstractLifeCycle.start(AbstractLifeCycle.java:39) at org.mortbay.jetty.servlet.ServletHandler.initialize(ServletHandler.java:616) at org.mortbay.jetty.servlet.Context.startContext(Context.java:140) at org.mortbay.jetty.webapp.WebAppContext.startContext(WebAppContext.java:1220) at org.mortbay.jetty.handler.ContextHandler.doStart(ContextHandler.java:513) at org.mortbay.jetty.webapp.WebAppContext.doStart(WebAppContext.java:448) at com.google.gwt.dev.shell.jetty.JettyLauncher$WebAppContextWithReload.doStart(JettyLauncher.java:447) at org.mortbay.component.AbstractLifeCycle.start(AbstractLifeCycle.java:39) at org.mortbay.jetty.handler.HandlerWrapper.doStart(HandlerWrapper.java:130) at org.mortbay.jetty.handler.RequestLogHandler.doStart(RequestLogHandler.java:115) at org.mortbay.component.AbstractLifeCycle.start(AbstractLifeCycle.java:39) at org.mortbay.jetty.handler.HandlerWrapper.doStart(HandlerWrapper.java:130) at org.mortbay.jetty.Server.doStart(Server.java:222) at org.mortbay.component.AbstractLifeCycle.start(AbstractLifeCycle.java:39) at com.google.gwt.dev.shell.jetty.JettyLauncher.start(JettyLauncher.java:543) at com.google.gwt.dev.DevMode.doStartUpServer(DevMode.java:421) at com.google.gwt.dev.DevModeBase.startUp(DevModeBase.java:1035) at com.google.gwt.dev.DevModeBase.run(DevModeBase.java:783) at com.google.gwt.dev.DevMode.main(DevMode.java:275) What did I miss ?

Read the article

Parameterized Queries /Without/ using queries.

- by Aren B

I've got a bit of a poor situation here. I'm stuck working with commerce server, which doesn't do a whole lot of sanitization/parameterization. I'm trying to build up my queries to prevent SQL Injection, however some things like the searches / where clause on the search object need to be built up, and there's no parameterized interface. Basically, I cannot parameterize, however I was hoping to be able to use the same engine to BUILD my query text if possible. Is there a way to do this, aside from writing my own parameterizing engine which will probably still not be as good as parameterized queries? Update: Example The where clause has to be built up as a sql query where clause essentially: CatalogSearch search = /// Create Search object from commerce server search.WhereClause = string.Format("[cy_list_price] > {0} AND [Hide] is not NULL AND [DateOfIntroduction] BETWEEN '{1}' AND '{2}'", 12.99m, DateTime.Now.AddDays(-2), DateTime.Now); *Above Example is how you refine the search, however we've done some testing, this string is NOT SANITIZED. This is where my problem lies, because any of those inputs in the .Format could be user input, and while i can clean up my input from text-boxes easily, I'm going to miss edge cases, it's just the nature of things. I do not have the option here to use a parameterized query because Commerce Server has some insane backwards logic in how it handles the extensible set of fields (schema) & the free-text search words are pre-compiled somewhere. This means I cannot go directly to the sql tables What i'd /love/ to see is something along the lines of: SqlCommand cmd = new SqlCommand("[cy_list_price] > @MinPrice AND [DateOfIntroduction] BETWEEN @StartDate AND @EndDate"); cmd.Parameters.AddWithValue("@MinPrice", 12.99m); cmd.Parameters.AddWithValue("@StartDate", DateTime.Now.AddDays(-2)); cmd.Parameters.AddWithValue("@EndDate", DateTime.Now); CatalogSearch search = /// constructor search.WhereClause = cmd.ToSqlString();

Read the article

Looking for Hardware that will easily interface with my .NET code.

