Search Results

Search found 25518 results on 1021 pages for 'iterative development'.

Page 636/1021 | < Previous Page | 632 633 634 635 636 637 638 639 640 641 642 643  | Next Page >

  • Building static (but complicated) lookup table using templates.

    - by MarkD
    I am currently in the process of optimizing a numerical analysis code. Within the code, there is a 200x150 element lookup table (currently a static std::vector < std::vector < double ) that is constructed at the beginning of every run. The construction of the lookup table is actually quite complex- the values in the lookup table are constructed using an iterative secant method on a complicated set of equations. Currently, for a simulation, the construction of the lookup table is 20% of the run time (run times are on the order of 25 second, lookup table construction takes 5 seconds). While 5-seconds might not seem to be a lot, when running our MC simulations, where we are running 50k+ simulations, it suddenly becomes a big chunk of time. Along with some other ideas, one thing that has been floated- can we construct this lookup table using templates at compile time? The table itself never changes. Hard-coding a large array isn't a maintainable solution (the equations that go into generating the table are constantly being tweaked), but it seems that if the table can be generated at compile time, it would give us the best of both worlds (easily maintainable, no overhead during runtime). So, I propose the following (much simplified) scenario. Lets say you wanted to generate a static array (use whatever container suits you best- 2D c array, vector of vectors, etc..) at compile time. You have a function defined- double f(int row, int col); where the return value is the entry in the table, row is the lookup table row, and col is the lookup table column. Is it possible to generate this static array at compile time using templates, and how?

    Read the article

  • Algorithm to pick values from set to match target value?

    - by CSharperWithJava
    I have a fixed array of constant integer values about 300 items long (Set A). The goal of the algorithm is to pick two numbers (X and Y) from this array that fit several criteria based on input R. Formal requirement: Pick values X and Y from set A such that the expression X*Y/(X+Y) is as close as possible to R. That's all there is to it. I need a simple algorithm that will do that. Additional info: The Set A can be ordered or stored in any way, it will be hard coded eventually. Also, with a little bit of math, it can be shown that the best Y for a given X is the closest value in Set A to the expression X*R/(X-R). Also, X and Y will always be greater than R From this, I get a simple iterative algorithm that works ok: int minX = 100000000; int minY = 100000000; foreach X in A if(X<=R) continue; else Y=X*R/(X-R) Y=FindNearestIn(A, Y);//do search to find closest useable Y value in A if( X*Y/(X+Y) < minX*minY/(minX+minY) ) then minX = X; minY = Y; end end end I'm looking for a slightly more elegant approach than this brute force method. Suggestions?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Matlab GUI: How to Save the Results of Functions (states of application)

    - by niko
    Hi, I would like to create an animation which enables the user to go backward and forward through the steps of simulation. An animation has to simulate the iterative process of channel decoding (a receiver receives a block of bits, performs an operation and then checks if the block corresponds to parity rules. If the block doesn't correspond the operation is performed again and the process finally ends when the code corresponds to a given rules). I have written the functions which perform the decoding process and return a m x n x i matrix where m x n is the block of data and i is the iteration index. So if it takes 3 iterations to decode the data the function returns a m x n x 3 matrix with each step is stired. In the GUI (.fig file) I put a "decode" button which runs the method for decoding and there are buttons "back" and "forward" which have to enable the user to switch between the data of recorded steps. I have stored the "decodedData" matrix and currentStep value as a global variable so by clicking "forward" and "next" buttons the indices have to change and point to appropriate step states. When I tried to debug the application the method returned the decoded data but when I tried to click "back" and "next" the decoded data appeared not to be declared. Does anyone know how is it possible to access (or store) the results of the functions in order to enable the described logic which I want to implement in Matlab GUI?

    Read the article

  • Stuck in implementing Pagination in Android

    - by user443141
    I am implementing pagination for ListView in Android . I am extending the BaseAdapater class for customising the ListView. Already I have the code working fine for the Customised ListView. Below is the new requirement. 1I am fetching 6 items from server & displaying them . Now when the user scrolls to the 6th item(end of list) , I need to call the server to fetch the next 6 items & update the Listview I have overriden the methods ipublic void onScroll(AbsListView view, int firstVisibleItem,int visibleItemCount, int totalItemCount) iipublic void onScrollStateChanged(AbsListView view, int scrollState) In the first response from the server, I get the total no of pages from the server & for each time I call the server , I get the current page value . Kindly provide me the steps/sample code on how to check the last item of the list & update the list . The code should be iterative since I may need to call multiple times & fetch from server. Warm Regards, CB

    Read the article

  • Tree iterator, can you optimize this any further?

    - by Ron
    As a follow up to my original question about a small piece of this code I decided to ask a follow up to see if you can do better then what we came up with so far. The code below iterates over a binary tree (left/right = child/next ). I do believe there is room for one less conditional in here (the down boolean). The fastest answer wins! The cnt statement can be multiple statements so lets make sure this appears only once The child() and next() member functions are about 30x as slow as the hasChild() and hasNext() operations. Keep it iterative <-- dropped this requirement as the recursive solution presented was faster. This is C++ code visit order of the nodes must stay as they are in the example below. ( hit parents first then the children then the 'next' nodes). BaseNodePtr is a boost::shared_ptr as thus assignments are slow, avoid any temporary BaseNodePtr variables. Currently this code takes 5897ms to visit 62200000 nodes in a test tree, calling this function 200,000 times. void processTree (BaseNodePtr current, unsigned int & cnt ) { bool down = true; while ( true ) { if ( down ) { while (true) { cnt++; // this can/will be multiple statesments if (!current->hasChild()) break; current = current->child(); } } if ( current->hasNext() ) { down = true; current = current->next(); } else { down = false; current = current->parent(); if (!current) return; // done. } } }

    Read the article

  • How to iteratively generate k elements subsets from a set of size n in java?

