Search Results

Search found 37654 results on 1507 pages for 'function prototypes'.

Page 627/1507 | < Previous Page | 623 624 625 626 627 628 629 630 631 632 633 634  | Next Page >

  • warning: (Internal error: pc 0x804a6b0 in read in psymtab, but not in symtab.) g++

    - by Sriram
    Hi, I am trying to debug a program using ddd. When I try to enter any function, or within main() itself, I get the following warning: warning: (Internal error: pc 0x804a6b0 in read in psymtab, but not in symtab.) This warning flashes whenever I try to move to another instruction using 'n' or enter or leave a function. I have tried to look this up in other forums, but with no conclusive answer. The code I am trying to debug runs into several files and I am not sure if I can post the entire code here. I am using g++ version: g++ (GCC) 4.4.1 20090725 (Red Hat 4.4.1-2) Any help on this is most welcome. Thanks, Sriram.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Server Error Message: No File Access

    - by iMayne
    Hello. Im having an issues but dont know where to solve it. My template works great in xampp but not on the host server. I get this message: Warning: file_get_contents() [function.file-get-contents]: URL file-access is disables in the server configuration in homepage/......./twitter.php. The error is on line 64. <?php /* For use in the "Parse Twitter Feeds" code below */ define("SECOND", 1); define("MINUTE", 60 * SECOND); define("HOUR", 60 * MINUTE); define("DAY", 24 * HOUR); define("MONTH", 30 * DAY); function relativeTime($time) { $delta = time() - $time; if ($delta < 2 * MINUTE) { return "1 min ago"; } if ($delta < 45 * MINUTE) { return floor($delta / MINUTE) . " min ago"; } if ($delta < 90 * MINUTE) { return "1 hour ago"; } if ($delta < 24 * HOUR) { return floor($delta / HOUR) . " hours ago"; } if ($delta < 48 * HOUR) { return "yesterday"; } if ($delta < 30 * DAY) { return floor($delta / DAY) . " days ago"; } if ($delta < 12 * MONTH) { $months = floor($delta / DAY / 30); return $months <= 1 ? "1 month ago" : $months . " months ago"; } else { $years = floor($delta / DAY / 365); return $years <= 1 ? "1 year ago" : $years . " years ago"; } } /* Parse Twitter Feeds */ function parse_cache_feed($usernames, $limit, $type) { $username_for_feed = str_replace(" ", "+OR+from%3A", $usernames); $feed = "http://twitter.com/statuses/user_timeline.atom?screen_name=" . $username_for_feed . "&count=" . $limit; $usernames_for_file = str_replace(" ", "-", $usernames); $cache_file = dirname(__FILE__).'/cache/' . $usernames_for_file . '-twitter-cache-' . $type; if (file_exists($cache_file)) { $last = filemtime($cache_file); } $now = time(); $interval = 600; // ten minutes // check the cache file if ( !$last || (( $now - $last ) > $interval) ) { // cache file doesn't exist, or is old, so refresh it $cache_rss = file_get_contents($feed); (this is line 64) Any help on how to give this access on my host server?

    Read the article

  • Unix: millionth number in the serie 2 3 4 6 9 13 19 28 42 63 ... ?

    - by HH
    It takes about minute to achieve 3000 in my comp but I need to know the millionth number in the serie. The definition is recursive so I cannot see any shortcuts except to calculate everything before the millionth number. How can you fast calculate millionth number in the serie? Serie Def n_{i+1} = \floor{ 3/2 * n_{i} } and n_{0}=2. Interestingly, only one site list the serie according to Goolge: this one. Too slow Bash code #!/bin/bash function serie { n=$( echo "3/2*$n" | bc -l | tr '\n' ' ' | sed -e 's@\\@@g' -e 's@ @@g' ); # bc gives \ at very large numbers, sed-tr for it n=$( echo $n/1 | bc ) #DUMMY FLOOR func } n=2 nth=1 while [ true ]; #$nth -lt 500 ]; do serie $n # n gets new value in the function throught global value echo $nth $n nth=$( echo $nth + 1 | bc ) #n++ done