- by SkippyFire

I'm a .NET C# developer looking to do some hardware interfacing/programming. I just want something super simple to mess around with. I have done one of those basic stamp projects, but I want something with less electrical work. A self-contained piece of hardware would be fine. I'm not really looking to do embedded programming... but that would actually be pretty cool if something was capable of running .net code. I'm looking for something that would be easy to connect, hopefully via USB. Serial ports seems to be more hit or miss nowadays with laptops and netbooks. Something I can easily send data to, like a mini LCD, or series of LED's. Better yet would be something that provides feedback, like a temperature sensor. The best would be something more featured that I could talk to. I would be able to send data to it, and it would send back responses. Maybe something like a servo that could report it's position? Or maybe something that I could set parameters on? Any ideas? Thanks in advance!

Read the article

Jquery with multi level json data array

- by coder

Read the article

How to Disable/Enable WYSIWYG editor in Magento 1.4

- by latvian

Hi When entering code in CMS static block(possible page as well) and in this code there is empty DIV tags such us: <a href="javascript:hide1(),show2(),hide3()"><div class="dropoff_button"></div></a> The DIV tags will be gone next time you open the block to edit. it will look as this <a href="javascript:hide1(),show2(),hide3()"> </a> without the div tags ...and saving again it modifies your code. I think it something to do with the 'show/hide editor'. By default it goes into the WYSIWYG editor, so when updating static block i don't see any other solution than 1."hide the editor' by clicking 'show/hide editor' 2.delete the old code from the editor 3. get code that doesn't miss the DIVs 4. Merge new code with code in 3 in some other editing software than magento 5. paste result in the magento editor, 6. Save Is this bug? What is your solution? Can i turn of WYSIWYG editor?

Read the article

What are alternatives to Win32 PulseEvent() function?

- by Bill

The documentation for the Win32 API PulseEvent() function (kernel32.dll) states that this function is “… unreliable and should not be used by new applications. Instead, use condition variables”. However, condition variables cannot be used across process boundaries like (named) events can. I have a scenario that is cross-process, cross-runtime (native and managed code) in which a single producer occasionally has something interesting to make known to zero or more consumers. Right now, a well-known named event is used (and set to signaled state) by the producer using this PulseEvent function when it needs to make something known. Zero or more consumers wait on that event (WaitForSingleObject()) and perform an action in response. There is no need for two-way communication in my scenario, and the producer does not need to know if the event has any listeners, nor does it need to know if the event was successfully acted upon. On the other hand, I do not want any consumers to ever miss any events. In other words, the system needs to be perfectly reliable – but the producer does not need to know if that is the case or not. The scenario can be thought of as a “clock ticker” – i.e., the producer provides a semi-regular signal for zero or more consumers to count. And all consumers must have the correct count over any given period of time. No polling by consumers is allowed (performance reasons). The ticker is just a few milliseconds (20 or so, but not perfectly regular). Raymen Chen (The Old New Thing) has a blog post pointing out the “fundamentally flawed” nature of the PulseEvent() function, but I do not see an alternative for my scenario from Chen or the posted comments. Can anyone please suggest one? Please keep in mind that the IPC signal must cross process boundries on the machine, not simply threads. And the solution needs to have high performance in that consumers must be able to act within 10ms of each event.

Read the article

Basic jUnit Questions

- by Epitaph

I was testing a String multiplier class with a multiply() method that takes 2 numbers as inputs (as String) and returns the result number (as String) `public String multiply(String num1, String num2); I have done the implementation and created a test class with the following test cases involving the input String parameter as 1) valid numbers 2) characters 3) special symbol 4) empty string 5) Null value 6) 0 7) Negative number 8) float 9) Boundary values 10) Numbers that are valid but their product is out of range 11) numbers will + sign (+23) 1) I'd like to know if "each and every" assertEquals() should be in it's own test method? Or, can I group similar test cases like testInvalidArguments() to contains all asserts involving invalid characters since ALL of them throw the same NumberFormatException ? 2) If testing an input value like character ("a"), do I need to include test cases for ALL scenarios? "a" as the first argument "a" as the second argument "a" and "b" as the 2 arguments 3) As per my understanding, the benefit of these unit tests is to find out the cases where the input from a user might fail and result in an exception. And, then we can give the user with a meaningful message (asking them to provide valid input) instead of an exception. Is that the correct? And, is it the only benefit? 4) Are the 11 test cases mentioned above sufficient? Did I miss something? Did I overdo? When is enough? 5) Following from the above point, have I successfully tested the multiply() method?

