Search Results

Search found 40441 results on 1618 pages for 'function templates'.

Page 610/1618 | < Previous Page | 606 607 608 609 610 611 612 613 614 615 616 617  | Next Page >

  • Codeigniter Inputting session data from model for a simple authentication system

    - by user1616244
    Trying to put together a simple login authentication. Been at this for quite sometime, and I can't find where I'm going wrong. Pretty new to Codeigniter and OOP PHP. I know there are authentication libraries out there, but I'm not interested in using those. Model: function login($username, $password){ if ($this->db->table_exists($username)){ $this->db->where('username', $username); $this->db->where('password', $password); $query = $this->db->get($username); if($query->num_rows >= 1) { return true; $data = array( 'username' => $this->input->post('username'), 'login' => true ); $this->session->set_userdata($data); } } } Controller function __construct(){ parent::__construct(); $this->logincheck(); } public function logincheck(){ if ($this->session->userdata('login')){ redirect('/members'); } } If I just echo from the controller: $this-session-all_userdata(); I get an empty array. So the problem seems to be that the $data array in the model isn't being stored in the session.

    Read the article

  • PHP Magic faster than simply setting the class attribute?

    - by Marc Trudel
    Well, not exactly that, but here is an example. Can anyone explain the difference between B and C? How can it be faster to use a magic function to dynamically set a value instead of simply setting the value in the attribute definition? Here is some code: [root@vm-202-167-238-17 ~]# cat test.php; for d in A B C; do echo "------"; ./test.php $d; done; #!/usr/bin/php <?php $className = $argv[1]; class A { public function __get($a) { return 5; } } class B { public $a = 5; } class C { public function __get($a) { $this->a = 5; return 5; } } $a = new $className; $start = microtime(true); for ($i=0; $i < 1000000; $i++) $b = $a->a; $end = microtime(true); echo (($end - $start) * 1000) ." msec\n"; ------ 598.90794754028 msec ------ 205.48391342163 msec ------ 189.7759437561 msec

    Read the article

  • Getting Response From Jquery JSON

    - by Howdy_McGee
    I'm having trouble getting a response from my php jquery / json / ajax. I keep combining all these different tutorials together but I still can't seem to pull it all together since no one tutorial follow what I'm trying to do. Right now I'm trying to pass two arrays (since there's no easy way to pass associative arrays) to my jquery ajax function and just alert it out. Here's my code: PHP $names = array('john doe', 'jane doe'); $ids = array('123', '223'); $data['names'] = $names; $data['ids'] = $ids; echo json_encode($data); Jquery function getList(){ $.ajax({ type: "GET", url: 'test.php', data: "", complete: function(data){ var test = jQuery.parseJSON(data); alert(test.names[0]); alert("here"); } }, "json"); } getList(); In my html file all I'm really calling is my javascript file for debugging purposes. I know i'm returning an object but I'm getting an error with null values in my names section, and i'm not sure why. What am I missing? My PHP file returns {"names":["john doe","jane doe"],"ids":["123","223"]} It seems to be just ending here Uncaught TypeError: Cannot read property '0' of undefined so my sub0 is killing me.

    Read the article

  • jQuery indexOf select box manipulation

    - by kenny99
    Hi, I'm trying to figure out how to remove options from a select box when that option has been selected in an adjacent select box. Basically the user has the option to add multiple records here via select boxes, but I want to remove the list of options available to them so that, for example, they can't enter the same value in two select boxes. When an Add More button is clicked, I fade in the next select box container. A number of select boxes have been generated by PHP and I use JS to hide them. Each select box has a unique number appended to the ID, so i want to access those select boxes which contain the string "other_pet_types", then I want to iterate through the currently visible ones and build an array of the values which have been selected, which I will then remove from the list of options in the newly displayed select box. This is what I have so far, but it's definitely not right - I can't get the initial test on the ID to work. Any pointers greatly appreciated as i realise i'm pretty wide of the mark at the moment! var vals = new Array(); //build array with currently selected options $('p.mult_entries select').each(function(){ vals += $(this).val(); }); $("p.mult_entries:hidden:first").fadeIn("slow", function() { $(this).find(('select').attr('id').indexOf('other_pet_types') > 0).each(function(){ console.log($(this).val()); //as expected prints nothing - need to iterate through the options of the above select //once i extract the correct values, iterate through new select box and use inArray to remove options where that value already exists in one of previous select boxes }); });

    Read the article

  • WCF - "Encountered unexpected character 'c'."

