Search Results

Search found 37568 results on 1503 pages for 'iif function'.

Page 624/1503 | < Previous Page | 620 621 622 623 624 625 626 627 628 629 630 631  | Next Page >

  • Logical python question - handeling directories and files in them

    - by Konstantin
    Hello! I'm using this function to extract files from .zip archive and store it on the server: def unzip_file_into_dir(file, dir): import sys, zipfile, os, os.path os.makedirs(dir, 0777) zfobj = zipfile.ZipFile(file) for name in zfobj.namelist(): if name.endswith('/'): os.mkdir(os.path.join(dir, name)) else: outfile = open(os.path.join(dir, name), 'wb') outfile.write(zfobj.read(name)) outfile.close() And the usage: unzip_file_into_dir('/var/zips/somearchive.zip', '/var/www/extracted_zip') somearchive.zip have this structure: somearchive.zip 1.jpeg 2.jpeg another.jpeg or, somethimes, this one: somearchive.zip somedir/ 1.jpeg 2.jpeg another.jpeg Question is: how do I modify my function, so that my extracted_zip catalog would always contain just images, not images in another subdirectory, even if images are stored in somedir inside an archive.

    Read the article

  • In Javascript, by what mechanism does setting an Image src property trigger an image load?

    - by brainjam
    One of the things you learn early on when manipulating a DOM using Javascript is the following pattern: var img = new Image(); // Create new Image object img.onload = function(){ // execute drawImage statements here } img.src = 'myImage.png'; // Set source path As far as I know, in general when you set an object property there are no side effects. So what is the mechanism for triggering an image load? Is it just magic? Or can I use a similar mechanism to implement a class Foo that supports a parallel pattern? var foo = new Foo(); // Create new object foo.barchanged = function(){ // execute something after side effect has completed } foo.bar = 'whatever'; // Assign something to 'bar' property I'm vaguely aware of Javascript getters and setters. Is this how Image.src triggers a load?

    Read the article

  • Why I am not getting Row value on click using this?

    - by rockers
    $("#grid td:first-child").click(function() { var value = $(this).closest('tr').find('td:eq(2)').text(); // for third column alert(value); var value = $(this).closest('tr').find('td:eq(3)').text(); // for fourth column alert(value); var AccountName = accountid; var x = function() { $(this).click($("#showregiongrid").load('/analyst/ror/regionspeexc/?a=' + AccountName)); } clickTimer = window.setTimeout(x, 300); }); Why i am not getting the row values of eq(2) and eq(3).. is there anyting I am doing wrong? if I delete td:first-child from my click event I am getting null vallues on popup? thanks

    Read the article

  • Chrome Javascript

    - by Mike
    i have two spans on my page with class='hidden' and then some javascript to remove the class when a condition is met, its working fine in ie 9/10 and firefox but its not working in chrome when I run the function in the chrome JS console I get the message TypeError: Cannot read property 'attributes' of null Anybody know whats going on? <script type='text/javascript' > function showhidden() { var att =document.getElementById('hiddentextbox'); att.attributes[0].value=''; att =document.getElementById('hiddentextbox1'); att.attributes[0].value=''; }</script> Thanks

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Is recursion preferred compare to iteration in multicore era?

    - by prM
    Or say, do multicore CPUs process recursion faster than iteration? Or it simply depends on how one language runs on the machine? like c executes function calls with large cost, comparing to doing simple iterations. I had this question because one day I told one of my friend that recursion isn't any amazing magic that can speed up programs, and he told me that with multicore CPUs recursion can be faster than iteration. EDIT: If we consider the most recursion-loved situation (data structure, function call), is it even possible for recursion to be faster?

    Read the article

  • Void pointer values comparing C++

    - by user2962977
    My actual question is it really possible to compare values contained in two void pointers, when you actually know that these values are the same type? For example int. void compVoids(void *firstVal, void *secondVal){ if (firstVal < secondVal){ cout << "This will not make any sense as this will compare addresses, not values" << endl; } } Actually I need to compare two void pointer values, while outside the function it is known that the type is int. I do not want to use comparison of int inside the function. So this will not work for me as well: if (*(int*)firstVal > *(int*)secondVal) Any suggestions? Thank you very much for help!