    - by Bea Metitiri
    Hi, I'm working on a puzzle that involves analyzing all size k subsets and figuring out which one is optimal. I wrote a solution that works when the number of subsets is small, but it runs out of memory for larger problems. Now I'm trying to translate an iterative function written in python to java so that I can analyze each subset as it's created and get only the value that represents how optimized it is and not the entire set so that I won't run out of memory. Here is what I have so far and it doesn't seem to finish even for very small problems: public static LinkedList<LinkedList<Integer>> getSets(int k, LinkedList<Integer> set) { int N = set.size(); int maxsets = nCr(N, k); LinkedList<LinkedList<Integer>> toRet = new LinkedList<LinkedList<Integer>>(); int remains, thresh; LinkedList<Integer> newset; for (int i=0; i<maxsets; i++) { remains = k; newset = new LinkedList<Integer>(); for (int val=1; val<=N; val++) { if (remains==0) break; thresh = nCr(N-val, remains-1); if (i < thresh) { newset.add(set.get(val-1)); remains --; } else { i -= thresh; } } toRet.add(newset); } return toRet; } Can anybody help me debug this function or suggest another algorithm for iteratively generating size k subsets? EDIT: I finally got this function working, I had to create a new variable that was the same as i to do the i and thresh comparison because python handles for loop indexes differently.

    Read the article

  • dotNet Templated, Repeating, Databound ServerControl: Counting the templates OnDataBind?

    - by Campbeln
    I have a server control that wraps an underlying class which manages a number of indexes to track where it is in a dataset (ie: RenderedRecordCount, ErroredRecordCount, NewRecordCount, etc.). I've got the server control rendering great, but OnDataBinding I'm having an issue as to seems to happen after CreateChildControls and before Render (both of which properly manage the iteration of the underlying indexes). While I'm somewhat familiar with the ASP.NET page lifecycle, this one seems to be beyond me at the moment. So... how do I hook into the iterative process OnDataBinding uses so I can manage the underlying indexes? Will I have to iterate over the ITemplates myself, managing the indexes as I go or is there an easier solution? Also... I implemented the iteration of the underlying indexes during CreateChildControls originally in the belief that was the proper place to hook in for events like OnDataBinding (thining it was done as the controls were being .Add'd). Now it seems that this may actually be unnecessary. So I guess the secondary question is: What happens during CreateChildControls? Are the unadulterated (read: with <%-tags in place) controls added to the .Controls collection without any other processing?

