Search Results

Search found 37844 results on 1514 pages for 'function composition'.

Page 633/1514 | < Previous Page | 629 630 631 632 633 634 635 636 637 638 639 640  | Next Page >

• How do you modify a modal popup from ASP codebehind instead of letting it close?

  - by user328422

  I'm using SimpleModal to create a popup on an ASP.net application. The OK button calls a server-side function - and based on the resulta of that function I'd like to modify the popup (make some things visible, etc.) instead of letting it close. If that's too difficult, I'd like to open the popup again without the user having to re-click on anything. I'm just not sure what the best way to do this is. Currently the OK button in the popup looks like this: <asp:ImageButton ID="submitInfoBtn" OnClick="btnSubmitInfo_Click" ImageUrl="css/assets/btn_ok.png" runat="server"/> and there is nothing defined that tells anything that the OK button should close the popup (the Cancel button has class="simplemodal-close", so I would expect it to do just that, but not the OK button) - anyone have any ideas on the best way through this? Thanks in advance!!

  Read the article

• XML pass values to timer, AS3

  - by VideoDnd

  My timer has three variables that I can trace to the output window, but don't know how to pass them to the timer. How to I pass the XML values to my timer? Purpose I want to test with an XML document, before I try connecting it to an XML socket. myXML <?xml version="1.0" encoding="utf-8"?> <SESSION> <TIMER TITLE="speed">100</TIMER> <COUNT TITLE="starting position">-77777</COUNT> <FCOUNT TITLE="ramp">1000</FCOUNT> </SESSION> myFlash //myTimer 'instance of mytext on stage' /* fields I want to change with XML */ //CHANGE TO 100 var timer:Timer = new Timer(10); //CHANGE TO -77777 var count:int = 0; //CHANGE TO 1000 var fcount:int = 0; timer.addEventListener(TimerEvent.TIMER, incrementCounter); timer.start(); function incrementCounter(event:TimerEvent) { count++; fcount=int(count*count/1000);//starts out slow... then speeds up mytext.text = formatCount(fcount); } function formatCount(i:int):String { var fraction:int = i % 100; var whole:int = i / 100; return ("0000000" + whole).substr(-7, 7) + "." + (fraction < 10 ? "0" + fraction : fraction); } //LOAD XML var myXML:XML; var myLoader:URLLoader = new URLLoader(); myLoader.load(new URLRequest("time.xml")); myLoader.addEventListener(Event.COMPLETE, processXML); //PARSE XML function processXML(e:Event):void { myXML = new XML(e.target.data); trace(myXML.ROGUE.*); trace(myXML); //TEXT var text:TextField = new TextField(); text.text = myXML.TIMER.*; text.textColor = 0xFF0000; addChild(text); } RESOURCES OReilly's ActionScript 3.0 Cookbook, Chapter 12 Strings, Chapter 20 XML

  Read the article

• Mocking imported modules in Python

  - by Evgenyt

  I'm trying to implement unit tests for function that uses imported external objects. For example helpers.py is: import os import pylons def some_func(arg): ... var1 = os.path.exist(...) var2 = os.path.getmtime(...) var3 = pylons.request.environ['HTTP_HOST'] ... So when I'm creating unit test for it I do some mocking (minimock in my case) and replacing references to pylons.request and os.path: import helpers def test_some_func(): helpers.pylons.request = minimock.Mock("pylons.request") helpers.pylons.request.environ = { 'HTTP_HOST': "localhost" } helpers.os.path = minimock.Mock(....) ... some_func(...) # assert ... This does not look good for me. Is there any other better way or strategy to substitute imported function/objects in Python?

  Read the article

• Chrome Javascript

  - by Mike

  i have two spans on my page with class='hidden' and then some javascript to remove the class when a condition is met, its working fine in ie 9/10 and firefox but its not working in chrome when I run the function in the chrome JS console I get the message TypeError: Cannot read property 'attributes' of null Anybody know whats going on? <script type='text/javascript' > function showhidden() { var att =document.getElementById('hiddentextbox'); att.attributes[0].value=''; att =document.getElementById('hiddentextbox1'); att.attributes[0].value=''; }</script> Thanks

  Read the article

• Passing an array for setting variable

  - by mathk

  Hi, I often see this idiom when reading php code: public function __construct($config) { if (array_key_exists('options', $config)) { ... } if (array_key_exists('driver_options', $config)) { ... } } Here I am concern with the way the parameter is used. If I were in lisp I would do: (defun ct (&key options driver_options) (do-something-with-option-and-driver_option)) But since I am in PHP I would rather have a constructor that take a list of parameter and let them be null if there a not require. So what do you guys think about having an array as parameter in other to do some initialization-or-whatever? In other to answer you have to take in account the point of view of the user of the function and the designer of the API. Also have you ever heard this has a code-smell? thanks

