Search Results

Search found 23708 results on 949 pages for 'javascript'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 634/949 | < Previous Page | 630 631 632 633 634 635 636 637 638 639 640 641  | Next Page >

  • Is there a way to embed an mp3 player in a website that isn't flash based (so that the website is iP

    - by hartleybrody
    I did a lot of searching for what I thought would be a pretty common question, but I came up with nothing. If there is another thread with a similar topic, please let me know. Basically, I'm looking for a way to have an .mp3 file play in a website without relying on a flash-based player. I've searched w3 schools and every forum I can think of, but every media player I've found so far has been some sort of proprietary flash player. Doesn't HTML support some sort of native player? I've found some that rely on Windows Media Player which is close, but I want the player to work on an iPhone and something tells me WMP won't get that done... PS, as I'm thinking more about this this idea just popped into my head: a javascipt player and inside the <noscript> tag, put a flash player? I'm running a music blog (@ http://www.freshoncampus.com) so the less code per post, the better...

    Read the article

  • How do I cache jQuery selections?

    - by David
    I need to cache about 100 different selections for animating. The following is sample code. Is there a syntax problem in the second sample? If this isn't the way to cache selections, it's certainly the most popular on the interwebs. So, what am I missing? note: p in the $.path.bezier(p) below is a correctly declared object passed to jQuery.path.bezier (awesome animation library, by the way) This works $(document).ready(function() { animate1(); animate2(); }) function animate1() { $('#image1').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $('#image2').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); } This doesn't work var $one = $('#image1'); //problem with syntax here?? var $two = $('#image2'); $(document).ready(function() { animate1(); animate2(); }) function animate1() { $one.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $two.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); }

    Read the article

  • database search function on an HTML page possible?

    - by synergy989
    Not sure if this is against stackoverflow rules as it's not a specific code question but I really need a little help. I want to know if it is possible to create a search feature (search box) on an HTML webpage that will query a database and return the results? Basically I have a database of products and their related categories. A user would come to the website, enter the category in the search field...somehow query the database and return the results on a new page. Note: the results page doesn't have to be HTML (could be PHP etc). If you could also include a little guidance on how (please nothing detailed, just need a direction). Thank you!

    Read the article

  • I want to style within JS

    - by 422
    Issue I have is I can use tags, but I would like to style particular words. Adding a class doesnt work, is it because I am within script dom ? Example: var config = [ { "name" : "tour_1", "bgcolor" : "black", "color" : "white", "position" : "BR", "text" : "Customize your user profile, it's easy. This is your shop window on <strong>here</strong> and <strong>there</strong>", "time" : 4000 } Instead of strong, I would like to apply class, like <p class="orange"> But it wont have it, any suggestions... please

    Read the article

  • Creating a json obj from a string when working without a net connection?

    - by user246114
    Hi, I have a json object returned from a third party api, it looks like: {"version":"1.0","encoding":"UTF-8"} I'm going to be working on my project without a network connection, so I have to do everything locally. How can I create an instance of a json object locally for testing? Say I copy the above string, can I do something like: var json = null; if (debugging_locally) { json = new jsonObj('{"version":"1.0","encoding":"UTF-8"}'); } else { json = doAjaxCall(); } doStuffWithJsonObj(json); so I just want to create a json object from a stored string if debugging locally - how can I do that? Thanks

    Read the article

  • Loading external content with jquery or iframe?

    - by nailuenlue
    Hiho, There's an existing website that i need to include into another site which goes like this: a.mysite.com and i need to fetch content from this site in my www.mysite.com website... As i need to access the content of the iframe the Same origin policy produces a problem here. What i did was to configure mod_proxy on Apache to proxy pass all requests from www.mysite.com/a to a.mysite.com This will work fine...but my problem is that im not sure what the best way would be to include those pages. 1. Idea As the content of the iframe is a full featured site with a top navigation...left navigation etc....i would need to change the page template to only show the content box to be able to integrate that page in the iframe. 2. Idea I could just load the DIV where the content lies through JQuery.load() and integrate it into my site. What is the best way to accomplish such a task? How bad is both ideas from the SEO point of view?