    Read the article

  • Rendering ASP.NET Script References into the Html Header

    - by Rick Strahl
    One thing that I’ve come to appreciate in control development in ASP.NET that use JavaScript is the ability to have more control over script and script include placement than ASP.NET provides natively. Specifically in ASP.NET you can use either the ClientScriptManager or ScriptManager to embed scripts and script references into pages via code. This works reasonably well, but the script references that get generated are generated into the HTML body and there’s very little operational control for placement of scripts. If you have multiple controls or several of the same control that need to place the same scripts onto the page it’s not difficult to end up with scripts that render in the wrong order and stop working correctly. This is especially critical if you load script libraries with dependencies either via resources or even if you are rendering referenced to CDN resources. Natively ASP.NET provides a host of methods that help embedding scripts into the page via either Page.ClientScript or the ASP.NET ScriptManager control (both with slightly different syntax): RegisterClientScriptBlock Renders a script block at the top of the HTML body and should be used for embedding callable functions/classes. RegisterStartupScript Renders a script block just prior to the </form> tag and should be used to for embedding code that should execute when the page is first loaded. Not recommended – use jQuery.ready() or equivalent load time routines. RegisterClientScriptInclude Embeds a reference to a script from a url into the page. RegisterClientScriptResource Embeds a reference to a Script from a resource file generating a long resource file string All 4 of these methods render their <script> tags into the HTML body. The script blocks give you a little bit of control by having a ‘top’ and ‘bottom’ of the document location which gives you some flexibility over script placement and precedence. Script includes and resource url unfortunately do not even get that much control – references are simply rendered into the page in the order of declaration. The ASP.NET ScriptManager control facilitates this task a little bit with the abililty to specify scripts in code and the ability to programmatically check what scripts have already been registered, but it doesn’t provide any more control over the script rendering process itself. Further the ScriptManager is a bear to deal with generically because generic code has to always check and see if it is actually present. Some time ago I posted a ClientScriptProxy class that helps with managing the latter process of sending script references either to ClientScript or ScriptManager if it’s available. Since I last posted about this there have been a number of improvements in this API, one of which is the ability to control placement of scripts and script includes in the page which I think is rather important and a missing feature in the ASP.NET native functionality. Handling ScriptRenderModes One of the big enhancements that I’ve come to rely on is the ability of the various script rendering functions described above to support rendering in multiple locations: /// <summary> /// Determines how scripts are included into the page /// </summary> public enum ScriptRenderModes { /// <summary> /// Inherits the setting from the control or from the ClientScript.DefaultScriptRenderMode /// </summary> Inherit, /// Renders the script include at the location of the control /// </summary> Inline, /// <summary> /// Renders the script include into the bottom of the header of the page /// </summary> Header, /// <summary> /// Renders the script include into the top of the header of the page /// </summary> HeaderTop, /// <summary> /// Uses ClientScript or ScriptManager to embed the script include to /// provide standard ASP.NET style rendering in the HTML body. /// </summary> Script, /// <summary> /// Renders script at the bottom of the page before the last Page.Controls /// literal control. Note this may result in unexpected behavior /// if /body and /html are not the last thing in the markup page. /// </summary> BottomOfPage } This enum is then applied to the various Register functions to allow more control over where scripts actually show up. Why is this useful? For me I often render scripts out of control resources and these scripts often include things like a JavaScript Library (jquery) and a few plug-ins. The order in which these can be loaded is critical so that jQuery.js always loads before any plug-in for example. Typically I end up with a general script layout like this: Core Libraries- HeaderTop Plug-ins: Header ScriptBlocks: Header or Script depending on other dependencies There’s also an option to render scripts and CSS at the very bottom of the page before the last Page control on the page which can be useful for speeding up page load when lots of scripts are loaded. The API syntax of the ClientScriptProxy methods is closely compatible with ScriptManager’s using static methods and control references to gain access to the page and embedding scripts. For example, to render some script into the current page in the header: // Create script block in header ClientScriptProxy.Current.RegisterClientScriptBlock(this, typeof(ControlResources), "hello_function", "function