Read the article

Defining jUnit Test cases Correctly

- by Epitaph

I am new to Unit Testing and therefore wanted to do some practical exercise to get familiar with the jUnit framework. I created a program that implements a String multiplier public String multiply(String number1, String number2) In order to test the multiplier method, I created a test suite consisting of the following test cases (with all the needed integer parsing, etc) @Test public class MultiplierTest { Multiplier multiplier = new Multiplier(); // Test for 2 positive integers assertEquals("Result", 5, multiplier.multiply("5", "1")); // Test for 1 positive integer and 0 assertEquals("Result", 0, multiplier.multiply("5", "0")); // Test for 1 positive and 1 negative integer assertEquals("Result", -1, multiplier.multiply("-1", "1")); // Test for 2 negative integers assertEquals("Result", 10, multiplier.multiply("-5", "-2")); // Test for 1 positive integer and 1 non number assertEquals("Result", , multiplier.multiply("x", "1")); // Test for 1 positive integer and 1 empty field assertEquals("Result", , multiplier.multiply("5", "")); // Test for 2 empty fields assertEquals("Result", , multiplier.multiply("", "")); In a similar fashion, I can create test cases involving boundary cases (considering numbers are int values) or even imaginary values. 1) But, what should be the expected value for the last 3 test cases above? (a special number indicating error?) 2) What additional test cases did I miss? 3) Is assertEquals() method enough for testing the multiplier method or do I need other methods like assertTrue(), assertFalse(), assertSame() etc 4) Is this the RIGHT way to go about developing test cases? How am I "exactly" benefiting from this exercise? 5)What should be the ideal way to test the multiplier method? I am pretty clueless here. If anyone can help answer these queries I'd greatly appreciate it. Thank you.

Read the article

Publish Maven artifacts on FTP with Hudson FTP Publisher Plugin

- by jaguard

I'm building a number of artefacts (zip files for different environments: test, dev) using the maven-assembly-plugin using a specialized Maven profile. These artefacts I want to copy/collect on on a FTP server keeping the version (01.07.10.16.Wed-1626) as a folder, so I need to copy from test/build/01.07.10.16.Wed-1626/ to ftp://my-ftp-server:21/projects/myserver-1.7/01.07.10.16.Wed-1626/ The layout for the Maven output is this: target/ build/ 01.07.10.16.Wed-1626/ my-server-01.07.10.16.Wed-1626-dev.zip my-server-01.07.10.16.Wed-1626-test.zip For copying the artefacts I'm using FTP Publisher Plugin but it seams I miss something since that even the build is OK and the artefacts are build without problem but the job is finishing without copying the artefacts, and in the console there is no log info about copying the artefacts My FTP publisher config (FTP repository hosts) is: Hostname: my-ftp-server Port: 21 Timeout: 10000 Root Repository Path: projects User Name: my-user Password: my-pass My Hudson job FTP publisher config (Publish artifacts to FTP) is: FTP site: my-ftp-server Files to upload Source: target/build/** Destination: myserver-1.7 1: There is any log to check if there are any FTP copy errors ? 2: There is any problem with the file pattern (source) or with the dest ?

Read the article

Search for string allowing for one mismatches in any location of the string, Python