  Read the article

• Refreshing metadata on user functions t-SQL

  - by luckyluke

  I am doing some T-SQL programming and I have some Views defines on my database. The data model is still changing these days and I have some table functions defined. Sometimes i deliberately use select * from MYVIEW in such a table function to return all columns. If the view changes (or table) the function crashes and I need to recompile it. I know it is in general good thing so that it prevents from hell lotta errors but still... Is there a way to write such functions so the dont' blow up in my face everytime I change something on the underlying table? Or maybe I am doing something completely wrong... Thanks for help

  Read the article

• Good Drupal IDEs?

  - by rlb.usa

  Are there any Drupal IDE's with syntax highlighting, and possibly intellisense, function descriptors?

  Read the article

• Firefox, prevent rendering between javascript statements.

  - by Erik

  I'm trying to create some kind of zoom around the mouse cursor feature on my website which ultimately runs these two lines (+ the same for height/scrollTop). canvas.style.width = someValue; canvas.parentNode.scrollLeft = someOtherValue; The problem is that in firefox(3.6) the page is re-rendered directly after the first row has been executed and since the view is depending on both values this means that every time i recalculate the view firefox will will render an invalid view before the correct one, in other words creating flicker. I've tried swapping the two rows but get the same problem. In chrome, opera and IE this doesn't happen. Both lines are executed before any rendering is done. Is there any way to lock the rendering manually, maybe something like this? document.disableRendering(); //fantasy function canvas.style.width = someValue; canvas.parentNode.scrollLeft = someOtherValue; document.enableRendering(); //fantasy function

  Read the article

• Get jQuery Error if PHP Breaks

  - by Norbert

  I have a PHP script that breaks if a variable is not populated and it isn't added to the database, but jQuery handles this as a success and I get this error: TypeError: Result of expression 'data' [null] is not an object. Here's the jQuery script: $.ajax({ type: "POST", url: "/clase/do-add", data: $("#adauga").serialize(), dataType: "json", error: function (xhr, textStatus, errorThrown) { alert('Try again.'); }, success: function(data) { var dlHTML = '<dl id="' + data.id + '"> [too long] </dl>'; $('form#adauga').after(dlHTML); $('#main dl:first').hide().fadeIn(); adaugaClasaSubmit.removeAttr('disabled'); adaugaClasa.removeAttr('readonly'); adaugaClasa.val("").focus(); } });

  Read the article

• Confused about adding multiple td's to tr using jQuery

  - by Jason

  So I have the following code: <script type="text/javascript"> $(document).ready( function () { $("#txt").click(function () { var $TableRow = $('<tr></tr>'); var $TableData = $('<td></td>'); var $TableData2 = $('<td></td>'); // Works $("#tblControls").append( $TableRow.html( $TableData.text("Test, Hello World3") ) ); </script> <div style="display: inline"> <input type="button" id="txt" value="Add TextBox" style="" /> </div> <br/> <table id="tblControls" width="100%"> </table> But why does this not add two td's to the tr? $("#tblControls").append( $TableRow.html( $TableData.text("Test, Hello World3") + $TableData2.text("Test, Hello World4") ) ); What I get is this: [object Object][object Object]

  Read the article

• Server Error Message: No File Access

  - by iMayne

  Hello. Im having an issues but dont know where to solve it. My template works great in xampp but not on the host server. I get this message: Warning: file_get_contents() [function.file-get-contents]: URL file-access is disables in the server configuration in homepage/......./twitter.php. The error is on line 64. <?php /* For use in the "Parse Twitter Feeds" code below */ define("SECOND", 1); define("MINUTE", 60 * SECOND); define("HOUR", 60 * MINUTE); define("DAY", 24 * HOUR); define("MONTH", 30 * DAY); function relativeTime($time) { $delta = time() - $time; if ($delta < 2 * MINUTE) { return "1 min ago"; } if ($delta < 45 * MINUTE) { return floor($delta / MINUTE) . " min ago"; } if ($delta < 90 * MINUTE) { return "1 hour ago"; } if ($delta < 24 * HOUR) { return floor($delta / HOUR) . " hours ago"; } if ($delta < 48 * HOUR) { return "yesterday"; } if ($delta < 30 * DAY) { return floor($delta / DAY) . " days ago"; } if ($delta < 12 * MONTH) { $months = floor($delta / DAY / 30); return $months <= 1 ? "1 month ago" : $months . " months ago"; } else { $years = floor($delta / DAY / 365); return $years <= 1 ? "1 year ago" : $years . " years ago"; } } /* Parse Twitter Feeds */ function parse_cache_feed($usernames, $limit, $type) { $username_for_feed = str_replace(" ", "+OR+from%3A", $usernames); $feed = "http://twitter.com/statuses/user_timeline.atom?screen_name=" . $username_for_feed . "&count=" . $limit; $usernames_for_file = str_replace(" ", "-", $usernames); $cache_file = dirname(__FILE__).'/cache/' . $usernames_for_file . '-twitter-cache-' . $type; if (file_exists($cache_file)) { $last = filemtime($cache_file); } $now = time(); $interval = 600; // ten minutes // check the cache file if ( !$last || (( $now - $last ) > $interval) ) { // cache file doesn't exist, or is old, so refresh it $cache_rss = file_get_contents($feed); (this is line 64) Any help on how to give this access on my host server?

