Search Results

Search found 55281 results on 2212 pages for 'get set'.

Page 635/2212 | < Previous Page | 631 632 633 634 635 636 637 638 639 640 641 642  | Next Page >

• User control event or method override where custom properties are valid?

  - by Curtis White

  I have an ASP.NET user control that is used in another use control. The parent user control uses data-binding to bind to a custom property of the child user control. What method can I override or page event where I am ensured that the property state is set? I think in a page it is PageLoaded versus the Page_Load override? I am looking for this in the user control because my property is always null even though it is set. Thanks.

  Read the article

• Looping in filemaker using a local variable

  - by Mike Davis

  Been programming in C# for a little bit - trying to use file maker and I cant believe it but I cant even get a simple for loop to work. What I want to do is simple: loop through for the amount of entries in my "amountOfRooms" field and create an entry in a table for each room. Sounds so simple, but I cant get it to work. Right now I have this: Set Variable[$cnt[Customers::AmountOfRooms]; value:1] Go to Layout["rooms"(Rooms)] Loop Exit Loop If[$cnt = Customers::AmountOfRooms] New Record / Request Set Variable[$cnt; Value: $cnt + 1] End Loop Exit Script No new records are created. I know the script is running because it does go to my layout, but doesnt create any new records. There is a "Repetition" field for my local variable - not sure how to use that or what it means? Any thoughts on how to do this simple loop? Thanks.

  Read the article

• GWT - Retrieve size of a widget that is not displayed

  - by Garagos

  I need to set the size of an absolutePanel regarding to its child size, but the getOffset* methods return 0 because (i think) the child as not been displayed yet. A Quick example: AbsolutePanel aPanel = new AbsolutePanel(); HTML text = new HTML(/*variable lenght text*/); int xPosition = 20; // actually variable aPanel.add(text, xPosition, 0); aPanel.setSize(xPosition + text .getOffsetWidth() + "px", "50px"); // 20px 50px I could also solve my problem by using the AbsolutePanel size to set the child position and size: AbsolutePanel aPanel = new AbsolutePanel(); aPanel.setSize("100%", "50px"); HTML text = new HTML(/*variable lenght text*/); int xPosition = aPanel.getOffsetWidth() / 3; // Once again, getOffsetWidth() returns 0; aPanel.add(text, xPosition, 0); In both case, i have to find a way to either: retrieve the size of a widget that has not been displayed be notified when a widget is displayed

  Read the article

• How can I create an enum using numbers?

  - by Jordan S

  Is it possible to make an enum using just numbers in C#? In my program I have a variable, Gain, that can only be set to 1, 2, 4, and 8. I am using a propertygrid control to display and set this value. If I were to create an enum like this... private enum GainValues {One, Two, Four, Eight} and I made my gain variable of type GainValues then the drop-down list in the propertygrid would only show the available values for the gain variable. The problem is I want the gain values to read numerically an not as words. But I can not create an enum like this: private enum GainValues {1,2,4,8} So is there another way of doing this? Perhaps creating a custom type?

  Read the article

• Can't modify XNA Vector components

  - by Matt H

  I have a class called Sprite, and ballSprite is an instance of that class. Sprite has a Vector2 property called Position. I'm trying to increment the Vector's X component like so: ballSprite.Position.X++; but it causes this error: Cannot modify the return value of 'WindowsGame1.Sprite.Position' because it is not a variable Is it not possible to set components like this? The tooltip for the X and Y fields says "Get or set ..." so I can't see why this isn't working.

  Read the article

• variables in batch scripts

  - by richzilla

  I'm trying to set up a batch file to automatically deploy a php app to a web server. Basically, what I want is an entirely automated process: I would just give it a revision number from the repository and it would then export the files, upload via ftp and then update deployment info at the repo host (codebase). However, I'm starting from scratch here. How would I set up a batch file to accept a variable when it was run? For example, the command myfile.bat /revision 42 should deploy revision 42 to my server. If anyone can point me in the right direction I'd appreciate it.

  Read the article

• How to bind WPF TreeView to a List<Drink> programmatically?