- by Vincent

I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

Read the article

Long running stateful service in .NET

- by Asaf R

Hi, I need to create a service in .NET that maintains (inner) state in-memory, spawns multiple threads and is generally long-running. There are a lot options - Good-old Windows Service Windows Communication Services Windows Workflow Foundation I really don't know which to choose. Most of the functionality is in a library used by this service, so the service itself is rather simple. On one hand, it's important the service host is as close to "simply working" as possible, which excludes Windows Service. On the other hand, it's important that the service is not taken down by the host just because there's no external activity, which makes WCF kind o' "scary". As for WF, it's strongest selling point is the ability to create processes as, um..., workflows, which is something I don't need nor want. To sum it up, the plethora of Microsoft technologies got me a bit confused. I'd appreciate help regarding the pros and cons of each solution (or other's I've failed to mention) for the problem of a stateful, long running service in .NET Thanks, Asaf P.S., I'm using .NET 4. EDIT: What I mean by the host "simply working" is, for example, that the service I create be reactivated if it crashes. I guess the reason for this question is that I've created Windows Services in the past (I think it was in plain C++ with Win32 API), and I don't want to miss out on something simpler if there's is such as thing. Thanks for all the replies thus far! Asaf.

Read the article

How to use delegate to perform callback between caller and web service helper class?

- by codemonkie

I have 2 classes A and B, where they belongs to the same namespace but resides in seperate files namely a.cs and b.cs, where class B essentially is a helper wrapping a web service call as follow: public class A { public A() // constructor { protected static B b = new B(); } private void processResult1(string result) { // come here when result is successful } private void processResult2(string result) { // come here when result is failed } static void main() { b.DoJobHelper(...); } } public class B { private com.nowhere.somewebservice ws; public B() { this.ws = new com.nowhere.somewebservice(); ws.JobCompleted += new JobCompletedEventHandler(OnCompleted); } void OnCompleted(object sender, JobCompletedEventArgs e) { string s = e.Result; Guid taskID = (Guid)e.UserState; switch (s) { case "Success": // Call processResult1(); break; case "Failed": // Call processResult2(); break; default: break; } } public void DoJobHelper() { Object userState = Guid.NewGuid(); ws.DoJob(..., userState); } } (1) I have seen texts on the net on using delegates for callbacks but failed to apply that to my case. All I want to do is to call the appropriate processResult() method upon OnCompleted() event, but dunno how to and where to declare the delegate: public delegate void CallBack(string s); (2) There is a sender object passed in to OnCompleted() but never used, did I miss anything there? Or how can I make good use of sender? Any helps appreciated.

Read the article

check status application pool iis7 with csharp (access-denied)

- by jack

I need to monitor the status of an application in the applications pool of IIS 7 from an other machine on the same domain. My monitoring application must be in C# and running as a Windows service. On my server, I create a user with administration rights and I execute the command aspnet_regiis -ga machine\username wich worked succesfully. My problem is when I try to access the application pool i still get COMExcepttion "Access denied". What did i do wrong or wich step did i miss? I used code from http://patelshailesh.com/index.php/create-a-website-application-pool-programmatically-using-csharp as example. int status = 0; string ipAddress = "10.20.2.13"; string username = "username"; string password = "password"; try { DirectoryEntry de = new DirectoryEntry(string.Format("IIS://{0}/W3SVC/AppPools/MyAppPoolName", ipAddress), username, password); //the exception is thron here. status = (int)de.InvokeGet("AppPoolState"); switch (status) { case 2: //Runnig break; case 4: //Stopped break; default: break; } } catch (Exception ex) { }

Read the article

Development environment for ASP.NET with EpiServer

- by Binary255

At our company we are going to develop more for the Windows platform than we have done up until now. As this scale of Windows development is new to us it would be nice with some feedback from experienced developers. Requirements we have: 5 developers from the beginning. 15 developers a year from now. All developers should be able to develop at the same time. Be able to develop solution for ASP.NET and EpiServer 5. Our idea: A shared server which developers use for development through Terminal Services. SQL Server Express. Start with some free express edition of Visual Studio, upgrade to a commercial version if we need the additional features. Use IIS and not the web server built into Visual Studio. Questions: Are we on the right track? In terms of license costs the above should be cheapest, right? What do you think about multiple developers doing development using a shared TS-server? Do you know of any company which has a similar development environment? Are we going to miss some features of the full Visual Studio version immediately? Is using Express version a bad choice? Is IIS the best choice? If use IIS the developers may use the same port for deployment. If we use the built in web server each one has to set their own port as we're sharing a machine. Comment answer: We are thinking about a shared server as it will most likely decrease the license costs. So it's purely a cost issue. We are using CVS for version control. Our situation is that we develop on Mac and Linux, that's why buying 1 server license + Visual Studio licenses seems to be a cost effective way of starting this type of development.