    Read the article

  • Define and send a JSON object array

    - by Eric
    I'm looking for a way to define and send a JSON object array. I've figured out how to define a single JSON object, turn it into a string and send it, but what about an array of this type? Probably something simple I'm overlooking... var myColumnSetting = { "ColumnName": name, "ColumnIndex": index } convert it to a string var myJSONText = JSON.stringify(myColumnSetting, false);

    Read the article

  • jquery autocomplete get selected item text

    - by rlee923
    I am wondering how to grab the selected item's text value on jquery autocomplete. I have initialised jquery as following : $(document).ready(function (){ $("input#autocomplete").autocomplete({ source: postcodelist, select: function (event, ui) { AutoCompleteSelectHandler(event, ui) } }); }); And I have created a function function AutoCompleteSelectHandler(event, ui) { }. Inside this function I want to some extra handling to feed data into correct textboxes but I can't figure out how to grab the text value of the selected item. I did google a bit and tried examples but I can't seem to get it working. Any help will be much appreciated. Thanks a lot advance.

    Read the article

  • why does twitter use the !function syntax in their embed code

    - by samccone
    I was looking at twitters embed code and saw that they are using !function ... while i know that this evaluates to false I was wondering what the point of it was. thoughts? !function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0];if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src="//platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs");

    Read the article

  • Is there a way to catch an attempt to access a non existant property or method?

    - by Tor Valamo
    For instance this code: function stuff() { this.onlyMethod = function () { return something; } } // some error is thrown stuff().nonExistant(); Is there a way to do something like PHP's __call as a fallback from inside the object? function stuff() { this.onlyMethod = function () { return something; } this.__call__ = function (name, params) { alert(name + " can't be called."); } } // would then raise the alert "nonExistant can't be called". stuff().nonExistant();

    Read the article

  • Simplify my menu animation code

    - by zaius
    I've got a bunch of 'project' divs that I want to expand when they're clicked on. If there's already a project open, I want to hide it before I slide out the new one. I also want to stop clicks on an already open project from closing and then opening it again. Here's an example of what I mean (warning - wrote the code in the browser): $('.projects').click(function() { var clicked_project = $(this); if (clicked_project.is(':visible')) { clicked_project.height(10).slideUp(); return; } var visible_projects = $('.projects:visible'); if (visible_projects.size() > 0) { visible_projects.height(10).slideUp(function() { clicked_project.slideDown(); }); } else { clicked_project.slideDown(); } }); Really, my big issue is with the second part - it sucks that I have to use that if/else - I should just be able to make the callback run instantly if there aren't any visible_projects. I would think this would be a pretty common task, and I'm sure there's a simplification I'm missing. Any suggestions appreciated!

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Implementing prompts in text-input

    - by AntonAL
    Hi, I have a form with some text-inputs: login, password. If user sees this form the first time, input-texts should "contain" prompts, like "enter login", "enter password". If user clicks text-input, it's prompt should disappear to allow typing. I have seen various examples, that uses background image with prerendered text on it. Those images are appearing with following jQuery: $("form > :text").focus(function(){ // hide image }).blur(function(){ // show image, if text-input is still empty if ( $(this).val() == "" ) // show image with prompt }); This approach has following problems: localization is impossible need to pre-render images for various textual prompts overhead with loading images How do you overcomes such a problems ?

    Read the article

  • Finding all the URL requests from a firefox extension

    - by user303052
    I am building a firefox extension. In this extension, I want to see the URLs of any new webpage that the user visits. The webpage can be in a different tab or window than the current tab that the user is viewing (this should also catch the URL of pop-ups). Is there a way to find when firefox makes a GET or POST request and grab the URL? An alternative that I am trying to avoid is going through all the tabs and manually check to see if they have loaded a new page. Thanks

    Read the article

  • It is the arranging game in which

    - by bachchan
    1 2 3 13 5 4 7 10 6 14 11 9 8 15 12 1.Every time when we refresh the page the numbers in the cells will change but the These numbers will remain unique n from 1 to 15 2.Whenever we double click the number in the cell which is surrounded the empty cell then it will replace the empty cell with that number n that number cell become empty. 3.If we double click the cell which is not surrounded the empty cell then it will not replace the empty cell. 4.e.g. if we click 8 then it will not move to empty cell But if we click either 13, 7 , or 11 then it will move to empty cell 5.And every time when we click the cell it’s num color will change for a moment

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

  • How do I find what text/HTML is on screen in a UIWebview?

