Search Results

Search found 4647 results on 186 pages for 'localizable strings'.

Page 62/186 | < Previous Page | 58 59 60 61 62 63 64 65 66 67 68 69  | Next Page >

  • Csharp: I am trying to get the top nth values from and rectangular array

    - by user355925
    I am reading a txt file for strings that represent intergers. the file is space delimited. I have created an array[10,2]. evertime the the strings 1~10 is found in the file I increment array[n,0] by 1. I also feed array[n,1] with numbers 1~10. ie txt file contents: 1/1/1 10/1/2001 1 1 10 2 2 3 1 5 10 word word 3 3 etc.. streamreader reads 1/1/1 and determines that is is not 1~10 streamreader reads 10/1/2001 and determines that it is not 1~10 streamreader reads 1 and ++array[0,0] streamreader reads 1 and ++array[0,0] streamreader reads 10 and ++array[9,0] etc.. the result will be: '1' was found 3 times '2' was found 2 times '3' was found 3 times '5' was found 1 time '10' was found 2 times My problem is that I need this array placed in order(sorted) by value of column 0 so that it would be: 1 3 2 10 5

    Read the article

  • php codeigniter MySQL search query

    - by kalafun
    I want to create a search query on MySQL database that will consist of 5 different strings typed in from user. I want to query 5 different table columns with these strings. When I for example have input fields like: first name, last name, address, post number, city. How should I query the database that I dont always get all the rows. My query is something like this: SELECT user_id, username from users where a like %?% AND b like %?% AND c like %?% AND d like %?% AND e like %?%; When I exchange the AND for OR I always get all the results which makes sense, and when I use AND I get only the exact matches... Is there any function or statement that would help me with this?

    Read the article

  • C++ string array from ifstream

    - by David Beck
    I have a program that I need to read in an array of strings from a file. The array must be C type strings (char * or char[]). Using the following code, I get a bad access error: for (i = 0; i < MAX_WORDS && !inputFile.eof(); i++) { inputFile >> words[i]; } words is declared as: char *words[MAX_WORDS];

    Read the article

  • Why doesen't the number 2 work in this for-loop?

    - by Emil
    Hello. I have a function that runs trough each element in an array. It's hard to explain, so I'll just paste in the code here: NSLog(@"%@", arraySub); for (NSString *string in arrayFav){ int favoriteLoop = [string intValue] + favCount; NSLog(@"%d", favoriteLoop); id arrayFavObject = [array objectAtIndex:favoriteLoop]; [arrayFavObject retain]; [array removeObjectAtIndex:favoriteLoop]; [array insertObject:arrayFavObject atIndex:0]; [arrayFavObject release]; id arraySubFavObject = [arraySub objectAtIndex:favoriteLoop]; [arraySubFavObject retain]; [arraySub removeObjectAtIndex:favoriteLoop]; [arraySub insertObject:arraySubFavObject atIndex:0]; [arraySubFavObject release]; id arrayLengthFavObject = [arrayLength objectAtIndex:favoriteLoop]; [arrayLengthFavObject retain]; [arrayLength removeObjectAtIndex:favoriteLoop]; [arrayLength insertObject:arrayLengthFavObject atIndex:0]; [arrayLengthFavObject release]; } NSLog(@"%@", arraySub); The array arrayFav contains these strings: "3", "8", "2", "10", "40". Array array contains 92 strings with a name. Array arraySub contains numbers 0 to 91, representing a filename with a title from the array array. Array arrayLength contains 92 strings representing the size of each file from array arraySub. Now, the first NSLog shows, as expected, the numbers 0 to 91. The NSLog-s in the loop shows the numbers 3, 8, 2, 10, 40, also as expected. But here's the odd part: the last NSLog shows these numbers: 40, 10, 0, 8, 3, 1, 2, 4, 5, 6, 7, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 that is 40, 10, 0, 8, 3, and so on. It was not supposed to be a zero in there, it was supposed to be a 2.. Do you have any idea at why this is happening or a way to fix it? Thank you.

    Read the article

  • Delphi: How to localize description for a menu shortcut?