    - by Villager
    Hello, I am trying to do something that I thought would be simple. I need to create a WCF service that I can post to via JQuery. I have an operation in my WCF service that is defined as follows: [OperationContract] [WebInvoke(Method = "POST", BodyStyle = WebMessageBodyStyle.WrappedRequest, RequestFormat=WebMessageFormat.Json, ResponseFormat=WebMessageFormat.Json)] public string SendMessage(string message, int urgency) { try { // Do stuff return "1"; // 1 represents success } catch (Exception) { return "0"; } } I then try to access this operation from an ASP.NET page via JQuery. My JQuery code to access this operation looks like the following: function sendMessage(message) { $.ajax({ url: "/resources/services/myService.svc/SendMessage", type: "POST", contentType: "application/json; charset=utf-8", data: ({ message: message, urgency: '1' }), dataType: "json", success: function (data) { alert("here!"); }, error: function (req, msg, obj) { alert("error: " + req.responseText); } }); } When I execute this script, the error handler is tripped. In it, I receive an error that says: "Encountered unexpected character 'c'." This message is included with a long stack trace. My question is, what am I doing wrong? I have received other posts such as this one (http://stackoverflow.com/questions/320291/how-to-post-an-array-of-complex-objects-with-json-jquery-to-asp-net-mvc-controll) without any luck. How do I get this basic interaction working? Thank you!

    Read the article

  • datepicker not working in chrome

    - by DotnetSparrow
    I have a Jquery UI datepicker control in my asp.net MVC application and it works fine in IE and Firefox but it doens't work in chrome when I click the datepicker button. Here is my Index view: $(function() { $('#datepicker').datepicker({ changeMonth: true, dateFormat: "dd M yy", changeYear: true, showButtonPanel: true, autoSize: true, altField: "input#txtDate", onSelect: function(dateText, inst) { $.ajax({ type: "POST", url: "/LiveGame/Partial3?gameDate=" + dateText, dataType: "html", success: function(result) { var domElement = $(result); $("#dvGames").html(domElement); } }); } }); $("#txtDate").val($.format.date(new Date(), 'dd MMM yyyy')); $('#dvGames').load( '<%= Url.Action("Partial3", "LiveGame") %>', { gameDate: $("#txtDate").val() } ); }); Here is my partial: public ActionResult Partial3(string gameDate) { return PartialView("Partial3", gameDate); } <div id="dvGames" class="cornerdate1"> <%= Url.Action("LiveGame","Partial3") %> </div> <input type="text" id="txtDate" name="txtDate" readonly="readonly" class="cornerdate" /> <input id="datepicker" class="cornerimage" type="image" src="../../Content/images/calendar.gif" alt="date" /> </div>

    Read the article

  • Ajax return string links not working

    - by Andreas Lympouras
    I have this ajax function: function getSearchResults(e) { var searchString = e.value; /*var x = e.keyCode; var searchString = String.fromCharCode(x);*/ if (searchString == "") { document.getElementById("results").innerHTML = ""; return; } var xmlhttp; if (window.XMLHttpRequest) {// code for IE7+, Firefox, Chrome, Opera, Safari xmlhttp = new XMLHttpRequest(); } else {// code for IE6, IE5 xmlhttp = new ActiveXObject("Microsoft.XMLHTTP"); } xmlhttp.onreadystatechange = function () { if (xmlhttp.readyState == 4 && xmlhttp.status == 200) { document.getElementById("results").innerHTML = xmlhttp.responseText; } } xmlhttp.open("GET", "<%=Page.ResolveUrl("~/template/searchHelper.aspx?searchString=")%>"+searchString, true); xmlhttp.setRequestHeader("If-Modified-Since", "Sat, 1 Jan 2000 00:00:00 GMT"); //solve any AJAX caching problem(not refreshing) xmlhttp.send(); } and here is when I call it: <input class="text-input" value="SEARCH" id="searchbox" onkeyup="javascript:getSearchResults(this);" maxlength="50" runat="server" /> and all my links in the searchHelper.aspx file(which retruns them as a string) are like this: <a class="item" href='../src/actors.aspx?id=77&name=dasdassss&type=a' > <span class="item">dasdassss</span></a> When I click this link I want my website to go to ../src/actors.aspx?id=77&name=dasdassss&type=a but nothing happens. When I hover over the link, it also shows me where the link is about to redirect! any help?