    Read the article

  • Suggestion for R/LaTeX table creation package

    - by aL3xa
    I've been using xtable package for a long time, and looking forward to writting my first package in R... so I reckon that if I have some "cool" idea that's worth carying out, there's a great chance that somebody got there before me... =) I'm interested in functions/packages specialized for LaTeX table creation (through R, of course). I bumped on quantreg package which has latex.table function. Any suggestion for similar function(s)/package(s)? P.S. I'm thinking about building a webapp in which users can define their own presets/templates of tables, choose style, statistics, etc. It's an early thought, though... =)

    Read the article

  • Built in raytracing?

    - by acidzombie24
    Relating to this question i was wondering if .NET has any libs (or a function) i can use to detect if one point collides with another. I am not sure what angles i should use but is there some function like this func(point src, rect target, angle, distanceOfVision, listPointOrRectOfWalls) Pretty unlikely but i dont know a formula or how to start. Its a quick and dirty prototype. I am thinking of writing the func about but dropping angle and just make line of sight a rectangle and check if any points is between src and target.

    Read the article

  • Mocking imported modules in Python

    - by Evgenyt
    I'm trying to implement unit tests for function that uses imported external objects. For example helpers.py is: import os import pylons def some_func(arg): ... var1 = os.path.exist(...) var2 = os.path.getmtime(...) var3 = pylons.request.environ['HTTP_HOST'] ... So when I'm creating unit test for it I do some mocking (minimock in my case) and replacing references to pylons.request and os.path: import helpers def test_some_func(): helpers.pylons.request = minimock.Mock("pylons.request") helpers.pylons.request.environ = { 'HTTP_HOST': "localhost" } helpers.os.path = minimock.Mock(....) ... some_func(...) # assert ... This does not look good for me. Is there any other better way or strategy to substitute imported function/objects in Python?

    Read the article

  • Clear Select options when selecting one field while using multiple forms on same page

    - by Nizam
    Hi all, I have a situation where the second select list option is generated from the first select list selected option. Like when we select Country corresponding states are generated in next select list. In my case I am having multiple forms on single page which are same. Can anyone let me know how to implement it on multiple forms. I tried the following code but it didn't work $(".country").change(function(){ $.get("sample.php?val=" + $(this).val(), function(data){ $(this).parent().next().children('.state').children('option').remove(); $(this).parent().next().children('.state').append(data); }); Waiting for your support thanks in advance

    Read the article

  • Using JSON Data to Populate a Google Map with Database Objects

    - by MikeH
    I'm revising this question after reading the resources mentioned in the original answers and working through implementing it. I'm using the google maps api to integrate a map into my Rails site. I have a markets model with the following columns: ID, name, address, lat, lng. On my markets/index view, I want to populate a map with all the markets in my markets table. I'm trying to output @markets as json data, and that's where I'm running into problems. I have the basic map displaying, but right now it's just a blank map. I'm following the tutorials very closely, but I can't get the markers to generate dynamically from the json. Any help is much appreciated! Here's my setup: Markets Controller: def index @markets = Market.filter_city(params[:filter]) respond_to do |format| format.html # index.html.erb format.json { render :json => @market} format.xml { render :xml => @market } end end Markets/index view: <head> <script type="text/javascript" src="http://www.google.com/jsapi?key=GOOGLE KEY REDACTED, BUT IT'S THERE" > </script> <script type="text/javascript"> var markets = <%= @markets.to_json %>; </script> <script type="text/javascript" charset="utf-8"> google.load("maps", "2.x"); google.load("jquery", "1.3.2"); </script> </head> <body> <div id="map" style="width:400px; height:300px;"></div> </body> Public/javascripts/application.js: function initialize() { if (GBrowserIsCompatible() && typeof markets != 'undefined') { var map = new GMap2(document.getElementById("map")); map.setCenter(new GLatLng(40.7371, -73.9903), 13); map.addControl(new GLargeMapControl()); function createMarker(latlng, market) { var marker = new GMarker(latlng); var html="<strong>"+market.name+"</strong><br />"+market.address; GEvent.addListener(marker,"click", function() { map.openInfoWindowHtml(latlng, html); }); return marker; } var bounds = new GLatLngBounds; for (var i = 0; i < markets.length; i++) { var latlng=new GLatLng(markets[i].lat,markets[i].lng) bounds.extend(latlng); map.addOverlay(createMarker(latlng, markets[i])); } } } window.onload=initialize; window.onunload=GUnload;

    Read the article

  • How do I process a jQuery SVG group event in a single handler?