  Read the article

• Javascript: Using the Module Pattern for larger projects

  - by Rob

  I'm interested in using the Module Pattern to better organize my future projects. Unfortunately, there are only a few brief tutorials and proof-of-concept examples of the Module Pattern. Using the module pattern, I would like to organize projects into this sort of structure: project.arm.object.method(); Where "project" is my global project name, "arm" is a sub-section or branch of the project, "object" is an individual object, and so on to the methods and properties. However, I'm not sure how I should be declaring and organizing multiple "arms" and "objects" under "project". var project = window.project || {}; project.arm = project.arm || {}; project.arm.object = (function() { var privateVar = "Private contents."; function privateMethod() { alert(privateVar); } return { method: privateMethod }; }()); Are there any best practices or conventions when defining a complex module structure? Should I just declare a new arm/object underneath the last?

  Read the article

• Global javascript variable inside ready

  - by w0rldart

  Which is the right way of declaring a global javascript variable? The way I'm trying it, doesn't work $(document).ready(function() { var intro; if ($('.intro_check').is(':checked')) { intro = true; $('.intro').wrap('<div class="disabled"></div>'); }; $('.intro_check').change(function(){ if(this.checked) { intro = false; $('.enabled').removeClass('enabled').addClass('disabled'); } else { intro = true; if($('.intro').exists()) { $('.disabled').removeClass('disabled').addClass('enabled'); } else { $('.intro').wrap('<div class="disabled"></div>'); } } }); }); console.log(intro);

  Read the article

• How do I combine 2 prewritten Javascript functions

  - by Rob Bennet

  Would I want to nest one function into another?

  Read the article

• def constrainedMatchPair(firstMatch,secondMatch,length):

  - by smart

  matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

  Read the article

• Inline assembler get address of pointer Visual Studio

  - by Joe

  I have a function in VS where I pass a pointer to the function. I then want to store the pointer in a register to further manipulate. How do you do that? I have tried void f(*p) { __asm mov eax, p // try one FAIL __asm mov eax, [p] // try two FAIL __asm mov eax, &p // try three FAIL } Both 1 and 2 are converted to the same code and load the value pointed to. I just want the address. Oddly, option 1 works just fine with integers. void f() { int i = 5; __asm mov eax, i // SUCCESS? }