    Read the article

  • Best suited tool to document message processing done in C written program

    - by user3494614
    I am relatively new to UML and it's seems to be very vast I have a small program which basically receives messages on socket and then depending upon message ID embedded as first byte of message it processes the buffer. There are around 5 different message ID which it processes and communicates on another socket and has around 8 major functions. So program in short is like this. I am not pasting entire .c file or main function but just giving some bits and pieces of it so that to get idea of program flow. int main(int argc, char** argv) { register_shared_mem(); listen(); while(get_next_message(buffer)) { switch((msg)(buffer)->id) { case TYPE1: process1(); answer(); ..... } } } I want to document this is pictorial way like for Message type 1 it calls this function which calls another and which calls another. Please let me know any open source tool which will allow me to quickly draw such kind of UML or sequence diagram and will also allow me to write brief description of what each function does? Thanks In Advance

    Read the article

  • Reading from an write-only(OUT) parameter in pl/sql

    - by sqlgrasshopper5
    When I tried writing to an read-only parameter(IN) of a function, Oracle complains with an error. But that is not the case when reading from an write-only(OUT) parameter of a function. Oracle silently allows this without any error. What is the reason for this behaviour?. The following code executes without any assignment happening to "so" variable: create or replace function foo(a OUT number) return number is so number; begin so := a; --no assignment happens here a := 42; dbms_output.put_line('HiYA there'); dbms_output.put_line('VAlue:' || so); return 5; end; / declare somevar number; a number := 6; begin dbms_output.put_line('Before a:'|| a); somevar := foo(a); dbms_output.put_line('After a:' || a); end; / Here's the output I got: Before a:6 HiYA there VAlue: After a:42

    Read the article

  • <input type="file"> reads only file name not full path

    - by Deep
    I am using Glassfish Server.I have seen the apache file upload to solve it...but i want to implement it in glassfish server. image.html <form action="" method="post" enctype="multipart/form-data"> Select a file: <input type="file" name="first" id="first"/> <br /> <input type="button" name="button" value="upload" id="button" /> <p id="test"></p> <img src='Unknown.png' id="profile_img" height="200px" width="150px"/> </form> test.js $(document).ready(function() { var filepath= $("#first"); $('#button').click(function() { $.ajax({ type: "post", url: "imageservlet", data: "user="+filepath.val(), success: function(msg) { $("#profile_img").attr('src',msg); $("#test").html(msg) .fadeIn("fast"); } }); }); }); imageservlet.java String user=request.getParameter("user"); out.print(user); the output is file name not full path.

    Read the article

  • Convert enumeration to string

    - by emptyheaded
    I am trying to build a function that converts an item from an enum to its corresponding string. The enums I use are fairly long, so I didn't want to use a switch-case. I found a method using boost::unordered_map very convenient, but I don't know how to make a default return (when there is no item matching the enum). const boost::unordered_map<enum_type, const std::string> enumToString = boost::assign::map_list_of (data_1, "data_1") (data_2, "data_2"); I tried to create an additional function: std::string convert(enum_type entry) { if (enumToString.find(entry)) // not sure what test to place here, return enumToString.at(entry); //because the find method returns an iter else return "invalid_value"; } I even tried something exceedingly wrong: std::string convert(enum_type entry) { try{ return enumToString.at(entry); } catch(...){ return "invalid_value"; } } Result: evil "Debug" runtime error. Can somebody give me a suggestion on how to either 1) find an easier method to convert enum to a string with the same name as the enum item 2) find a way to use already built boost methods to get a default value from a hash map (best option) 3) find what to place in the test to use a function that returns either the pair of the key-value, or a different string if the key is not found in the map. Thank you very much.