    - by rmflow
    I'm trying to draw a button using jQuery SVG, the button is a filled rect and the text is placed on top of the rect. Rect and text are grouped and I want to control the mouseover/mouseout events. The problem is: mouseover/mouseout events are triggered separately for every element of the group. Is it possible to make a single event handler for entire group? Here is an example: gClear = svg.group(); btClear = svg.rect(gClear, 10, 10, 100, h-20, 5 ,5, attrs); txtClear = svg.text(gClear, 35, 30, "Clear", {fontFamily: "Verdana", fontWeight: "bold", fontSize: "16px"}); $(gClear, svg.root()).bind("mouseover", function() { $(btClear).animate({svgFill: '#adf'}, 100); }).bind("mouseout", function() { $(btClear).animate({svgFill: '#fff'}, 100); }) When I move the mouse inside the rect the events mouseover/mouseout are triggered. Can I make "text" events transparent or can I have a single event handler for the group?

    Read the article

  • jQuery: form input values turns up undefined

    - by Seerumi
    Having problem with this bit of code qith jQuery. it should pick the values from current form and then submit them, but when I try to get them with jQuery they always turn up undefined. I know the SQL results are fine since they show correctly in HTML table, so it must be my inferior javascript skills. New with jQuery and I'm at loss :( PHP/HTML: echo "<table>\n" while ($row = odbc_fetch_array($query)) { echo "<form class='catForm'>\n"; echo "<input type=hidden class='catID' name='catID' value='".$row['running_id']."'/>\n"; echo "<tr>\n"; echo "<td>".$row['running_id']."</td>\n"; echo "<td>".$row['site_id']."</td>\n"; echo "<td>".$row['main_category']."</td>\n"; echo "<td>".$row['map_name']."</td>\n"; echo "<td><input type=textfield class='bCatID' value='".$row['mapping_id']."' size=6/></td>\n"; echo "<td><input type=submit class='saveCat' value='Save'/></td>\n"; echo "<td><input type=submit class='killCat' value='Delete' /></td>\n"; echo "</tr>\n"; echo "</form>\n"; } echo "</table>"; jQuery: $(".catForm").submit(function () { var id = $(this).find('.catID').val(); var bCatID = $(this).find('.bCatID').val(); var dataString = 'id='+id+'&bCatID='+bCatID; $.ajax({ type: "POST", url: 'adminUI/bin/updateSCategories.php', dataType : 'json', data: dataString, success: function(data) { if (data.error == true) $('.failure').html("Error, save failed.").show().fadeOut(2000); if (data.error == false) $('.success').html("Saved succesfully").show().fadeOut(2000); }, error: function(XMLHttpRequest, textStatus, errorThrown) { $('.failure').html("Error, save failed.").show().fadeOut(2000); } }); return false; }); RESULT: id: undefined bCatID: undefined

    Read the article

  • Pointer to local variable

    - by Radek Šimko
    May I have any acces to local variable in different function? If may, how? void replaceNumberAndPrint(int array[3]) { printf("%i\n", array[1]); printf("%i\n", array[1]); } int * getArray() { int myArray[3] = {4, 65, 23}; return myArray; } int main() { replaceNumberAndPrint(getArray()); } The output of the piece of code above: 65 4202656 What am i doing wrong? What the "4202656" means?? Do I have to copy the whole array in the replaceNumberAndPrint() function to be able to access to it more than first times?

    Read the article

  • Ajax doesn't work on remote server .