  - by Joan Venge

  So I am very new to WPF and trying to bind or assign a list of Drink values to a wpf treeview, but don't know how to do that, and find it really hard to find anything online that just shows stuff without using xaml. struct Drink { public string Name { get; private set; } public int Popularity { get; private set; } public Drink ( string name, int popularity ) : this ( ) { this.Name = name; this.Popularity = popularity; } } List<Drink> coldDrinks = new List<Drink> ( ){ new Drink ( "Water", 1 ), new Drink ( "Fanta", 2 ), new Drink ( "Sprite", 3 ), new Drink ( "Coke", 4 ), new Drink ( "Milk", 5 ) }; } } How can I do this in code? For example: treeview1.DataItems = coldDrinks; and everything shows up in the treeview.

  Read the article

• jQuery/JavaScript: Trigger when preloaded

  - by user317563

  Hello there, jQuery has the .ready() function, but I am unsure whether this is what I need: I set a default background image in CSS (imange 1 out of 4), once document is loaded (images and all, not only DOM); I want to start preloading background image 2 out of 4. Once that is loaded, I want to fade image 1 into image 2. Then I want to preload the next image (3 out of 4), once that is loaded, I want to fade from background image 2 into image 3, and finally preload image 4. Once image 4 is loaded, i would like to fade image 3 into image 4. After that, I want to cycle between the images with a set time interval. What strategy would I use to solve this? .load() function? Thank you for your time. Kind regards,Marius

  Read the article

• Cross domain secure cookie usage?

  - by asdasda

  I have a website that came with a SSL site for HTTPS but its on a different server. Example being my website: http://example.com my SSL site: http://myhostingcompany.com/~myuseraccount/ So I can do transactions over HTTPS and we have user accounts and everything but it is located on a different domain. The cookie domain is set for that one. Is there a way I can check on my actual site to see if a cookie is set for the other one? And possibly grab its data and auth a user? I think this violates a major principle of security and can't be done for good reasons, but am i wrong? is this possible?

  Read the article

• Any Problems Using Samba as a Windows Domain Controller?

  - by maxam

  We're looking to run a Windows domain using Samba+OpenLDAP on Ubuntu as a domain controller. The documentation out there is a bit spotty and out of date, especially when it comes to installation, which features are supported, and how well. Once this is set up, we hope to be able to use integrated authentication of our IIS sites (including Sharepoint) against the domain controller. Anyone out there who has done this already? Anything specific we should watch out for? Or is it not worth the hassle of trying to set up?

  Read the article

• MVC Display Template for Generic Type

  - by Kyle

  I am trying to use the model ListModel as a generic list model. I would like to enter on the page @Html.DisplayForModel() However the MVC is not correctly finding the templated file "ListModel.cshtml". It must work differently for generic models. What should I name the templated file in order for it to correctly be located? public class ListModel<T> { public IEnumerable<T> Models {get;set;} public string NextPage {get;set;} } I would expect it to look for "Shared/DisplayTemplates/ListModel.ascx" but it doesn't. Does anyone know?

  Read the article

• Is it possible to specify the name of the Index property to use for lists in a fluent nhibernate con

  - by Teevus

  When mapping a HasMany or HasManyToMany in fluent nhibernate, you can specify the column name to use for the list as a parameter to the AsList() method as follows: HasMany(c => c.Customers) .AsList(c => c.Column("PositionIndex")); I would prefer to be able to set this using a Fluent NHibernate convention (either a pre-existing one, or a custom one), especially since the default name appears to be "Index" which is a reserved word in MSSQL. I've tried using a custom convention implementing IHasManyConvention, but the instance parameter does not seem to contain the information about whether its a list, a bag, or a set, and also does not contain the column details for the index column. public void Apply(IOneToManyCollectionInstance instance) { } Any ideas?

  Read the article

• How do I print array values in a range when values are supplied?

  - by dcp3450

  My php reads in xml and I want to ouput the values within a given range. I have no way of knowing the size of the array or the range. However, I do know where to start; I have a $key that holds my current location. I also know where to stop; I have the word "ENDEVENTS" between each set. I want to get the values from my current position ($key) to my end position ("ENDEVENTS"). for example i may have an array set like this: Array( [0]=1 [1]=apple [2]=straw [3]=bike [4]=ENDEVENTS [5]=15 [6]=hair [7]=shirt [8]=nose [9]=kiwi [10]=ENDEVENTS ) My code knows when I'm on 15 (in this example $key=5). I want to print 6 through 9. I tried using foreach but it's thats causing issues with what I'm trying to produce. Any ideas?