    Read the article

  • Global javascript variable inside ready

    - by w0rldart
    Which is the right way of declaring a global javascript variable? The way I'm trying it, doesn't work $(document).ready(function() { var intro; if ($('.intro_check').is(':checked')) { intro = true; $('.intro').wrap('<div class="disabled"></div>'); }; $('.intro_check').change(function(){ if(this.checked) { intro = false; $('.enabled').removeClass('enabled').addClass('disabled'); } else { intro = true; if($('.intro').exists()) { $('.disabled').removeClass('disabled').addClass('enabled'); } else { $('.intro').wrap('<div class="disabled"></div>'); } } }); }); console.log(intro);

    Read the article

  • flash cs4 file reference. Event.COMPLETE not called on a MAC,

    - by jobbie jones
    Hi, I am working with a fileReference, however I'm having issues running on Safari on a MAC... EDIT The below example also doesnt work on Safari on a MAC... http://www.permadi.com/blog/2010/06/flash-as3-using-filereference-to-load-files-example-for-flash-cs4-and-above/ # The workflow on a PC runs as such: 1) Create file reference 2) attach addEventListener's for Event.SELECT and Event.COMPLETE 3) call the browse() method On a PC, Event.SELECT is fired when a file has been selected. Event.COMPLETE is fired when the file data is available to flash. If I select an 500meg file, it takes a few seconds before Event.COMPLETE is fired. If I attempt to access the file data properties (such as reading the data stream) before Event.COMPLETE is fired, I receive null reference errors... So far so good. However, on a MAC (speficially Safari, not tested other browsers), the Event.COMPLETE is not fired. I have checked the Adobe docs, which say Event.COMPLETE is fired when the upload is completed. So why does it get fired on windows when the fileReference has parsed the file, but the upload method has not yet been called... Can anyone help? Here's snippets of the code I am working on: public function browseFile(target:Object):void { var imagesFilter:FileFilter = new FileFilter("Allowed files", "*.jpg;*.bmp;*.flv;"); fileReference.browse([imagesFilter]); fileReference.addEventListener(Event.SELECT, fileSelect); fileReference.addEventListener(Event.COMPLETE, fileSelectComplete); } private function fileSelect(event:Event):void { // update label - IMPORTANT for large files as there's a delay while flash parses file, before control is handed back to this script... setStatusLabel("...loading file"); var fileReference:FileReference = event.target as FileReference; fileReference.addEventListener(Event.COMPLETE, fileSelectComplete); // load the file into the fileReference object fileReference.load(); } // Called when upload file has been processed by flash (a few secs for large files, or fileRef.data is null...) private function fileSelectComplete(event:Event):void { var fileReference:FileReference=event.target as FileReference; trace("ready to do things - but not fired on Safari on a MAC "); }

    Read the article

  • Fullscreen image with jquery on window resize?

    - by lauthiamkok
    I am trying to make fullscreen images with jquery when the window resize function is triggered. But I get this kind of result - where you can see a gap at the bottom of the image which I don't know how to fix it. the basic html, <!-- container --> <div id="container" class="container"> <div class="holder-supersize" id="supersize"> <ul class="background-supersize"> <li><a href="#"><img src="styles/images/IMG_0250.jpg" alt="" width="1000" height="667" /></a></li> <li><a href="#"><img src="styles/images/IMG_0255.jpg" alt="" width="667" height="1000" /></a></li> <li class="active"><a href="#"><img src="styles/images/IMG_0323.jpg" alt="" width="1158" height="772" /></a></li> </ul> </div> </div> <!-- container --> jquery for updating image size on window resize, $(document).ready(function(){ $(window).resize(function(){ $(".holder-supersize").each(function() { //Define image ratio & minimum dimensions var minwidth = .5*(640); var minheight = .5*(480); var ratio = 480/640; //Gather browser and current image size var imagewidth = $(this).width(); var imageheight = $(this).height(); var browserwidth = $(window).width(); var browserheight = $(window).height(); //Check for minimum dimensions if ((browserheight < minheight) && (browserwidth < minwidth)){ $(this).height(minheight); $(this).width(minwidth); } else { //When browser is taller if (browserheight > browserwidth){ imageheight = browserheight; $(this).height(browserheight); imagewidth = browserheight/ratio; $(this).width(imagewidth); if (browserwidth > imagewidth){ imagewidth = browserwidth; $(this).width(browserwidth); imageheight = browserwidth * ratio; $(this).height(imageheight); } } //When browser is wider if (browserwidth >= browserheight){ imagewidth = browserwidth; $(this).width(browserwidth); imageheight = browserwidth * ratio; $(this).height(imageheight); if (browserheight > imageheight){ imageheight = browserheight; $(this).height(browserheight); imagewidth = browserheight/ratio; $(this).width(imagewidth); } } } return false; }); }); }); CSS for supersize image /* Supersize -------------------------------------------*/ .holder-supersize { width:100%; height:100%; position:absolute; left:0; top:0; z-index:0; } .background-supersize { width:100%; height:100%; overflow:hidden; position:relative; } .background-supersize li { width:100%; height:100%; overflow:hidden; position:absolute; left:0; top:0; text-align:center; } .background-supersize li img { /* for image with height < width */ /**/ width:100%; height:auto; /* for image with height > width */ /* width:auto; height:100%; */ } .background-supersize li , .background-supersize a, .background-supersize img{ display:none; } .background-supersize .active, .background-supersize .active a, .background-supersize .active img{ display:inline; } This is the link at jsfiddle and this is the link to see the actual product. Any ideas what I have done wrong and how can I fix it?