    - by Nuha
    Hello . when I Implemented chatting Function , I use Ajax to send messages between file to another . so , it is working well on local host . but , when I upload it in to remote server it doesn't work. can U tell me ,why ? is an Ajax need Special configuration ? Ajax code : function Ajax_Send(GP,URL,PARAMETERS,RESPONSEFUNCTION){? var xmlhttp? try{xmlhttp=new ActiveXObject("Msxml2.XMLHTTP")}? catch(e){? try{xmlhttp=new ActiveXObject("Microsoft.XMLHTTP")}? catch(e){? try{xmlhttp=new XMLHttpRequest()}? catch(e){? alert("Your Browser Does Not Support AJAX")}}}? ? err=""? if (GP==undefined) err="GP "? if (URL==undefined) err +="URL "? if (PARAMETERS==undefined) err+="PARAMETERS"? if (err!=""){alert("Missing Identifier(s)\n\n"+err);return false;}? ? xmlhttp.onreadystatechange=function(){? if (xmlhttp.readyState == 4){? if (RESPONSEFUNCTION=="") return false;? eval(RESPONSEFUNCTION(xmlhttp.responseText))? }? }? ? if (GP=="GET"){? URL+="?"+PARAMETERS? xmlhttp.open("GET",URL,true)? xmlhttp.send(null)? }? ? if (GP="POST"){? PARAMETERS=encodeURI(PARAMETERS)? xmlhttp.open("POST",URL,true)? xmlhttp.setRequestHeader("Content-type", "application/x-www-form-urlencoded")? xmlhttp.setRequestHeader("Content-length",PARAMETERS.length)? xmlhttp.setRequestHeader("Connection", "close")? xmlhttp.send(PARAMETERS)? }? }

    Read the article

  • Avoid multiple autocomplete calls by wrapping it with SetTimeOut

    - by pixelboy
    Here's my issue : using an autocomplete jQuery plugin, I'd like to avoid multiple ajax requests when user strikes his keynoard by surrounding the $('#query1').autocomplete({ serviceUrl:'/actions/autocomplete?population=salon', minChars:3, maxHeight:300, width:200, clearCache:true, onSelect: function(suggestions,data){ $(".btn1").attr("href", "${pageContext.request.contextPath}/actions/espaceClients?participantId=" + data) } }); with something like var search = false; $('#query1, #query2, #query3').keyup(function(){ if (!search){ search = true; } if (search) { search = false; autocompleteThem(); } }); A you can see, above code is stupid, but it kinda shows what i'm trying to do. In simple words, if user dosen't type anything else in a certain period of time, then you can call autocomplete. I hope i'm being clear, as my brains are a mess...

    Read the article

  • How to have type hinting in PHP that specifies variable scope inside of a template? (specifically PhpStorm)

    - by Lance Rushing
    I'm looking for a doc comment that would define the scope/context of the current php template. (similar to @var) Example View Class: <?php class ExampleView { protected $pageTitle; public function __construct($title) { $this->pageTitle = $title; } public function render() { require_once 'template.php'; } } -- <?php // template.php /** @var $this ExampleView */ echo $this->pageTitle; PHPStorm gives an inspection error because the access on $pageTitle is protected. Is there a hint to give scope? Something like: <?php // template.php /** @scope ExampleView */ // <---???? /** @var $this ExampleView */ echo $this->pageTitle;

    Read the article

  • jQuery get value from checked element with a given name

    - by Travis Leleu
    I've got an input like so: I'd like to use jQuery to grab that element, and add the function call foo() to the change event. Currently I can get it done, but there are two hacks involved. My (working) code: $(":input[name*=myfield]").change( function( $(":input[name*=myfield]") ) { foo(); }); )}; There are two hacks in there I'd like to eliminate. Keeping in mind that the input names are multidimensional arrays, how can I use the :input[name=somename], versus [name*=someone]? I'd imagine it's faster using an exact name rather than *=, but I can't get the escape sequence correct for the brackets on the multidimensional arrays. Can I chain the call together so that I don't have to select the element twice? Is the standard practice for that to select the HTML element into a var, then use that var? Or can I chain it together? Thanks for the help. Still working on getting my footing in JS/JQ.

    Read the article

  • BizTalk 2009 XSLT and Attribute Value Templates

    - by amok
    I'm trying to make use of attribute value type in a BizTalk XSL transformation to dynamically setting attribute or other element names. Read more here: http://www.w3.org/TR/xslt#dt-attribute-value-template The following code is an example of an XSL template to add an attribute optionally. <xsl:template name="AttributeOptional"> <xsl:param name="value"/> <xsl:param name="attr"/> <xsl:if test="$value != ''"> <xsl:attribute name="{$attr}"> <xsl:value-of select="$value"/> </xsl:attribute> </xsl:if> </xsl:template> Running this script in BizTalk results in "Exception from HRESULT: 0x80070002)" An alternative I was thinking of was to call a msxsl:script function to do the same but i cannot get a handle on the XSL output context from within the function. An ideas?