    - by Grant M
    I would like to know what the first piece of text/html that is currently showing on screen, or more generally where in pixel location a particular tag or piece of text is in the UIWebview. I know that I can use window.pageYOffset to get the scroll position of the UIwebview, but how do I find out what text or HTML item is there?

    Read the article

  • Can jquery capture the dynamic dom events and perform actions

    - by Zombie15
    I just wanted to know if something like this is possible. Jquery should fire some action on certian custom event. Like Whenever a new row is added to dom dynamically to table then i have certain action like change the background color to example red. That should work across the whole site. Somethings like Event listeners in Doctrine2 or Signals in Django EDIT: Basically i want some thing like where i can create custom event $.AddnewEvent(newRowAdded); Then i can customise that event with my own functions like $.newRowAdded(function(){ blah blah });

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • jQuery center multiple dynamic images in different sized containers

    - by JVK Design
    So I've found similar questions but none that answer all the questions I have and I know there must be a simple jQuery answer to this. I've got multiple images that are being dynamically placed in their own containing div that have overflow:hidden, they need to fill their containing divs and be centered(horizontally and vertically) also. The containing divs will be different sizes as well. So in short: multiple different sized images fill and center in containing div. containing divs will be different sizes. will be used multiple times on a page. Hopefully this image helps explain what I'm after. Click here to view the image. HTML I'm using but can be changed <div class="imageHolder"> <div class="first SlideImage"> <img src="..." alt="..."/> </div> <div class="second SlideImage"> <img src="..." alt="..."/> </div> <div class="third SlideImage"> <img src="..." alt="..."/> </div> </div> And the CSS .imageHandler{ float:left; width:764px; height:70px; margin:1px 0px 0px; } .imageHolder .SlideImage{ float:left; position:relative; overflow:hidden; } .imageHolder .SlideImage img{ position:absolute; } .imageHolder .first.SlideImage{ width:381px; height:339px; margin-right:1px; } .imageHolder .second.SlideImage{margin-bottom:1px;} .imageHolder .second.SlideImage, .imageHolder .third.SlideImage { width: 382px; height: 169px; } Ask me anything if this doesn't make sense, thanks in advance

    Read the article

  • jQuery bug when trying to insert partial elements before() / after() ?

    - by RedGlobe
    I'm trying to wrap a div around an element (my 'template' div) by using jQuery's before() and after(). When I try to insert a closing after the selected element, it actually gets placed before the target. Example: <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8" /> <title>Div Wrap</title> <script src="http://code.jquery.com/jquery-1.4.4.min.js"></script> <script> $('document').ready(function() { var beforestr = "<div id=\"wrap\"><div id=\"header\">Top</div><div id=\"page\">"; var afterstr = "</div><div id=\"footer\">Bottom</div></div>"; $('#template').before(beforestr); $('#template').after(afterstr); }); </script> </head> <body> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. <script>document.write('This script should still work and might contain variables. Please don\'t recommend concatenation.');</script> Donec non enim in turpis pulvinar facilisis.</p> </div> </body> </html> The result is: <div id="wrap"> <div id="header">Top</div> <div id="page"> </div> </div> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. This script should still work and might contain variables. Please don't recommend concatenation. Donec non enim in turpis pulvinar facilisis.</p> </div> <div id="footer">Bottom</div> Why are my closing wrap and page divs getting placed before the target, when I'm trying to place them after() ? Is there an alternative way to accomplish this (keeping in mind I may need to call script functions within the template div)? As I'm sure you're aware, best practices aren't what I'm going for here.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 630 631 632 633 634 635 636 637 638 639 640 641  | Next Page >