Read the article

Project with multiple binaries in Eclipse CDT

- by Robert Schneider

I think it is quite normal to have more than one binary in a project. However, with Eclipse CDT I don't know how to set up the IDE to get things done. I know I can create several projects - one per binary. And I know I can set the dependencies per project. However, I cannot regard them as one project in Eclipse. If I'd like to share the code with a version control system (like svn), each developer has to import the projects separately. What I miss is something like the Solution (sln file) in Visual Studio. Should I create a single project and create the make files by myself? I haven't tried it out yet, but there is this 'project set' which can be ex- and imported. Is this the solution? Can this be put into version control? My goal it to put everything under version control, not only subprojects. I cannot imagine that CDT makes only sense for single-binary applications. How can I work properly?

Read the article

Why won't this DOM element disappear?

- by George Edison

I have a page that uses jQuery with a small glitch. I managed to get this down to a simple example that demonstrates the problem: <html> <head> <script type="text/javascript" src="jquery.js"></script> <script type="text/javascript"> function hideIt() { $('#hideme').fadeOut('slow', function() { $(this).remove(); } ); } </script> </head> <body> <div id='#hideme'>Hide me!</div> <button onclick='hideIt();'>Hide</button> </body> </html> As you would expect, the problem is simple: the caption doesn't disappear. What simple thing did I overlook? (Or if it's not a simple thing, what complicated thing did I miss?)

Read the article

What ever happened to APL?

- by lkessler

When I was at University 30 years ago, I used a programming language called APL. I believe the acronym stood for "A Programming Language", This language was interpretive and was especially useful for array and matrix operations with powerful operators and library functions to help with that. Did you use APL? Is this language still in use anywhere? Is it still available, either commercially or open source? I remember the combinatorics assignment we had. It was complex. It took a week of work for people to program it in PL/1 and those programs ranged from 500 to 1000 lines long. I wrote it in APL in under an hour. I left it at 10 lines for readability, although I should have been a purist and worked another hour to get it into 1 line. The PL/1 programs took 1 or 2 minutes to run on the IBM mainframe and solve the problem. The computer charge was $20. My APL program took 2 hours to run and the charge was $1,500 which was paid for by our Computer Science Department's budget. That's when I realized that a week of my time is worth way more than saving some $'s in someone else's budget. I got an A+ in the course. p.s. Don't miss this presentation entitled: "APL one of the greatest programming languages ever"

Read the article

Suggestions on how build an HTML Diff tool?

- by Danimal

In this post I asked if there were any tools that compare the structure (not actual content) of 2 HTML pages. I ask because I receive HTML templates from our designers, and frequently miss minor formatting changes in my implementation. I then waste a few hours of designer time sifting through my pages to find my mistakes. The thread offered some good suggestions, but there was nothing that fit the bill. "Fine, then", thought I, "I'll just crank one out myself. I'm a halfway-decent developer, right?". Well, once I started to think about it, I couldn't quite figure out how to go about it. I can crank out a data-driven website easily enough, or do a CMS implementation, or throw documents in and out of BizTalk all day. Can't begin to figure out how to compare HTML docs. Well, sure, I have to read the DOM, and iterate through the nodes. I have to map the structure to some data structure (how??), and then compare them (how??). It's a development task like none I've ever attempted. So now that I've identified a weakness in my knowledge, I'm even more challenged to figure this out. Any suggestions on how to get started? clarification: the actual content isn't what I want to compare -- the creative guys fill their pages with lorem ipsum, and I use real content. Instead, I want to compare structure: <div class="foo">lorem ipsum<div> is different that <div class="foo"><p>lorem ipsum<p><div>

Read the article

Why is XmlSerializer so hard to use?