    Read the article

  • How to get <td> value in textbox

    - by Shreeuday Kasat
    I've done some code in html and in JavaScript ... My query is when I click on <td>, whatever the value associated with it, has to be displayed in the corresponding text box ... In front of <td> I've taken the textbox ... for an example I've taken 3 <td> and 3 textboxes <script type="text/javascript"> function click3(x) { x = document.getElementById("name").innerHTML var a = document.getElementById("txt"); a.value = x; } function click1(y) { y = document.getElementById("addr").innerHTML var b = document.getElementById("txt1"); b.value = y; } function click2(z) { z = document.getElementById("email").innerHTML var c = document.getElementById("txt2"); c.value = z; } </script> this is my JavaScript code , I know this is not an adequate way to deal such problem, since its giving static way to deal with this problem does anyone have a better solution for this problem ?? In JavaScript/jQuery

    Read the article

  • Loading city/state from SQL Server to Google Maps?

    - by knawlejj
    I'm trying to make a small application that takes a city & state and geocodes that address to a lat/long location. Right now I am utilizing Google Map's API, ColdFusion, and SQL Server. Basically the city and state fields are in a database table and I want to take those locations and get marker put on a Google Map showing where they are. This is my code to do the geocoding, and viewing the source of the page shows that it is correctly looping through my query and placing a location ("Omaha, NE") in the address field, but no marker, or map for that matter, is showing up on the page: function codeAddress() { <cfloop query="GetLocations"> var address = document.getElementById(<cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput>).value; if (geocoder) { geocoder.geocode( {<cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput>: address}, function(results, status) { if (status == google.maps.GeocoderStatus.OK) { var marker = new google.maps.Marker({ map: map, position: results[0].geometry.location, title: <cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput> }); } else { alert("Geocode was not successful for the following reason: " + status); } }); } </cfloop> } And here is the code to initialize the map: var geocoder; var map; function initialize() { geocoder = new google.maps.Geocoder(); var latlng = new google.maps.LatLng(42.4167,-90.4290); var myOptions = { zoom: 5, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP } var marker = new google.maps.Marker({ position: latlng, map: map, title: "Test" }); map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); } I do have a map working that uses lat/long that was hard coded into the database table, but I want to be able to just use the city/state and convert that to a lat/long. Any suggestions or direction? Storing the lat/long in the database is also possible, but I don't know how to do that within SQL.

    Read the article

  • Javascript FAQ drop down

    - by kdipaolo
    Im trying to create a simple FAQ drop down but for some reason it is not working. Would you mind taking a look? Thanks guys! CSS #faqs h3 { cursor:pointer; } #faqs h3.active { color:#d74646; } #faqs div { height:0; overflow:hidden; position:relative; } #faqs div p { padding:0; margin-bottom:15px; } JavaScript: $(document).ready(function() { $('#faqs h3').each(function() { var tis = $(this), state = false, answer = tis.next('div') .hide() .css('height','auto') .slideUp(); tis.click(function() { state = !state; answer.slideToggle(state); tis.toggleClass('active',state); }); }); }); HTML <div id="faqs"> <h3>This is question 1?</h3> <div> <p>This is the answer to question #1.</p> </div> <h3>This is question 2?</h3> <div> <p>This is the answer to question #2.</p> </div> </div>