  Read the article

• highlight query string in more than one field using solr search feature

  - by Romi

  i am using solr indexes for showing my search results. to show serch results i am parsing json data received from solr. i am able to highlight a query string in search result but only in a single field. for this i set hl=true and hl.fl="field1". i did it as $.getJSON("http://192.168.1.9:8983/solr/db/select/?wt=json&&start=0&rows=100&q="+lowerCaseQuery+"&hl=true&hl.fl=description,name&hl.usePhraseHighlighter=true&sort=price asc&json.wrf=?", function(result){ var n=result.response.numFound var highlight = new Array(n); $.each(result.highlighting, function(i, hitem){ var match = hitem.text[0].match(/<em>(.*?)<\/em>/); highlight[i]=match[1]; }); $.each(newresult.response.docs, function(i,item){ var word=highlight[item["UID_PK"]]; var result = item.text[0].replace(new RegExp(word,'g'), '<em>' + word + '</em>'); }); for this json object is as : { "responseHeader": { "status": 0, "QTime": 32 }, "response": { "numFound": 21, "start": 0, "docs": [ { "description": "The matte finish waves on this wedding band contrast with the high polish borders. This sharp and elegant design was finely crafted in Japan.", "UID_PK": "8252", }, { "description": "This elegant ring has an Akoya cultured pearl with a band of bezel-set round diamonds making it perfect for her to wear to work or the night out.", "UID_PK": "8142", }, ] }, "highlighting": { "8252": { "description": [ " and <em>elegant</em> design was finely crafted in Japan." ] }, "8142": { "description": [ "This <em>elegant</em> ring has an Akoya cultured pearl with a band of bezel-set round diamonds making" ] }, } } Now if i want to highlight query string in two fields i did as hl=true hl.fl=descrption, name my json is as: { "responseHeader":{ "status":0, "QTime":16 }, "response":{ "numFound":1904, "start":0, "docs":[ { "description":"", "UID_PK":"7780", "name":[ "Diamond bracelet with Milgrain Bezel1" ] }, { "description":"This pendant is sure to win hearts. Round diamonds form a simple and graceful line.", "UID_PK":"8121", "name":[ "Heartline Diamond Pendant" ] }, "highlighting":{ "7780":{ "name":[ "<em>Diamond</em> bracelet with Milgrain Bezel1" ] }, "8121":{ "description":[ "This pendant is sure to win hearts. Round <em>diamonds</em> form a simple and graceful line." ], "name":[ "Heartline <em>Diamond</em> Pendant" ] } } } Now how should i parse it to get the result. suggest me some general technique, so if i want to highlight query in more fields then i could do so. Thanks

  Read the article

• flash cs4 file reference. Event.COMPLETE not called on a MAC,

  - by jobbie jones

  Hi, I am working with a fileReference, however I'm having issues running on Safari on a MAC... EDIT The below example also doesnt work on Safari on a MAC... http://www.permadi.com/blog/2010/06/flash-as3-using-filereference-to-load-files-example-for-flash-cs4-and-above/ # The workflow on a PC runs as such: 1) Create file reference 2) attach addEventListener's for Event.SELECT and Event.COMPLETE 3) call the browse() method On a PC, Event.SELECT is fired when a file has been selected. Event.COMPLETE is fired when the file data is available to flash. If I select an 500meg file, it takes a few seconds before Event.COMPLETE is fired. If I attempt to access the file data properties (such as reading the data stream) before Event.COMPLETE is fired, I receive null reference errors... So far so good. However, on a MAC (speficially Safari, not tested other browsers), the Event.COMPLETE is not fired. I have checked the Adobe docs, which say Event.COMPLETE is fired when the upload is completed. So why does it get fired on windows when the fileReference has parsed the file, but the upload method has not yet been called... Can anyone help? Here's snippets of the code I am working on: public function browseFile(target:Object):void { var imagesFilter:FileFilter = new FileFilter("Allowed files", "*.jpg;*.bmp;*.flv;"); fileReference.browse([imagesFilter]); fileReference.addEventListener(Event.SELECT, fileSelect); fileReference.addEventListener(Event.COMPLETE, fileSelectComplete); } private function fileSelect(event:Event):void { // update label - IMPORTANT for large files as there's a delay while flash parses file, before control is handed back to this script... setStatusLabel("...loading file"); var fileReference:FileReference = event.target as FileReference; fileReference.addEventListener(Event.COMPLETE, fileSelectComplete); // load the file into the fileReference object fileReference.load(); } // Called when upload file has been processed by flash (a few secs for large files, or fileRef.data is null...) private function fileSelectComplete(event:Event):void { var fileReference:FileReference=event.target as FileReference; trace("ready to do things - but not fired on Safari on a MAC "); }

  Read the article

• jquery iterating through newly created elements

  - by jaeyun

  Hi All, I am trying to add new rows in my table, and save them into DB. First, I use .append() to append rows on the table: $("#tablename").append("<tr id='newRow'><td>newly added row</td></tr>"); The appending function works fine. My page displays the correct result. However, I am unable to select them with $("#newRow").each(function () { alert "it never reaches here!"; }); I am guessing it is because the elements are added after the DOM is loaded. Can anyone please tell me how I can iterate through all my newly added elements? Thank you.

  Read the article

• Generating random numbers in C

  - by moonstruckhorrors

  While searching for Tutorials on generating random numbers in C I found This Topic When I try to use the rand() function with parameters, I always get the random number generated 0. When I try to use the rand() function with parameters, I always get the value 41. And whenever I try to use arc4random() and random() functions, I get a LNK2019 error. Here's what I'm doing: #include <stdlib.h> int main() { int x; x = rand(6); printf("%d", x); } This code always generate 41. Where am I going wrong?? P.S. : I'm running Windows XP SP3 and using VS2010 Command Prompt as compiler. P.P.S. : Took me 15 minutes to learn how to format properly.