    Read the article

  • jQuery Plugin with $.getJSON Returning undefined?

    - by Oscar Godson
    Inside of a jQuery plugin I made I have: $.getJSON(base_url,{ agenda_id:defaults.id, action:defaults.action+defaults.type, output:defaults.output },function(json){ return json; }); And in a separate JS file (yes, it comes after the plugin): json = $('#agenda-live-preview').agenda({action:'get',type:'agenda',output:'json'}); alert(json[0].agenda_id); If i do the above $.getJSON and put an alert inside of the $.getJSON it works and returns "3", which is correct. If I do it like the json=$('#agenda-live-preview').agenda(...)... it returns undefined. My JSON is valid, and the json[0].agenda_id is correct also, I know it's in a callback, so how do I get the stuff inside of a callback in a function return?

    Read the article

  • How modify ascii table in C?

    - by drigoSkalWalker
    like this: My ASCII Chart 0 1 2 3 4 5 6 7 8 9 A B C D E F 0 NUL SOH STX ETX EOT ENQ ACK BEL BS HT LF VT FF CR SO SI 1 DLE DC1 DC2 DC3 DC4 NAK SYN ETB CAN EM SUB ESC FS GS RS US 2 SP ! " # $ % & ' ( ) * + , - . / 3 0 1 2 3 4 5 6 7 8 9 : ; ? 4 @ A B C D E F G H I J K L M N O 5 P Q R S T U V W X Y Z [ \ ] ^ _ 6 ` a b c d e f g h i j k l m n o 7 p q r s t u v w x y z { | } ~ DEL I want to call a function, alter the ascii sequence in this function and when it return, the ascii sequence back to the original. thanks in advance!

    Read the article

  • Generating random numbers in C

    - by moonstruckhorrors
    While searching for Tutorials on generating random numbers in C I found This Topic When I try to use the rand() function with parameters, I always get the random number generated 0. When I try to use the rand() function with parameters, I always get the value 41. And whenever I try to use arc4random() and random() functions, I get a LNK2019 error. Here's what I'm doing: #include <stdlib.h> int main() { int x; x = rand(6); printf("%d", x); } This code always generate 41. Where am I going wrong?? P.S. : I'm running Windows XP SP3 and using VS2010 Command Prompt as compiler. P.P.S. : Took me 15 minutes to learn how to format properly.

    Read the article

  • Get the WPMU default blog domain

    - by RobertWHurst
    I have a network of blogs that link to each other. The problem is when I want to get the primary blog's domain. I need it for things like the the target of the logo when clicked. I can't seem to find a function in WPMU the retrieves this. I can see the value I want in the wp_site table. I could easily get it with $wpdb, but its a bit over kill, and if there is a function that can get the value already, then I want to use it.