    Read the article

  • Creating a procedure with PLSQL

    - by user1857460
    I am trying to write a PLSQL function that implements a constraint that an employee cannot be both a driver and a mechanic at the same time, in other words, the same E# from TRKEMPLOYEE cannot be in TRKDRIVER and TRKMECHANIC at the same time. The abovementioned tables are something like as follows: TRKEMPLOYEE(E# NUMBER(12) NOT NULL CONSTRAINT TRKEMPLOYEE_PKEY PRIMARY KEY(E#)) TRKDRIVER(E# NUMBER(12) NOT NULL CONSTRAINT TRKDRIVER_PKEY PRIMARY KEY(E#), CONSTRAINT TRKDRIVER_FKEY FOREIGN KEY(E#) REFERENCES TRKEMPLOYEE(E#)) TRKMECHANIC(E# NUMBER(12) NOT NULL CONSTRAINT TRKMECHANIC_PKEY PRIMARY KEY(E#), CONSTRAINT TRKMECHANIC_FKEY FOREIGN KEY(E#) REFERENCES TRKEMPLOYEE(E#)) I have attempted to write a function but keep getting a compile error in line 1 column 7. Can someone tell me why my code doesn't work? My code is as follows CREATE OR REPLACE FUNCTION Verify() IS DECLARE E# TRKEMPLOYEE.E#%TYPE; CURSOR C1 IS SELECT E# FROM TRKEMPLOYEE; BEGIN OPEN C1; LOOP FETCH C1 INTO EMPNUM; IF(EMPNUM IN(SELECT E# FROM TRKMECHANIC )AND EMPNUM IN(SELECT E# FROM TRKDRIVER)) SELECT E#, NAME FROM TRKEMPLOYEE WHERE E#=EMPNUM; ELSE dbms_output.put_line(“OK”); ENDIF EXIT WHEN C1%NOTFOUND; END LOOP; CLOSE C1; END; / Any help would be appreciated. Thanks.

    Read the article

  • Segmentation fault on certain inputs and not others

    - by Brandon Schwandt
    Heres a function I wrote that has some debugging elements in it already. When i enter either a "y" or a "Y" as the input I get a segmentation fault during runtime. When I enter any other value the code runs. The seg fault kicks out after it scans and gives me the response but before the "scan worked" line is output. DOn't know why it would act like this only on these values. If anyone needs the function call I have that as well. query_user(char *response [10]) { printf("response after query call before clear=%s\n",response); strcpy(response,""); printf("response after clearing before scan=%s\n",response); printf("Enter another person into the line? y or n\n"); scanf("%s", response); printf("response after scan=%s\n",response); printf("scan worked"); } main() { char response [10]; strcpy(response,"y"); printf("response=%s\n",response); printf("When finished with program type \"done\" to exit\n"); while (strcmp(response,"done") != 0) { printf("response after while loop and before query call=%s\n",response); query_user(&response); } } output on error: response after query call before clear=y response after clearing before scan= Enter another person into the line? y or n y response after scan=y Segmentation Fault (core dumped) output on non-error: response after query call before clear=y response after clearing before scan= Enter another person into the line? y or n n response after scan=n scan worked Cycle number 0 (program continues to run outside this function)

    Read the article

  • HREF link that targets nothing, does not want to use hash or void(0)

    - by Mattis
    I have a link that I want to be able to click to trigger a piece of jQuery code. Currently I have <a href="#" id="foo">Link</a> and $('#foo').click(function(){ // Do stuff }); which works well. But, I have always hated using hash in this way. The page flickers and the hash is added to the page url. One alternative is to use <a href="javascript:void(0);" id="foo">Link</a> but I also dislike seeing that piece of code in the browser status bar. It looks tacky. What I'd rather have is an explanatory javascript placeholder that does nothing, like <a href="javascript:zoom();" id="foo">Link</a> which actually works, but throws an ReferenceError in the javascript console since there are no such function. What's the minimum definition of a function that does nothing? Are there any other alternatives? Should I just skip the link and use something like <span id="foo" style="cursor:pointer;cursor:hand;">Link</span> instead?