  Read the article

• R looking for the wrong java version

  - by Veit

  Hi, I installed/uninstalled java jre/jdk now many times and finally installed the older version 1.6.0_17 which is now located at "C:\Program Files\Java\jre6\bin". Now after all if I call 'java -version' within R i can see that R is looking for Java at the old path which is now wrong. The question is: Why is R looking for Java at the wrong path even so the windows path is set correctly? There are no double entrys within the windows path as far as I can see and I restarted R as well as Windows more then once since then. Any Ideas where R takes the wrong path from? On windows shell: $set [..] OS=Windows_NT Path=C:\Program Files\Java\jre6\bin; [..] $ java -version java version "1.6.0_17" Java(TM) SE Runtime Environment (build 1.6.0_17-b04) Java HotSpot(TM) 64-Bit Server VM (build 14.3-b01, mixed mode) within R: $system("java -version") Error: could not open `C:\Program Files (x86)\Java\jre6\lib\i386\jvm.cfg'

  Read the article

• SQL SELECT INSERTed data from Table

  - by Noam Smadja

  its in ASP Classic. MS-Access DB. i do: INSERT INTO Orders (userId) VALUES (123)" what i want to retrieve is orderNumber from that row. its an auto-increment number. so i did: SELECT orderNumber FROM Orders WHERE userId=123 but since it is on the same page, the SELECT returns: Either BOF or EOF is True, or the current record has been deleted. Requested operation requires a current record. i've seen somewhere RETURNING orderNumber as variable but it was for oracle and i dont know how to implement it into my asp :( set addOrder = Server.CreateObject("ADODB.Command") addOrder.ActiveConnection = MM_KerenDB_STRING addOrder.CommandText = "INSERT INTO Orders (userId) VALUES ("&userId&")" addOrder.CommandType = 1 addOrder.CommandTimeout = 0 addOrder.Prepared = true addOrder.Execute() Dim getOrderNumber Set getOrderNumber = Server.CreateObject("ADODB.Recordset") getOrderNumber.ActiveConnection = MM_KerenDB_STRING getOrderNumber.Source = "SELECT orderNumber FROM Orders WHERE userId=" & userId getOrderNumber.CursorType = 0 getOrderNumber.CursorLocation = 2 getOrderNumber.LockType = 1 getOrderNumber.Open() session("orderNumber") = getOrderNumber.Fields.Item("orderNumber").value

  Read the article

• ListView GridView and Grid

  - by urema

  Hi, If you have a ListView with its view set as a GridView, which itself contains columns for each month say.....how do I set a template up for the ItemTemplate of the ListView so that each Item will be three rows high, and be inline with the ListView.View's columns? For example different employee recruits over a year.... each month across the top and each employee on the left side, though sub-columned on the employee are three rows "Name", "Address" and "Job Type" say. I know you have to use the IsSharedSizeScope attached property. January February ... Employee1 Name E1 Address E1 Street Job Type Cleaner Employee2 Name ... Address ... Job Type ... Thanks greatly in advance, U.

  Read the article

• change selects value onchange of another select

  - by Syom

  i start learning jquery few days ago, and i like it very much. but now i have a problem, that can't solve alone. i have two selects <select id="select1"> <option value="1">1day</option> <option value="2">2day</option> <option value="3">3day</option> </select> <select id="select2"> <option value="1">1day</option> <option value="2">2day</option> <option value="3">3day</option> </select> i need to set #select2 the same value with #select1, when #select1 changes i've red some questions about select tag here, but i need to set "selected" attribute to that option, which have the same value. how can i do it? Thanks

  Read the article

• Updating counters through Hibernate

  - by at

  This is an extremely common situation, so I'm expecting a good solution. Basically we need to update counters in our tables. As an example a web page visit: Web_Page -------- Id Url Visit_Count So in hibernate, we might have this code: webPage.setVisitCount(webPage.getVisitCount()+1); The problem there is reads in mysql by default don't pay attention to transactions. So a highly trafficked webpage will have inaccurate counts. The way I'm used to doing this type of thing is simply call: update Web_Page set Visit_Count=Visit_Count+1 where Id=12345; I guess my question is, how do I do that in Hibernate? And secondly, how can I do an update like this in Hibernate which is a bit more complex? update Web_Page wp set wp.Visit_Count=(select stats.Visits from Statistics stats where stats.Web_Page_Id=wp.Id) + 1 where Id=12345;

  Read the article

• Qt: Is it possible to tell a widget to take all the place that it has in layout, but not more?