helloWorld() { alert('hello'); }", true, ScriptRenderModes.Header); // Same again - shouldn't be rendered because it's the same id ClientScriptProxy.Current.RegisterClientScriptBlock(this, typeof(ControlResources), "hello_function", "function helloWorld() { alert('hello'); }", true, ScriptRenderModes.Header); // Create a second script block in header ClientScriptProxy.Current.RegisterClientScriptBlock(this, typeof(ControlResources), "hello_function2", "function helloWorld2() { alert('hello2'); }", true, ScriptRenderModes.Header); // This just calls ClientScript and renders into bottom of document ClientScriptProxy.Current.RegisterStartupScript(this,typeof(ControlResources), "call_hello", "helloWorld();helloWorld2();", true); which generates: <html xmlns="http://www.w3.org/1999/xhtml" > <head><title> </title> <script type="text/javascript"> function helloWorld() { alert('hello'); } </script> <script type="text/javascript"> function helloWorld2() { alert('hello2'); } </script> </head> <body> … <script type="text/javascript"> //<![CDATA[ helloWorld();helloWorld2();//]]> </script> </form> </body> </html> Note that the scripts are generated into the header rather than the body except for the last script block which is the call to RegisterStartupScript. In general I wouldn’t recommend using RegisterStartupScript – ever. It’s a much better practice to use a script base load event to handle ‘startup’ code that should fire when the page first loads. So instead of the code above I’d actually recommend doing: ClientScriptProxy.Current.RegisterClientScriptBlock(this, typeof(ControlResources), "call_hello", "$().ready( function() { alert('hello2'); });", true, ScriptRenderModes.Header); assuming you’re using jQuery on the page. For script includes from a Url the following demonstrates how to embed scripts into the header. This example injects a jQuery and jQuery.UI script reference from the Google CDN then checks each with a script block to ensure that it has loaded and if not loads it from a server local location: // load jquery from CDN ClientScriptProxy.Current.RegisterClientScriptInclude(this, typeof(ControlResources), "http://ajax.googleapis.com/ajax/libs/jquery/1.3.2/jquery.min.js", ScriptRenderModes.HeaderTop); // check if jquery loaded - if it didn't we're not online string scriptCheck = @"if (typeof jQuery != 'object') document.write(unescape(""%3Cscript src='{0}' type='text/javascript'%3E%3C/script%3E""));"; string jQueryUrl = ClientScriptProxy.Current.GetWebResourceUrl(this, typeof(ControlResources), ControlResources.JQUERY_SCRIPT_RESOURCE); ClientScriptProxy.Current.RegisterClientScriptBlock(this, typeof(ControlResources), "jquery_register", string.Format(scriptCheck,jQueryUrl),true, ScriptRenderModes.HeaderTop); // Load jquery-ui from cdn ClientScriptProxy.Current.RegisterClientScriptInclude(this, typeof(ControlResources), "http://ajax.googleapis.com/ajax/libs/jqueryui/1.7.2/jquery-ui.min.js", ScriptRenderModes.Header); // check if we need to load from local string jQueryUiUrl = ResolveUrl("~/scripts/jquery-ui-custom.min.js"); ClientScriptProxy.Current.RegisterClientScriptBlock(this, typeof(ControlResources), "jqueryui_register", string.Format(scriptCheck, jQueryUiUrl), true, ScriptRenderModes.Header); // Create script block in header ClientScriptProxy.Current.RegisterClientScriptBlock(this, typeof(ControlResources), "hello_function", "$().ready( function() { alert('hello'); });", true, ScriptRenderModes.Header); which in turn generates this HTML: <html xmlns="http://www.w3.org/1999/xhtml" > <head> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.3.2/jquery.min.js" type="text/javascript"></script> <script type="text/javascript"> if (typeof jQuery != 'object') document.write(unescape("%3Cscript src='/WestWindWebToolkitWeb/WebResource.axd?d=DIykvYhJ_oXCr-TA_dr35i4AayJoV1mgnQAQGPaZsoPM2LCdvoD3cIsRRitHKlKJfV5K_jQvylK7tsqO3lQIFw2&t=633979863959332352' type='text/javascript'%3E%3C/script%3E")); </script> <title> </title> <script src="http://ajax.googleapis.com/ajax/libs/jqueryui/1.7.2/jquery-ui.min.js" type="text/javascript"></script> <script type="text/javascript"> if (typeof jQuery != 'object') document.write(unescape("%3Cscript src='/WestWindWebToolkitWeb/scripts/jquery-ui-custom.min.js' type='text/javascript'%3E%3C/script%3E")); </script> <script type="text/javascript"> $().ready(function() { alert('hello'); }); </script> </head> <body> …</body> </html> As you can see there’s a bit more control in this process as you can inject both script includes and script blocks into the document at the top or bottom of the header, plus if necessary at the usual body locations. This is quite useful especially if you create custom server controls that interoperate with script and have certain dependencies. The above is a good example of a useful switchable routine where you can switch where scripts load from by default – the above pulls from Google CDN but a configuration switch may automatically switch to pull from the local development copies if your doing development for example. How does it work? As mentioned the ClientScriptProxy object mimicks many of the ScriptManager script related methods and so provides close API compatibility with it although it contains many additional overloads that enhance functionality. It does however work against ScriptManager if it’s available on the page, or