    Read the article

  • waiting for a signal

    - by Umesha MS
    Hi, I am working on an application which uploads the content of the file to server. To upload the file to server I am using ‘QNetworkAccessManager’ class. Since it works as asynchronous way, I changed it to work as synchronous way by using QEventLoop. Class FileTransfer { Public : QNetworkAccessManager mNetworkManager; Void Upload(QNetworkRequest request, QIODevice *data) { responce = mNetworkManager.put(request, data); EventLoop.exec(); ReadResponce(responce); } Void Stop() { responce ->close(); } } In my sample application I have 2 windows. 1st to select the files and 2nd to show the progress. When user click on upload button in the first window, the 2nd window will be displayed and then I create the FileTransfer object and start uploading. While uploading the file if user closes the form then in the destructor of the window I call the stop of ‘FileTransfer’ after that I delete the ‘FileTransfer’ object. But here the Upload() function is not yet completed so it will crash. Please help me to: How to wait in 'stop()' function until the Upload() function is completed

    Read the article

  • Jquery tabs with cookie support restore wrong tab position after page refresh.

    - by zenonych
    Hello, all. I have tricky problem which I can't completely understand... It's jquery tabs with cookie support. I've following code: $(document).ready(function() { var $tabs = $("#tabs").tabs(); $tabs.tabs('select', $.cookie("tabNumber")); $('#tabs ul li a').click(function() { $.cookie("tabNumber", $tabs.tabs('option', 'selected')); }); $('#btnSelect').click(function() { //alert($.cookie("tabNumber")); //$tabs.tabs('select', 2); $tabs.tabs('select', $.cookie("tabNumber")); }); }); So, I've 3 tabs (with positions 0,1,2) inside div named "tabs". When user selects one tab, then tab position stores in cookie. After that if user refresh page, active tab position must be restored. But each time I refresh page I get active tab in previous position (if I select 2nd tab, then after refresh I got active tab in position 1, etc.). I add some test in code (button btnSelect with onclick handler which duplicates load position functionality). So, if I uncomment and use $tabs.tabs('select', 2); Then after I click btnSelect I've got right position. Ok, that's right. Then I comment that line and uncomment next one: alert($.cookie("tabNumber")); So, I select tab, click button, get dialog message "2", and after that tab in position 1 became active. Why?? In both cases I call 'select' method with parameter 2... I know I can use aliases for tabs, but I want to understate why my code doesn't work properly.

    Read the article

  • Use string to store statement (or part of a statement), and then add it to the code

    - by Dean
    I use multidimensional arrays to store product attributes (well Virtuemart does, to be precise). When I tried to echo the sub-arrays value, if the sub-array did not exist PHP threw: Fatal error: Cannot use string offset as an array To get around this, I attempted to create a function to check on every array level if it is an actual array, and if it is empty (when trying on the whole thing at once such as: is_array($array['level1']['level2']['level3']), I got the same error if level1 or level2 are not actual arrays). This is the function ($array contains the array to check, $array_levels is an array containing the names of the sub-arrays, in the order they should apper): function check_md_array($array,$array_levels){ if(is_array($array)){ $dimension = null; //This will store the dimensions string foreach($array_levels as $level){ $dimension .= "['" . $level . "']"; //Add the current dimension to the dimensions string if(!is_array($array/* THE CONTENT OF $dimension SHOULD BE INSERTED HERE*/)){ return false; } } return true; } } How can I take the string contained in $dimensions, and insert it into the code, to be part of the statement?

    Read the article

  • Noobie Jquery Question

    - by piratebill
    I've been working with Jquery fro a grand total of two hours now. Up until this point I have made this really simple FAQ page. <script type="text/javascript" src="jquery.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#void").click(function(event) { event.preventDefault(); }); $('#faq').find('dd').hide().end().find('dt').click(function() { $(this).next().slideToggle(); }); }); </script> <dl id="faq"> <dt><a href="" id="void">Coffee</a></dt> <dd>- black hot drink</dd> <dt><a href="" id="void">Milk</a></dt> <dd>- white cold drink</dd> </dl> The problem is only the first item is working. My questions are, why is only the first entree working and how do I fix it? I've tried using an each() but I am unsure where to put it.