    Read the article

  • Wrong image dimensions when it's dynamically loaded on a page the 1st time

    - by Nikita Barsukov
    I have the following piece of Javascript code on my web-page var central_image = document.createElement("img") central_image.setAttribute("src", imgs[curr_image_no - 1]); central_image.setAttribute("name", "jpeg"); document.getElementById("photo").appendChild(central_image); central_image.onload = getDimensions(); //function that alerts image dimensions Now, when the central_image is loaded for the 1st time in Firefox, its height always equals to 0. In IE its dimensions are 28 x 30 pixels. When I reload image, its dimensions are OK in both browsers. I guess the problem is that function getDimensions() starts before image was loaded completely. How to change that?

    Read the article

  • Problem in passing arrays from C# to C++

    - by Rakesh K
    Hi, I have an application in which I need to pass an array from C# to a C++ DLL. What is the best method to do it? I did some search on Internet and figured out that I need to pass the arrays from C# using ref. The code for the same: status = IterateCL(ref input, ref output); The input and output arrays are of length 20. and the corresponding code in C++ DLL is IterateCL(int *&inArray, int *&outArray) This works fine for once. But if I try to call the function from C# in a loop the second time, the input array in C# is showing up as an array of one element. Why is this happening and please help me how I can call this function iteratively from C#. Thanks, Rakesh.

    Read the article

  • Why is FLD1 loading NaN instead?

    - by Bernd Jendrissek
    I have a one-liner C function that is just return value * pow(1.+rate, -delay); - it discounts a future value to a present value. The interesting part of the disassembly is 0x080555b9 : neg %eax 0x080555bb : push %eax 0x080555bc : fildl (%esp) 0x080555bf : lea 0x4(%esp),%esp 0x080555c3 : fldl 0xfffffff0(%ebp) 0x080555c6 : fld1 0x080555c8 : faddp %st,%st(1) 0x080555ca : fxch %st(1) 0x080555cc : fstpl 0x8(%esp) 0x080555d0 : fstpl (%esp) 0x080555d3 : call 0x8051ce0 0x080555d8 : fmull 0xfffffff8(%ebp) While single-stepping through this function, gdb says (rate is 0.02, delay is 2; you can see them on the stack): (gdb) si 0x080555c6 30 return value * pow(1.+rate, -delay); (gdb) info float R7: Valid 0x4004a6c28f5c28f5c000 +41.68999999999999773 R6: Valid 0x4004e15c28f5c28f6000 +56.34000000000000341 R5: Valid 0x4004dceb851eb851e800 +55.22999999999999687 R4: Valid 0xc0008000000000000000 -2 =R3: Valid 0x3ff9a3d70a3d70a3d800 +0.02000000000000000042 R2: Valid 0x4004ff147ae147ae1800 +63.77000000000000313 R1: Valid 0x4004e17ae147ae147800 +56.36999999999999744 R0: Valid 0x4004efb851eb851eb800 +59.92999999999999972 Status Word: 0x1861 IE PE SF TOP: 3 Control Word: 0x037f IM DM ZM OM UM PM PC: Extended Precision (64-bits) RC: Round to nearest Tag Word: 0x0000 Instruction Pointer: 0x73:0x080555c3 Operand Pointer: 0x7b:0xbff41d78 Opcode: 0xdd45 And after the fld1: (gdb) si 0x080555c8 30 return value * pow(1.+rate, -delay); (gdb) info float R7: Valid 0x4004a6c28f5c28f5c000 +41.68999999999999773 R6: Valid 0x4004e15c28f5c28f6000 +56.34000000000000341 R5: Valid 0x4004dceb851eb851e800 +55.22999999999999687 R4: Valid 0xc0008000000000000000 -2 R3: Valid 0x3ff9a3d70a3d70a3d800 +0.02000000000000000042 =R2: Special 0xffffc000000000000000 Real Indefinite (QNaN) R1: Valid 0x4004e17ae147ae147800 +56.36999999999999744 R0: Valid 0x4004efb851eb851eb800 +59.92999999999999972 Status Word: 0x1261 IE PE SF C1 TOP: 2 Control Word: 0x037f IM DM ZM OM UM PM PC: Extended Precision (64-bits) RC: Round to nearest Tag Word: 0x0020 Instruction Pointer: 0x73:0x080555c6 Operand Pointer: 0x7b:0xbff41d78 Opcode: 0xd9e8 After this, everything goes to hell. Things get grossly over or undervalued, so even if there were no other bugs in my freeciv AI attempt, it would choose all the wrong strategies. Like sending the whole army to the arctic. (Sigh, if only I were getting that far.) I must be missing something obvious, or getting blinded by something, because I can't believe that fld1 should ever possibly fail. Even less that it should fail only after a handful of passes through this function. On earlier passes the FPU correctly loads 1 into ST(0). The bytes at 0x080555c6 definitely encode fld1 - checked with x/... on the running process. What gives?