Page.ClientScript if it’s not so it provides a single unified frontend to script access. There are however many overloads of the original SM methods like the above to provide additional functionality. The implementation of script header rendering is pretty straight forward – as long as a server header (ie. it has to have runat=”server” set) is available. Otherwise these routines fall back to using the default document level insertions of ScriptManager/ClientScript. Given that there is a server header it’s relatively easy to generate the script tags and code and append them to the header either at the top or bottom. I suspect Microsoft didn’t provide header rendering functionality precisely because a runat=”server” header is not required by ASP.NET so behavior would be slightly unpredictable. That’s not really a problem for a custom implementation however. Here’s the RegisterClientScriptBlock implementation that takes a ScriptRenderModes parameter to allow header rendering: /// <summary> /// Renders client script block with the option of rendering the script block in /// the Html header /// /// For this to work Header must be defined as runat="server" /// </summary> /// <param name="control">any control that instance typically page</param> /// <param name="type">Type that identifies this rendering</param> /// <param name="key">unique script block id</param> /// <param name="script">The script code to render</param> /// <param name="addScriptTags">Ignored for header rendering used for all other insertions</param> /// <param name="renderMode">Where the block is rendered</param> public void RegisterClientScriptBlock(Control control, Type type, string key, string script, bool addScriptTags, ScriptRenderModes renderMode) { if (renderMode == ScriptRenderModes.Inherit) renderMode = DefaultScriptRenderMode; if (control.Page.Header == null || renderMode != ScriptRenderModes.HeaderTop && renderMode != ScriptRenderModes.Header && renderMode != ScriptRenderModes.BottomOfPage) { RegisterClientScriptBlock(control, type, key, script, addScriptTags); return; } // No dupes - ref script include only once const string identifier = "scriptblock_"; if (HttpContext.Current.Items.Contains(identifier + key)) return; HttpContext.Current.Items.Add(identifier + key, string.Empty); StringBuilder sb = new StringBuilder(); // Embed in header sb.AppendLine("\r\n<script type=\"text/javascript\">"); sb.AppendLine(script); sb.AppendLine("</script>"); int? index = HttpContext.Current.Items["__ScriptResourceIndex"] as int?; if (index == null) index = 0; if (renderMode == ScriptRenderModes.HeaderTop) { control.Page.Header.Controls.AddAt(index.Value, new LiteralControl(sb.ToString())); index++; } else if(renderMode == ScriptRenderModes.Header) control.Page.Header.Controls.Add(new LiteralControl(sb.ToString())); else if (renderMode == ScriptRenderModes.BottomOfPage) control.Page.Controls.AddAt(control.Page.Controls.Count-1,new LiteralControl(sb.ToString())); HttpContext.Current.Items["__ScriptResourceIndex"] = index; } Note that the routine has to keep track of items inserted by id so that if the same item is added again with the same key it won’t generate two script entries. Additionally the code has to keep track of how many insertions have been made at the top of the document so that entries are added in the proper order. The RegisterScriptInclude method is similar but there’s some additional logic in here to deal with script file references and ClientScriptProxy’s (optional) custom resource handler that provides script compression /// <summary> /// Registers a client script reference into the page with the option to specify /// the script location in the page /// </summary> /// <param name="control">Any control instance - typically page</param> /// <param name="type">Type that acts as qualifier (uniqueness)</param> /// <param name="url">the Url to the script resource</param> /// <param name="ScriptRenderModes">Determines where the script is rendered</param> public void RegisterClientScriptInclude(Control control, Type type, string url, ScriptRenderModes renderMode) { const string STR_ScriptResourceIndex = "__ScriptResourceIndex"; if (string.IsNullOrEmpty(url)) return; if (renderMode == ScriptRenderModes.Inherit) renderMode = DefaultScriptRenderMode; // Extract just the script filename string fileId = null; // Check resource IDs and try to match to mapped file resources // Used to allow scripts not to be loaded more than once whether // embedded manually (script tag) or via resources with ClientScriptProxy if (url.Contains(".axd?r=")) { string res = HttpUtility.UrlDecode( StringUtils.ExtractString(url, "?r=", "&", false, true) ); foreach (ScriptResourceAlias item in ScriptResourceAliases) { if (item.Resource == res) { fileId = item.Alias + ".js"; break; } } if (fileId == null) fileId = url.ToLower(); } else fileId = Path.GetFileName(url).ToLower(); // No dupes - ref script include only once const string identifier = "script_"; if (HttpContext.Current.Items.Contains( identifier + fileId ) ) return; HttpContext.Current.Items.Add(identifier + fileId, string.Empty); // just use script manager or ClientScriptManager if (control.Page.Header == null || renderMode == ScriptRenderModes.Script || renderMode == ScriptRenderModes.Inline) { RegisterClientScriptInclude(control, type,url, url); return; } // Retrieve script index