  - by Lukasz Lew

  I have a following Qt code: QVBoxLayout* box = new QVBoxLayout; label = new QLabel(); // will be set later dynamically box->addWidget (label); Text in label will be set later. The problem is that when label resizes, it resizes QVBoxLayout, and it resizes other neighboring widgets. I don't want to make a label or layout fixed width. Because I want them to resize with a whole window. Is it possible to tell label to take all the place that it has in layout, but not more?

  Read the article

• find users that are following other users

  - by Jakob

  Hi I'm wondering how I can go about this problem I have a DB with a Users Table, and a Followers table. The Followers table contains 2 Columns "FollowerID" and "FollowedID" I have a 1 - * relation in my datamodel between Users.ID -> Followers.FollowerID and Users.ID -> FollowedID How do I in LINQ get a set of users that are following a specific user? I'll express what I'm trying to achieve programatically I can get this far: ctx.Followers.Where(f => f.FollowedID == CurrentUser.ID) so now i have a Followers set where I have the ID of the users that follow the CurrentUser, and I could iterate through this collection and then add users after each iteration to a collection that would be a total USER collection that followed CurrentUser, but isn't there a smarter, or LINQ'er way to do this? Much appreciated Thx

  Read the article

• finding the numbers in a given range?

  - by Jamis

  Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

  Read the article

• iPhone SDK: Downloading large files from a server into the app's documents.

  - by Jessica

  Hi, I am building an app that plays multiple video files, But I would like to know How do you download a video file (100mb - 300mb) from a server into the application's documents so it can later be locally referred to in code? The reason I want this type of a set up in my app is that I don't want the app binary to be made unnecessarily large due to including videos some users may not want. Also does this violate any of apple's terms? Also would it be simple to implement a progress view with this kind of set up and if so how? Any help is appreciated.

  Read the article

• How to null a translation in in gettext system?

  - by Evgeny

  Suppose a simple phrase "In" in English needs to be interpreted as "" - empty string in Russian. Is is possible to specify that in the .po file? What normally happens if you set msgstr "" - you'll get the untranslated key, but I want to get nothing in that specific case. Here is a use case: I have underneath a search bar a set of buttons to select questions (for a Q&A site) from particular scopes - like so: (in English) In: [all] [unanswered] [my own] (in Russian I want) [???] [??? ???????] [???] It just sounds more natural. Yes I can leave out In for english, but I don't want to and I do not want to put button (things in [] are buttongs) html into the 'po' file. Thanks!

  Read the article

• html - how do I make a page load in a new tab in IE8?

  - by erynion

  My website works in Firefox - pages on the site load in the current tab, and links off site load a new tab. IE8 won't behave: target="_blank" opens a whole new window; the other options, _self _top _parent, all open the page in the current tab. I have Firefox set to "Open new windows in a new tab." The links to pages on my site all have target="_self" and Firefox keeps these in the current tab. On the external links I don't have a target set (I added _blank to see if it fixed IE8, and doing that didn't affect Firefox). I can't find an equivalent setting in IE8. Tools-Internet Options-General-Tabs/Settings has an enable tabs box, and a sub-option to automatically switch to newly opened tabs. Is there some html that will work? An IE8 setting I'm missing? Any help appreciated.

  Read the article

• Fluent Nhibernate mapping related items

  - by Josh

  I am trying to relate 2 items. I have a table that is simply an Id field, and then 2 columns for the Item Id's to relate. I want it to be a 2 way relationship - that is, if the items appear twice in the table, I only want one relationship connection back. So, here's my item: public class Item { public virtual Guid ItemId {get; set;} public virtual string Name {get; set;} public virtual IList<Item> RelatedItems {get; set;} } The table for relating the items looks like this: CREATE TABLE RelatedItems ( RelatedItemId uniqueidentifier NOT NULL, ItemId uniqueidentifier NOT NULL, RelatedId uniqueidentifier NOT NULL, CONSTRAINT PK_RelatedItems PRIMARY KEY CLUSTERED (RelatedItemId) ) What is the best way to map this connection?

  Read the article

< Previous Page | 631 632 633 634 635 636 637 638 639 640 641 642  | Next Page >