    Read the article

  • Construct a variadic template of unsigned int recursively

    - by Vincent
    I need a tricky thing in a C++ 2011 code. Currently, I have a metafunction of this kind : template<unsigned int N, unsigned int M> static constexpr unsigned int myFunction() This function can generate number based on N and M. I would like to write a metafunction with input N and M, and that will recursively construct a variadic template by decrementing M. For example, by calling this function with M = 3, It will construct a variadic template called List equal to : List... = myFunction<N, 3>, myFunction<N, 2>, myFunction<N, 1>, myFunction<N, 0> How to do that (if it is possible of course) ?

    Read the article

  • Efficient implementation of natural logarithm (ln) and exponentiation

    - by Donotalo
    Basically, I'm looking for implementation of log() and exp() functions provided in C library <math.h>. I'm working with 8 bit microcontrollers (OKI 411 and 431). I need to calculate Mean Kinetic Temperature. The requirement is that we should be able to calculate MKT as fast as possible and with as little code memory as possible. The compiler comes with log() and exp() functions in <math.h>. But calling either function and linking with the library causes the code size to increase by 5 Kilobytes, which will not fit in one of the micro we work with (OKI 411), because our code already consumed ~12K of available ~15K code memory. The implementation I'm looking for should not use any other C library functions (like pow(), sqrt() etc). This is because all library functions are packed in one library and even if one function is called, the linker will bring whole 5K library to code memory.

    Read the article

  • Using jQuery to find keywords in string

    - by Nic Hubbard
    In php, I have used preg_match_all() to find keywords (using the format %keyword%) in a string, which works wonderfully and returns an array of all found keywords. What I would like to do, is do the same thing using jQuery or javascript. I have tried using the filter() function, and it kind of works. But I think I am missing something. How can I find ALL instances of the keyword in a string, using a regex? Here is what I have worked out so far: $("[id^='editableContent-']").filter(function() { alert($(this).html().match(/\%(.*?)\%/)); }); Any suggestions are welcome!

    Read the article

  • Ajax doesn't work on remote server .

    - by Nuha
    Hello . when I Implemented chatting Function , I use Ajax to send messages between file to another . so , it is working well on local host . but , when I upload it in to remote server it doesn't work. can U tell me ,why ? is an Ajax need Special configuration ? Ajax code : function Ajax_Send(GP,URL,PARAMETERS,RESPONSEFUNCTION){? var xmlhttp? try{xmlhttp=new ActiveXObject("Msxml2.XMLHTTP")}? catch(e){? try{xmlhttp=new ActiveXObject("Microsoft.XMLHTTP")}? catch(e){? try{xmlhttp=new XMLHttpRequest()}? catch(e){? alert("Your Browser Does Not Support AJAX")}}}? ? err=""? if (GP==undefined) err="GP "? if (URL==undefined) err +="URL "? if (PARAMETERS==undefined) err+="PARAMETERS"? if (err!=""){alert("Missing Identifier(s)\n\n"+err);return false;}? ? xmlhttp.onreadystatechange=function(){? if (xmlhttp.readyState == 4){? if (RESPONSEFUNCTION=="") return false;? eval(RESPONSEFUNCTION(xmlhttp.responseText))? }? }? ? if (GP=="GET"){? URL+="?"+PARAMETERS? xmlhttp.open("GET",URL,true)? xmlhttp.send(null)? }? ? if (GP="POST"){? PARAMETERS=encodeURI(PARAMETERS)? xmlhttp.open("POST",URL,true)? xmlhttp.setRequestHeader("Content-type", "application/x-www-form-urlencoded")? xmlhttp.setRequestHeader("Content-length",PARAMETERS.length)? xmlhttp.setRequestHeader("Connection", "close")? xmlhttp.send(PARAMETERS)? }? }