    - by Ulrich Gerhardt
    Is there a way to get a localized description of a shortcut like Ctrl+Z so that I get "Ctrl+Z" if the app runs on an English system and "Strg+Z" on a German system? The VCL function ShortCutToText isn't internationalized. The API function GetKeyNameText is a bit better but still not perfect: If one switches the regional settings of a German XP to English (US), it still produces German texts. Besides the results are in CAPITALS which is ugly. Clarification: I know how I can replace ShortCutToText or the Smkc* resource strings with customized versions. But to use that I need the translated strings. And I would like to get these from the OS (or similar). Update: It looks like Microsoft expects developers to do the translation on their own - see 2. in Associating a Menu Item with an Accelerator Key.

    Read the article

  • Pick Random String From Array

    - by atrljoe
    How do I go about picking a random string from my array but not picking the same one twice. string[] names = { "image1.png", "image2.png", "image3.png", "image4.png", "image5.png" }; Is this possible? I was thinking about using return strings[random.Next(strings.Length)]; But this has the possibility of returning the same string twice. Or am I wrong about this? Should I be using something else like a List to accomplish this. Any feedback is welcome.

    Read the article

  • String.split() - matching leading empty String prior to first delimiter?

    - by tehblanx
    I need to be able to split an input String by commas, semi-colons or white-space (or a mix of the three). I would also like to treat multiple consecutive delimiters in the input as a single delimiter. Here's what I have so far: String regex = "[,;\\s]+"; return input.split(regex); This works, except for when the input string starts with one of the delimiter characters, in which case the first element of the result array is an empty String. I do not want my result to have empty Strings, so that something like, ",,,,ZERO; , ;;ONE ,TWO;," returns just a three element array containing the capitalized Strings. Is there a better way to do this than stripping out any leading characters that match my reg-ex prior to invoking String.split? Thanks in advance!

    Read the article

  • File System Types in .Net

    - by Avi
    I don't get the abstractions and the terminology :-( For example, DirectoryInfo.FullName is defined as the full path of the directory or file, but it's a string! So is DirectoryInfo.Name, FileInfo.FullName, Path.GetDirectoyName and so on. This means that in .Net there is no "depth" (or "meat" - my English isn't so good) for the file system objects. There's no protection from a type system. I can't, for example, define two Path objects and ask if one of them is "above" the other - I have to manipulate the strings. I can't differentiate between a Path that identifies a directory and a path that identifies a file. I can't do anything!-( Just manipulate strings. Is this correct (or am I simply missing something). If correct, are there any alternatives?

    Read the article

  • Efficient questions

    - by rayman
    Hi, I have to manage xml's and Strings in my app. by efficenty and memory saving, is collection(ArrayList) will be much more 'expensive' then array of Strings? another issue is: i could use the content as regular String, or XML.. is working with XML also makes it more 'expensive' ? when i say i expensive i talk about taking system sources. please tell me by any of your exprience if the diffrences are significant? thanks, ray.

    Read the article

  • Whats the difference between a C++ and a Cocoa Project in Xcode?

    - by david
    I need to work with TagLib for my project. I've created a framework (and I tried using it as a lib) but the compiler cannot find #include < strings on compiling (No such file or Directory). I've created a test C++ project and it #includes < strings just fine. I've looked at the project settings and I cannot find a difference between them. But the standard cocoa projects obviously so not have the search path set to include C++ libraries (Or am I completely getting it wrong?). I've searched for a solution but no one else seems to have run into this problem.

    Read the article

  • (C++) While reading a file (ifstream), is there any way to direct it to make a new line?

    - by Enzo
    While reading a file (ifstream), is there any way to direct it to make a new line? For instance, I would like for THIS to happen: myfilearray[1]array[2]endl; Obviously, the "endl" just isn't allowed. Is there another way to do this? Edit---thanks for the quick responses guys! From a text file, I'm trying to store two strings from that file into arrays and then do the same with the next line (or until I desire, using a for loop) Using strings is important to me as it will make my future program a lot more flexible.

    Read the article

  • Converting image to byte/encoding it? - RichTextBox

    - by user1667191
    I have strings that are "Images", although they are in "String" format. Here's how one of the strings look like: {\pict\wmetafile8\picw820\pich900\picwgoal465\pichgoal510 010009000003ac1000000000f60900000000f6090000..etc.. It goes on like this for a few more lines. The guy that got this said he converted the image by pasting it in a richtextbox and getting that string. How can I go about getting the same result? Sorry for the lack of info. Just not sure how this is called.