in header int? index = HttpContext.Current.Items[STR_ScriptResourceIndex] as int?; if (index == null) index = 0; StringBuilder sb = new StringBuilder(256); url = WebUtils.ResolveUrl(url); // Embed in header sb.AppendLine("\r\n<script src=\"" + url + "\" type=\"text/javascript\"></script>"); if (renderMode == ScriptRenderModes.HeaderTop) { control.Page.Header.Controls.AddAt(index.Value, new LiteralControl(sb.ToString())); index++; } else if (renderMode == ScriptRenderModes.Header) control.Page.Header.Controls.Add(new LiteralControl(sb.ToString())); else if (renderMode == ScriptRenderModes.BottomOfPage) control.Page.Controls.AddAt(control.Page.Controls.Count-1, new LiteralControl(sb.ToString())); HttpContext.Current.Items[STR_ScriptResourceIndex] = index; } There’s a little more code here that deals with cleaning up the passed in Url and also some custom handling of script resources that run through the ScriptCompressionModule – any script resources loaded in this fashion are automatically cached based on the resource id. Raw urls extract just the filename from the URL and cache based on that. All of this to avoid doubling up of scripts if called multiple times by multiple instances of the same control for example or several controls that all load the same resources/includes. Finally RegisterClientScriptResource utilizes the previous method to wrap the WebResourceUrl as well as some custom functionality for the resource compression module: /// <summary> /// Returns a WebResource or ScriptResource URL for script resources that are to be /// embedded as script includes. /// </summary> /// <param name="control">Any control</param> /// <param name="type">A type in assembly where resources are located</param> /// <param name="resourceName">Name of the resource to load</param> /// <param name="renderMode">Determines where in the document the link is rendered</param> public void RegisterClientScriptResource(Control control, Type type, string resourceName, ScriptRenderModes renderMode) { string resourceUrl = GetClientScriptResourceUrl(control, type, resourceName); RegisterClientScriptInclude(control, type, resourceUrl, renderMode); } /// <summary> /// Works like GetWebResourceUrl but can be used with javascript resources /// to allow using of resource compression (if the module is loaded). /// </summary> /// <param name="control"></param> /// <param name="type"></param> /// <param name="resourceName"></param> /// <returns></returns> public string GetClientScriptResourceUrl(Control control, Type type, string resourceName) { #if IncludeScriptCompressionModuleSupport // If wwScriptCompression Module through Web.config is loaded use it to compress // script resources by using wcSC.axd Url the module intercepts if (ScriptCompressionModule.ScriptCompressionModuleActive) { string url = "~/wwSC.axd?r=" + HttpUtility.UrlEncode(resourceName); if (type.Assembly != GetType().Assembly) url += "&t=" + HttpUtility.UrlEncode(type.FullName); return WebUtils.ResolveUrl(url); } #endif return control.Page.ClientScript.GetWebResourceUrl(type, resourceName); } This code merely retrieves the resource URL and then simply calls back to RegisterClientScriptInclude with the URL to be embedded which means there’s nothing specific to deal with other than the custom compression module logic which is nice and easy. What else is there in ClientScriptProxy? ClientscriptProxy also provides a few other useful services beyond what I’ve already covered here: Transparent ScriptManager and ClientScript calls ClientScriptProxy includes a host of routines that help figure out whether a script manager is available or not and all functions in this class call the appropriate object – ScriptManager or ClientScript – that is available in the current page to ensure that scripts get embedded into pages properly. This is especially useful for control development where controls have no control over the scripting environment in place on the page. RegisterCssLink and RegisterCssResource Much like the script embedding functions these two methods allow embedding of CSS links. CSS links are appended to the header or to a form declared with runat=”server”. LoadControlScript Is a high level resource loading routine that can be used to easily switch between different script linking modes. It supports loading from a WebResource, a url or not loading anything at all. This is very useful if you build controls that deal with specification of resource urls/ids in a standard way. Check out the full Code You can check out the full code to the ClientScriptProxyClass here: ClientScriptProxy.cs ClientScriptProxy Documentation (class reference) Note that the ClientScriptProxy has a few dependencies in the West Wind Web Toolkit of which it is part of. ControlResources holds a few standard constants and script resource links and the ScriptCompressionModule which is referenced in a few of the script inclusion methods. There’s also another useful ScriptContainer companion control  to the ClientScriptProxy that allows scripts to be placed onto the page’s markup including the ability to specify the script location and script minification options. You can find all the dependencies in the West Wind Web Toolkit repository: West Wind Web Toolkit Repository West Wind Web Toolkit Home Page© Rick Strahl, West Wind Technologies, 2005-2010Posted in ASP.NET  JavaScript  