- by mafutrct

I imagine to use XML serialization like this: class Foo { public Foo (string name) { Name1 = name; Name2 = name; } [XmlInclude] public string Name1 { get; private set; } [XmlInclude] private string Name2; } StreamWriter wr = new StreamWriter("path.xml"); new XmlSerializer<Foo>().Serialize (wr, new Foo ("me")); But this does not work at all: XmlSerializer is not generic. I have to cast from and to object on (de)serialization. Every property has to be fully public. Why aren't we just using Reflection to access private setters? Private fields cannot be serialized. I'd like to decorate private fields with an attribute to have XmlSerializer include them. Did I miss something and XmlSerializer is actually offering the described possibilities? Are there alternate serializers to XML that handle these cases more sophisticatedly? If not: We're in 2010 after all, and .NET has been around for many years. XML serialization is often used, totally standard and should be really easy to perform. Or is my understanding possibly wrong and XML serialization ought not to expose the described features for a good reason? (Feel free to adjust caption or tags. If this should be CW, please just drop a note.)

Read the article

In ParallelPython, a method of an object ( object.func() ) fails to manipulate a variable of an object ( object.value )

- by mehmet.ali.anil

With parallelpython, I am trying to convert my old serial code to parallel, which heavily relies on objects that have methods that change that object's variables. A stripped example in which I omit the syntax in favor of simplicity: class Network: self.adjacency_matrix = [ ... ] self.state = [ ... ] self.equilibria = [ ... ] ... def populate_equilibria(self): # this function takes every possible value that self.state can be in # runs the boolean dynamical system # and writes an integer within self.equilibria for each self.state # doesn't return anything I call this method as: Code: j1 = jobserver.submit(net2.populate_equilibria,(),(),("numpy as num")) The job is sumbitted, and I know that a long computation takes place, so I speculate that my code is ran. The problem is, i am new to parallelpython , I was expecting that, when the method is called, the variable net2.equilibria would be written accordingly, and I would get a revised object (net2) . That is how my code works, independent objects with methods that act upon the object's variables. Rather, though the computation is apparent, and reasonably timed, the variable net2.equilibria remains unchanged. As if PP only takes the function and the object, computes it elsewhere, but never returns the object, so I am left with the old one. What do I miss? Thanks in advance.

Read the article

Is Annotation in Javascript? If not, how to switch between debug/productive modes in declarative way

- by Michael Mao

Hi all: This is but a curious question. I cannot find any useful links from Google so it might be better to ask the gurus here. The point is: is there a way to make "annotation" in javascript source code so that all code snippets for testing purpose can be 'filtered out' when project is deployed from test field into the real environment? I know in Java, C# or some other languages, you can assign an annotation just above the function name, such as : // it is good to remove the annoying warning messages @SuppressWarnings("unchecked") public class Tester extends TestingPackage { ... } Basically I've got a lot of testing code that prints out something into FireBug console. I don't wanna manually "comment out" them because the guy that is going to maintain the code might not be aware of all the testing functions, so he/she might just miss one function and the whole thing can be brought down to its knees. One other thing, we might use a minimizer to "shrink" the source code into "human unreadable" code and boost up performance (just like jQuery.min), so trying to match testing section out of the mess is not possible for plain human eyes in the future. Any suggestion is much appreciated.

Search Results

Search found 1838 results on 74 pages for 'miss spider'.

Page 61/74 | < Previous Page | 57 58 59 60 61 62 63 64 65 66 67 68 | Next Page >

- by ereOn

- by Khorkrak

- by pion

- by Sherwin Valdez

- by user325284

- by Aren B

- by SkippyFire

- by coder

- by latvian

- by Bill

- by Epitaph

- by Epitaph

- by jaguard

- by Vincent

- by Asaf R

- by codemonkie

- by jack

- by Binary255

- by Robert Schneider

- by George Edison

- by lkessler

- by Danimal

- by mafutrct

- by mehmet.ali.anil

- by Michael Mao

< Previous Page | 57 58 59 60 61 62 63 64 65 66 67 68 | Next Page >