    Read the article

  • Javascript/Jquery pop-up window in Asp.Net MVC4

    - by Mark
    Below I have a "button" (just a span with an icon) that creates a pop-up view of a div in my application to allow users to compare information in seperate windows. However, I get and Asp.Net Error as follows: **Server Error in '/' Application. The resource cannot be found. Requested URL: /Home/[object Object]** Does anyone have an Idea of why this is happending? Below is my code: <div class="module_actions"> <div class="actions"> <span class="icon-expand2 pop-out"></span> </div> </div> <script> $(document).ajaxSuccess(function () { var Clone = $(".pop-out").click(function () { $(this).parents(".module").clone().appendTo("#NewWindow"); }); $(".pop-out").click(function popitup(url) { LeftPosition = (screen.width) ? (screen.width - 400) / 1 : 0; TopPosition = (screen.height) ? (screen.height - 700) / 1 : 0; var sheight = (screen.height) * 0.5; var swidth = (screen.width) * 0.5; settings = 'height=' + sheight + ',width=' + swidth + ',top=' + TopPosition + ',left=' + LeftPosition + ',scrollbars=yes,resizable=yes,toolbar=no,status=no,menu=no, directories=no,titlebar=no,location=no,addressbar=no' newwindow = window.open(url, '/Index', settings); if (window.focus) { newwindow.focus() } return false; }); });

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • qTip pop ups come in from top left of screen (on first load)

    - by franko75
    Hi, not sure if i'm set things up incorrectly - I don't seem to see anyone else with this problem, but my qTip popups (all ajax loaded content) are loading quite erratically, in that they are often animating in from off screen before appearing in the correct position. Is there a simple solution to this which I may have missed? Thanks again for your help. HTML markup: <span class="formInfo"> <a href="http://localhost/httpdocs/index.php/help/kc_dob" class="jTip" name="" id="dob_help">?</a> </span> qTip initialisation.. //set up for qtip function initQtip() { $('a.jTip').each(function() { $(this).qtip( { content: { // Set the text to an image HTML string with the correct src URL to the loading image you want to use text: '<img src="/media/images/wait.gif" alt="Loading..." />', url: $(this).attr('href') // Use the rel attribute of each element for the url to load }, position: { adjust: { screen: true // Keep the tooltip on-screen at all times } }, show: { when: 'click', solo: true // Only show one tooltip at a time }, hide: 'unfocus', style: { tip: true, // Apply a speech bubble tip to the tooltip at the designated tooltip corner border: { width: 10, radius: 10 }, width: { min: 200, max: 500 }, name: 'light' // Use the default light style } }); //prevent default event on click }).bind('click', function(event){ event.preventDefault(); return false; }); }

    Read the article

  • Access is denied. Javascript error on request to secured page

    - by ihorko
    On SomePage.aspx page by javascript (XMLHttpRequest) I call SecuredPage.aspx used next code: var httpRequest = GetXmlHttp(); var url = "https://myhost.com/SecuredPage.aspx"; var params = "param1=" + document.getElementById('param1').value + "&param2=" + document.getElementById('param2').value; httpRequest.open("POST", url, true); httpRequest.setRequestHeader("Content-Type", "application/x-www-form-urlencoded"); httpRequest.onreadystatechange = function() { //Call a function when the state changes. if (httpRequest.readyState == 4 && httpRequest.status == 200) { alert(httpRequest.responseText); } } httpRequest.send(params); // HERE ACCESS IS DENIED //--------------------------------------------- function GetXmlHttp() { var xmlhttp = false; if (window.XMLHttpRequest) { xmlhttp = new XMLHttpRequest(); } else if (window.ActiveXObject) // code for IE { try { xmlhttp = new ActiveXObject("Msxml2.XMLHTTP"); } catch (e) { try { xmlhttp = new ActiveXObject("Microsoft.XMLHTTP"); } catch (E) { xmlhttp = false; } } } return xmlhttp; } It throws Access is denied error. if send to http (http://myhost.com/SecuredPage.aspx), it works fine. How is it possible to resolve that problem. Thanks!

    Read the article

< Previous Page | 606 607 608 609 610 611 612 613 614 615 616 617  | Next Page >