    Read the article

  • Running an intern program

    - by dotneteer
    This year I am running an unpaid internship program for high school students. I work for a small company. We have ideas for a few side projects but never have time to do them. So we experiment by making them intern projects. In return, we give these interns guidance to learn, personal attentions, and opportunities with real-world projects. A few years ago, I blogged about the idea of teaching kids to write application with no more than 6 hours of training. This time, I was able to reduce the instruction time to 4 hours and immediately put them into real work projects. When they encounter problems, I combine directions, pointer to various materials on w3school, Udacity, Codecademy and UTube, as well as encouraging them to  search for solutions with search engines. Now entering the third week, I am more than encouraged and feeling accomplished. Our the most senior intern, Christopher Chen, is a recent high school graduate and is heading to UC Berkeley to study computer science after the summer. He previously only had one year of Java experience through the AP computer science course but had no web development experience. Only 12 days into his internship, he has already gain advanced css skills with deeper understanding than more than half of the “senior” developers that I have ever worked with. I put him on a project to migrate an existing website to the Orchard content management system (CMS) with which I am new as well. We were able to teach each other and quickly gain advanced Orchard skills such as creating custom theme and modules. I felt very much a relationship similar to the those between professors and graduate students. On the other hand, I quite expect that I will lose him the next summer to companies like Google, Facebook or Microsoft. As a side note, Christopher and I will do a two part Orchard presentations together at the next SoCal code camp at UC San Diego July 27-28. The first part, “creating an Orchard website on Azure in 60 minutes”, is an introductory lecture and we will discuss how to create a website using Orchard without writing code. The 2nd part, “customizing Orchard websites without limit”, is an advanced lecture and we will discuss custom theme and module development with WebMatrix and Visual Studio.

    Read the article

  • Try out Windows Phone 7 on your PC today

    - by Matthew Guay
    Anticipation has been building for the new Windows Phone 7 Series ever since Microsoft unveiled it at the Mobile World Congress in February.  Now, thanks to free developer tools, you can get a first-hand experience of the basic Windows Phone 7 Series devices on your PC. Windows Phone 7 Series represents a huge change in the mobile field for Microsoft, bringing the acclaimed Zune HD UI to an innovative phone platform.  Windows Mobile has often been criticized for being behind other Smartphone platforms, but Microsoft seeks to regain the lead with this new upcoming release.  A platform must have developers behind it to be useful, so they have released a full set of free development tools so anyone can make apps for it today.  Or, if you simply want to play with Windows Phone 7, you can use the included emulator to try out the new Metro UI.  Here’s how to do this today on your Vista or 7 computer. Please note: These tools are a Customer Technology Preview release, so only install them if you’re comfortable using pre-release software. Getting Started First, download the Windows Phone Developer Tools CTP (link below), and run the installer.  This will install the Customer Technology Preview (CTP) versions of Visual Studio 2010 Express for Windows Phone, Windows Phone Emulator, Silverlight for Windows Phone, and XNA 4.0 Game Studio on your computer, all of which are required and cannot be installed individually. Accept the license agreement when prompted. Click “Install Now” to install the tools you need.  The only setup customization option is where to save the files, so choose Customize if you need to do so. Setup will now automatically download and install the components you need, and will additionally download either 32 or 64 bit programs depending on your operating system. About halfway thorough the installation, you’ll be prompted to reboot your system.  Once your computer is rebooted, setup will automatically resume without further input.   When setup is finished, click “Run the Product Now” to get started. Running Windows Phone 7 on your PC Now that you’ve got the Windows Phone Developer tools installed, it’s time to get the Windows Phone emulator running.  If you clicked “Run the Product Now” when the setup finished, Visual Studio 2010 Express for Windows Phone should have already started.   If not, simply enter “visual studio” in your start menu search and select “Microsoft Visual Studio 2010 Express for Windows Phone”. Now, to run the Windows Phone 7 emulator, we have to test an application.  So, even if you don’t know how to program, we can open a phone application template, and then test it to run the emulator.  First, click New Project on the left hand side of the front page. Any of the application templates would work for this, but here let’s select “Windows Phone Application”, and then click Ok. Here’s your new application template, which already contains the basic phone application framework.  This is where you’d start if you want to develop a Windows Phone app, but for now we just want to see Windows Phone 7 in action. So, to run the emulator, click Debug in the menu and then select Start Debugging. Your new application will launch inside the Windows Phone 7 Series emulator.  The default template doesn’t give us much, but it does show an example application running in Windows Phone 7.   Exploring Windows Phone 7 Click the Windows button on the emulator to go to the home screen.  Notice the Zune HD-like transition animation.  The emulator only includes Internet Explorer, your test application, and a few settings. Click the arrow on the right to see the available applications in a list. Settings lets you change the theme, regional settings, and the date and time in your emulator.  It also has an applications settings pane, but this currently isn’t populated. The Time settings shows a unique Windows Phone UI. You can return to the home screen by pressing the Windows button.  Here’s the Internet Explorer app running, with the virtual keyboard open to enter an address.  Please note that this emulator can also accept input from your keyboard, so you can enter addresses without clicking on the virtual keyboard. And here’s Google running in Internet Explorer on Windows Phone 7. Windows Phone 7 supports accelerometers, and you can simulate this in the emulator.  Click one of the rotate buttons to rotate the screen in that direction. Here’s our favorite website in Internet Explorer on Windows Phone 7 in landscape mode. All this, running right inside your Windows 7 desktop… Developer tools for Windows Phone 7 Although it may be fun to play with the Windows Phone 7 emulator, developers will be more excited to actually be able to create new and exciting apps for it.  The Windows Phone Developer Tools download includes Visual Studio Express and XNA Game Studio 4.0 which lets you create enticing games and apps for Windows Phones.  All development for Windows Phones will be in C#, Silverlight, and the XNA game framework.  Visual Studio Express for Windows Phone includes templates for these, and additionally has code samples to help you get started with development. Conclusion Many features are still not functional in this preview version, such as the search button and most of the included applications.  However, this still gives you a great way to experience firsthand the future of the Windows Phone platform.  And, for developers, this is your chance to set your mark on the Windows Phone 7 Series even before it is released to the public.  Happy playing and developing! Links Download Windows Phone Developer Tools CTP Windows Phone Developer Site Similar Articles Productive Geek Tips Keep Track of Homework Assignments with SoshikuWeekend Fun: Watch Television On Your PC With TVUPlayerEasily Manage Your Downloads with Download StatusbarCreate a Shortcut or Hotkey to Mute the System Volume in WindowsHow-To Geek on Lifehacker: How to Make Windows Vista Less Annoying TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 PCmover Professional Convert the Quick Launch Bar into a Super Application Launcher Automate Tasks in Linux with Crontab Discover New Bundled Feeds in Google Reader Play Music in Chrome by Simply Dragging a File 15 Great Illustrations by Chow Hon Lam Easily Sync Files & Folders with Friends & Family