    Read the article

  • fastest in objC: IsEqualToString:@"" or length > 0?

    - by Cœur
    I'd like to know which one is fastest for testing a non-empty NSString for iOS 4.0+ (iPhone 3G). Note: the strings to test will be 99% of the time from 2 to 100 chars length. if ([foo length] > 0) or if ([foo isEqualToString:@""] == NO && foo != nil) I think it depends if isEqualToString: compares the length first (and in that case first way is faster) or if isEqualToString: compares first character of strings first (and in that case second way might be faster). ps: I already know isEqualToString: is faster than isEqual: which is itself faster than compare:.

    Read the article

  • Is there a way to specify java annotations in antlr grammar files?

    - by Steve B.
    I'm looking for a way to include a few additional strings in output .java files generated from antlr. Is there a comprehensive listing of available directives? For example, given parser output like this: package com.foo.bar; //<-- this can be generated with @header { .... } //antlr generated import org.antlr.runtime.*; ... //<-- is there a way to generate anything here? public class MyParser { //<--- or here? public void f1(){ ... } } Is there a way to generate strings that appear after the import statements (e.g. class-level annotations) or possibly method annotations?

    Read the article

  • Get the top nth values from a rectangular array

    - by user355925
    I am reading a txt file for strings that represent integers. The file is space delimited. I have created an array[10,2]. Everytime the strings 1~10 is found in the file I increment array[n,0] by 1. I also feed array[n,1] with numbers 1~10. i.e. txt file contents: 1/1/1 10/1/2001 1 1 10 2 2 3 1 5 10 word word 3 3 etc.. streamreader reads 1/1/1 and determines that is is not 1~10 streamreader reads 10/1/2001 and determines that it is not 1~10 streamreader reads 1 and ++array[0,0] streamreader reads 1 and ++array[0,0] streamreader reads 10 and ++array[9,0] etc.. The result will be: '1' was found 3 times '2' was found 2 times '3' was found 3 times '5' was found 1 time '10' was found 2 times My problem is that I need this array placed in order(sorted) by value of column 0 so that it would be: 1 3 2 10 5

    Read the article

  • Pass variable number of variables to a class in PHP

    - by user325282
    I need to pass a variable number of strings to instantiate different classes. I can always do a switch on the size of the array: switch(count($a)) { case 1: new Class(${$a[0]}); break; case 2: new Class(${$a[0]}, ${$a[1]}); break; etc... There has to be a better way to do this. If I have an array of strings ("variable1", "variable2", 'variable3", ...), how can I instantiate a Class without manually accounting for every possibility?

    Read the article

  • Map a property in the entity framework to a different type

    - by Tom
    I have a SQL Server 2008 database. I have a bunch of fields in TableA that are just strings that corresponds to booleans. So every value is either true or false. The edmx I generated using Entity Framework 4.0 has them as strings. This is technically correct but I would like to have them mapped as Booleans instead. Is this possible? If so how can I accomplish this? Thanks much!

    Read the article

  • In-memory data structure that supports boolean querying

    - by sanity
    I need to store data in memory where I map one or more key strings to an object, as follows: "green", "blue" -> object1 "red", "yellow" -> object2 I need to be able to efficiently receive a list of objects, where the strings match some boolean criteria, such as: ("red" OR "green") AND NOT "blue" I'm working in Java, so the ideal solution would be an off-the-shelf Java library. I am, however, willing to implement something from scratch if necessary. Anyone have any ideas? I'd rather avoid the overhead of an in-memory database if possible, I'm hoping for something comparable in speed to a HashMap (or at least the same order of magnitude).

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How to test Language DLLs?

    - by EKI
    Our application offer the user to display different languages if they have the approppriate Language DLL (say German.DLL, French.DLL, even Chinese.DLL). We have functional test to verify that those DLLs enable the right options in a Combobox and that choosing them will actually translate strings in the UI. I would like to know options to test this translation dll's more in depth, maybe ensuring that all the characters in the selected langauge (and in the file) can be correctly displayed, or that the internal structure of the DLL is consistent, there are no strings exceeding the limits that are expected of them, etc... Any suggestions on what to test and how to test it? Does anyone know specific problems that may arise and we should check? Thanks in advance.

    Read the article

< Previous Page | 58 59 60 61 62 63 64 65 66 67 68 69  | Next Page >