  Read the article

• Get the WPMU default blog domain

  - by RobertWHurst

  I have a network of blogs that link to each other. The problem is when I want to get the primary blog's domain. I need it for things like the the target of the logo when clicked. I can't seem to find a function in WPMU the retrieves this. I can see the value I want in the wp_site table. I could easily get it with $wpdb, but its a bit over kill, and if there is a function that can get the value already, then I want to use it.

  Read the article

• Problem in passing arrays from C# to C++

  - by Rakesh K

  Hi, I have an application in which I need to pass an array from C# to a C++ DLL. What is the best method to do it? I did some search on Internet and figured out that I need to pass the arrays from C# using ref. The code for the same: status = IterateCL(ref input, ref output); The input and output arrays are of length 20. and the corresponding code in C++ DLL is IterateCL(int *&inArray, int *&outArray) This works fine for once. But if I try to call the function from C# in a loop the second time, the input array in C# is showing up as an array of one element. Why is this happening and please help me how I can call this function iteratively from C#. Thanks, Rakesh.

  Read the article

• AJAX XML reply node value iteration

  - by XpiritO

  Hi there, guys. I would really appreciate to get your help on this, as I can't seem to detect and solve the problem I'm having with an AJAX functionality on a site that I'm currently developing. I have a webform that makes an asynchronous call to a handler (.ashx) that delivers a XML response that is later processed by a Javascript client-side function that places it's contents into the user-interface. I'm attaching an example of the response generated by my handler, and what I would like to know is how can I get all the <body> element innerHTML (with the text and child nodes) contents to append it to a <span> element on the user-interface. Can anyone help me out with this? XML Response returned by the handler (checked via Firebug): <message> <content> <messageId>2</messageId> <from>Barack Obama</from> <fromMail>[email protected]</fromMail> <subject>Yes, we can... get World Peace</subject> <body>Hello, dear citizen. I'm sending you this message to invite you to join us! <a href="http://www.whitehouse.gov">Test link</a> Thank you for your time.</body> </content> </message> Client-side Javascript function to affect the user-interface innerHTML property with the data returned via AJAX: function GetMessageContentsCallback(args, resp) { //XML Parser try { //Internet Explorer xmlDoc = new ActiveXObject("Microsoft.XMLDOM"); xmlDoc.async = "false"; xmlDoc.loadXML(resp); } catch (e) { parser = new DOMParser(); xmlDoc = parser.parseFromString(resp, "text/xml"); } var msgReply = xmlDoc.getElementsByTagName('message')[0]; var ajaxRespondeBodyInnerHTML = msgReply.getElementsByTagName(body)[0].firstChild.nodeValue; //this currently only delivers inner text content, without the <a href... bit and subsequent text document.getElementById("bodySpan").innerHTML = ajaxRespondeBodyInnerHTML; }

  Read the article

• How modify ascii table in C?

  - by drigoSkalWalker

  like this: My ASCII Chart 0 1 2 3 4 5 6 7 8 9 A B C D E F 0 NUL SOH STX ETX EOT ENQ ACK BEL BS HT LF VT FF CR SO SI 1 DLE DC1 DC2 DC3 DC4 NAK SYN ETB CAN EM SUB ESC FS GS RS US 2 SP ! " # $ % & ' ( ) * + , - . / 3 0 1 2 3 4 5 6 7 8 9 : ; ? 4 @ A B C D E F G H I J K L M N O 5 P Q R S T U V W X Y Z [ \ ] ^ _ 6 ` a b c d e f g h i j k l m n o 7 p q r s t u v w x y z { | } ~ DEL I want to call a function, alter the ascii sequence in this function and when it return, the ascii sequence back to the original. thanks in advance!

  Read the article

• Wrong image dimensions when it's dynamically loaded on a page the 1st time

  - by Nikita Barsukov

  I have the following piece of Javascript code on my web-page var central_image = document.createElement("img") central_image.setAttribute("src", imgs[curr_image_no - 1]); central_image.setAttribute("name", "jpeg"); document.getElementById("photo").appendChild(central_image); central_image.onload = getDimensions(); //function that alerts image dimensions Now, when the central_image is loaded for the 1st time in Firefox, its height always equals to 0. In IE its dimensions are 28 x 30 pixels. When I reload image, its dimensions are OK in both browsers. I guess the problem is that function getDimensions() starts before image was loaded completely. How to change that?

  Read the article

< Previous Page | 629 630 631 632 633 634 635 636 637 638 639 640  | Next Page >