    Read the article

  • Javascript Canvas Element - Array Of Images

    - by Ben Shelock
    I'm just learning JS, trying to do things without jQuery, and I want to make something similar to this however I want to use an array of images instead of just the one. My image array is formed like this var image_array = new Array() image_array[0] = "image1.jpg" image_array[1] = "image2.jpg" And the canvas element is written like this. (Pretty much entirely taken from the Mozilla site) function draw() { var ctx = document.getElementById('canvas').getContext('2d'); var img = new Image(); img.src = 'sample.png'; img.onload = function(){ for (i=0;i<5;i++){ for (j=0;j<9;j++){ ctx.drawImage(img,j*126,i*126,126,126); } } } } It uses the image "sample.png" in that code but I want to change it to display an image from the array. Displaying a different one each time it loops. Apoligies if I've not explained this well.

    Read the article

  • Generating random numbers in C

    - by moonstruckhorrors
    While searching for Tutorials on generating random numbers in C I found This Topic When I try to use the rand() function with parameters, I always get the random number generated 0. When I try to use the rand() function with parameters, I always get the value 41. And whenever I try to use arc4random() and random() functions, I get a LNK2019 error. Here's what I'm doing: #include <stdlib.h> int main() { int x; x = rand(6); printf("%d", x); } This code always generate 41. Where am I going wrong?? P.S. : I'm running Windows XP SP3 and using VS2010 Command Prompt as compiler. P.P.S. : Took me 15 minutes to learn how to format properly.

    Read the article

  • How to implement a timer for regular events?

    - by Torben Jonas
    I would like to implement some timers into my application. My goal is to provide an easy way to execute some function every x seconds/minutes so I thought about implementing a 1 sec, 5 sec and 15 seconds timer. The first thing i would like to update every 1 second is the built in clock (don't know if there is any other solution in c#, used this method in c++) Another use would be e.g. a sync function etc. which shall be executed every xx seconds. My question is if there are any useful tutorials on this topic? It is the first time that I would like to implement such an timer system into one of my applications and I do not know if there are any things I have to keep in mind. Thank you in advance for any answer :)

    Read the article

  • jQuery mobile ajax login form authentication

    - by Jakub Zak
    I know i already asked simillar question, but now when I work with jQuery Mobile I can't figure it out. So I have this form: <div data-role="page" data-theme="a" id="login_page"> <div data-role="header" data-position="fixed"> <h1>****</h1> </div> <div data-role="content"> <form id="login_form" method="POST" data-ajax="false"> <label for="basic">Username:</label> <input type="text" name="name" id="username" value=""/> <label for="basic">Password:</label> <input type="password" name="password" id="password" value=""/> <input type="submit" value="Login" id="login" name="login"/> </form> </div> <div data-role="footer" data-position="fixed"> <div data-role="navbar"></div> </div> </div> And I need to submit Username and Password to php script, where php replies and send "success" or "failed". Here is php: <?php session_start(); $username = $_POST["name"]; $password = $_POST["password"]; include('mysql_connection.php'); mysql_select_db("jzperson_imesUsers", $con); $res1 = mysql_query("SELECT * FROM temp_login WHERE username='$username' AND password='$password'"); $count=mysql_num_rows($res1); if($count==1){ echo "success"; }else{ echo "failed"; } ?> And to do all this I want to use this script: $(document).ready(function() { $("form").submit(function(){ $.mobile.showPageLoadingMsg(); $.ajax({ url: "http://imes.jzpersonal.com/login_control.php", type: "POST", dataType: "jsonp", jsonp: "jsoncallback", data: $("form#login_form").serialize(), success: function( response ){ $.mobile.changePage( "http://imes.jzpersonal.com/user_panel.html"); } }); return false; }); }); But I can't make it work, I know I must have mistakes in there, I just can't find them, or better way to do it. Thank you in advance for any help.

    Read the article

< Previous Page | 620 621 622 623 624 625 626 627 628 629 630 631  | Next Page >