    Read the article

  • visual studio 2008 linker error

    - by ravi
    In visual studio 2008, I have created a static dll called test_static.dll. I am trying to call this from one application. I have included this dll in source files folder and the header file related to it in headers folder. When i am running the application I am getting following liking error. Please give me a solution. error LNK2019: unresolved external symbol "struct morph_output * __cdecl morpho_data(struct morph_input *)" (?morpho_data@@YAPAUmorph_output@@PAUmorph_input@@@Z) referenced in function _wmain 1D:\test_app\Debug\test_app.exe : fatal error LNK1120: 1 unresolved externals 1Build log was saved at "file://d:\test_app\test_app\Debug\BuildLog.htm" Here test_app is application that is using static dll. and morpho_data is the dll function which is taking input as structure and returning another structure.

    Read the article

  • Linking to a C library compiled as C++

    - by Jacob
    I'm in linker paradise now. I have a C library which only compiles in Visual C++ (it probably works in gcc) if: I compile it as C++ code Define __cplusplus which results in all the declarations being enclosed in extern "C" { } So, by doing this I have a static library called, say, bsbs.lib Now, I have a C++ project called Tester which would like to call function barbar in declared in bsbs.h. All goes fine, until I try to link to bsbs.lib where I get the all-too-familiar: Tester.obj : error LNK2001: unresolved external symbol _foofoo And it always seems to be foofoo which cannot be resolved regardless of which function I call in Tester (barbar or anything else).

    Read the article

  • How should I port this Prototype to JQuery?

    - by blu
    There is currently this Prototype code that does a PUT: new Ajax.Request(someUrl, { method: 'put', parameters: { 'foo': bar }, onSuccess: function(response) { } .bind(this) }); I found this post but the solution uses an extra parameter supported by RoR, however I am targeting an ASP.NET backend. I searched a bit and found that not all browsers support PUT operations so apparently this could fail in certain browsers? This is already in prod, so a direct port would be fine for now I suppose. As an aside, what is the deal with the bind(this) in the onSuccess function?

    Read the article

  • Slider with keypress control bugs when keys pressed to quickly.

    - by Jaybuz
    Hello, I've made a slider that uses the left and right arrow keys to move the slide but when pressed to quickly it will bug a little and I was wondering if it's possible to limit the amount of presses in say a second. You can see it here: {link} $('#slider-nav div').click(function() { $('#slider-nav div').removeClass('selected').addClass(''); $('#slider-nav div:eq('+($.jcarousel.intval($(this).text())-1)+')').addClass('selected'); }) // Allow left and right keys to control slider $(document.documentElement).keypress(function(e) { var code = (e.keyCode ? e.keyCode : e.which); var direction = null; // handle cursor keys if (code == 37) { // left key direction = 'prev'; } else if (code == 39) { // right key direction = 'next'; } if (direction != null) { $('#slider-nav div.selected')[direction]().click(); } });

    Read the article

  • Void pointer values comparing C++

    - by user2962977
    My actual question is it really possible to compare values contained in two void pointers, when you actually know that these values are the same type? For example int. void compVoids(void *firstVal, void *secondVal){ if (firstVal < secondVal){ cout << "This will not make any sense as this will compare addresses, not values" << endl; } } Actually I need to compare two void pointer values, while outside the function it is known that the type is int. I do not want to use comparison of int inside the function. So this will not work for me as well: if (*(int*)firstVal > *(int*)secondVal) Any suggestions? Thank you very much for help!

    Read the article

  • How to have type hinting in PHP that specifies variable scope inside of a template? (specifically PhpStorm)

    - by Lance Rushing
    I'm looking for a doc comment that would define the scope/context of the current php template. (similar to @var) Example View Class: <?php class ExampleView { protected $pageTitle; public function __construct($title) { $this->pageTitle = $title; } public function render() { require_once 'template.php'; } } -- <?php // template.php /** @var $this ExampleView */ echo $this->pageTitle; PHPStorm gives an inspection error because the access on $pageTitle is protected. Is there a hint to give scope? Something like: <?php // template.php /** @scope ExampleView */ // <---???? /** @var $this ExampleView */ echo $this->pageTitle;

    Read the article

< Previous Page | 623 624 625 626 627 628 629 630 631 632 633 634  | Next Page >