    Read the article

  • Issue 15: The Benefits of Oracle Exastack

    - by rituchhibber
         SOLUTIONS FOCUS The Benefits of Oracle Exastack Paul ThompsonDirector, Alliances and Solutions Partner ProgramsOracle EMEA Alliances & Channels RESOURCES -- Oracle PartnerNetwork (OPN) Oracle Exastack Program Oracle Exastack Ready Oracle Exastack Optimized Oracle Exastack Labs and Enablement Resources Oracle Exastack Labs Video Tour SUBSCRIBE FEEDBACK PREVIOUS ISSUES Exastack is a revolutionary programme supporting Oracle independent software vendor partners across the entire Oracle technology stack. Oracle's core strategy is to engineer software and hardware together, and our ISV strategy is the same. At Oracle we design engineered systems that are pre-integrated to reduce the cost and complexity of IT infrastructures while increasing productivity and performance. Oracle innovates and optimises performance at every layer of the stack to simplify business operations, drive down costs and accelerate business innovation. Our engineered systems are optimised to achieve enterprise performance levels that are unmatched in the industry. Faster time to production is achieved by implementing pre-engineered and pre-assembled hardware and software bundles. Our strategy of delivering a single-vendor stack simplifies and reduces costs associated with purchasing, deploying, and supporting IT environments for our customers and partners. In parallel to this core engineered systems strategy, the Oracle Exastack Program enables our Oracle ISV partners to leverage a scalable, integrated infrastructure that delivers their applications tuned, tested and optimised for high-performance. Specifically, the Oracle Exastack Program helps ISVs run their solutions on the Oracle Exadata Database Machine, Oracle Exalogic Elastic Cloud, and Oracle SPARC SuperCluster T4-4 - integrated systems products in which the software and hardware are engineered to work together. These products provide OPN members with a lower cost and high performance infrastructure for database and application workloads across on-premise and cloud based environments. Ready and Optimized Oracle Partners can now leverage our new Oracle Exastack Program to become Oracle Exastack Ready and Oracle Exastack Optimized. Partners can achieve Oracle Exastack Ready status through their support for Oracle Solaris, Oracle Linux, Oracle VM, Oracle Database, Oracle WebLogic Server, Oracle Exadata Database Machine, Oracle Exalogic Elastic Cloud, and Oracle SPARC SuperCluster T4-4. By doing this, partners can demonstrate to their customers that their applications are available on the latest major releases of these products. The Oracle Exastack Ready programme helps customers readily differentiate Oracle partners from lesser software developers, and identify applications that support Oracle engineered systems. Achieving Oracle Exastack Optimized status demonstrates that an OPN member has proven itself against goals for performance and scalability on Oracle integrated systems. This status enables end customers to readily identify Oracle partners that have tested and tuned their solutions for optimum performance on an Oracle Exadata Database Machine, Oracle Exalogic Elastic Cloud, and Oracle SPARC SuperCluster T4-4. These ISVs can display the Oracle Exadata Optimized, Oracle Exalogic Optimized or Oracle SPARC SuperCluster Optimized logos on websites and on all their collateral to show that they have tested and tuned their application for optimum performance. Deliver higher value to customers Oracle's investment in engineered systems enables ISV partners to deliver higher value to customer business processes. New innovations are enabled through extreme performance unachievable through traditional best-of-breed multi-vendor server/software approaches. Core product requirements can be launched faster, enabling ISVs to focus research and development investment on core competencies in order to bring value to market as quickly as possible. Through Exastack, partners no longer have to worry about the underlying product stack, which allows greater focus on the development of intellectual property above the stack. Partners are not burdened by platform issues and can concentrate simply on furthering their applications. The advantage to end customers is that partners can focus all efforts on business functionality, rather than bullet-proofing underlying technologies, and so will inevitably deliver application updates faster. Exastack provides ISVs with a number of flexible deployment options, such as on-premise or Cloud, while maintaining one single code base for applications regardless of customer deployment preference. Customers buying their solutions from Exastack ISVs can therefore be confident in deploying on their own networks, on private clouds or into a public cloud. The underlying platform will support all conceivable deployments, enabling a focus on the ISV's application itself that wouldn't be possible with other vendor partners. It stands to reason that Exastack accelerates time to value as well as lowering implementation costs all round. There is a big competitive advantage in partners being able to offer customers an optimised, pre-configured solution rather than an assortment of components and a suggested fit. Once a customer has decided to buy an Oracle Exastack Ready or Optimized partner solution, it will be up and running without any need for the customer to conduct testing of its own. Operational costs and complexity are also reduced, thanks to streamlined customer support through standardised configurations and pro-active monitoring. 'Engineered to Work Together' is a significant statement of Oracle strategy. It guarantees smoother deployment of a single vendor solution, clear ownership with no finger-pointing and the peace of mind of the Oracle Support Centre underpinning the entire product stack. Next steps Every OPN member with packaged applications must seriously consider taking steps to become Exastack Ready, or Exastack Optimized at the first opportunity. That first step down the track is to talk to an expert on the OPN Portal, at the Oracle Partner Business Center or to discuss the next steps with the closest Oracle account manager. Oracle Exastack lab environments and other technical enablement resources are available for OPN members wishing to further their knowledge of Oracle Exastack and qualify their applications for Oracle Exastack Optimized. New Boot Camps and Guided Learning Paths (GLPs), tailored specifically for ISVs, are available for Oracle Exadata Database Machine, Oracle Exalogic Elastic Cloud, Oracle Linux, Oracle Solaris, Oracle Database, and Oracle WebLogic Server. More information about these GLPs and Boot Camps (including delivery dates and locations) are posted on the OPN Competency Center and corresponding OPN Knowledge Zones. Learn more about Oracle Exastack labs and ISV specific enablement resources. "Oracle Specialized partners are of course front-and-centre, with potential customers clearly directed to those partners and to Exadata Ready partners as a matter of priority." --More OpenWorld 2011 highlights for Oracle partners and customers Oracle Application Testing Suite 9.3 application testing solution for Web, SOA and Oracle Applications Oracle Application Express Release 4.1 improving the development of database-centric Web 2.0 applications and reports Oracle Unified Directory 11g helping customers manage the critical identity information that drives their business applications Oracle SOA Suite for healthcare integration Oracle Enterprise Pack for Eclipse 11g demonstrating continued commitment to the developer and open source communities Oracle Coherence 3.7.1, the latest release of the industry's leading distributed in-memory data grid Oracle Process Accelerators helping to simplify and accelerate time-to-value for customers' business process management initiatives Oracle's JD Edwards EnterpriseOne on the iPad meeting the increasingly mobile demands of today's workforces Oracle CRM On Demand Release 19 Innovation Pack introducing industry-leading hosted call centre and enterprise-marketing capabilities designed to drive further revenue and productivity while reducing costs and improving the customer experience Oracle's Primavera Portfolio Management 9 for businesses delivering on project portfolio goals with increased versatility, transparency and accuracy Oracle's PeopleSoft Human Capital Management (HCM) 9.1 On Demand Standard Edition helping customers manage their long-term investment in enterprise-wide business applications New versions of Oracle FLEXCUBE Universal Banking and Oracle FLEXCUBE Investor Servicing for Financial Institutions, as well as Oracle Financial Services Enterprise Case Management, Oracle Financial Services Pricing Management, Oracle Financial Management Analytics and Oracle Tax Analytics Oracle Utilities Network Management System 1.11 offering new modelling and analysis features to improve distribution-grid management for electric utilities Oracle Communications Network Charging and Control 4.4 helping communications service providers (CSPs) offer their customers more flexible charging options Plus many, many more technology announcements, enhancements, momentum news and community updates -- Oracle OpenWorld 2012 A date has already been set for Oracle OpenWorld 2012. Held once again in San Francisco, exhibitors, partners, customers and Oracle people will gather from 30 September until 4 November to meet, network and learn together with the rest of the global Oracle community. Register now for Oracle OpenWorld 2012 and save $$$! We'll reward your early planning for Oracle OpenWorld 2012 with reduced rates. Super Saver deals are now available! -- Back to the welcome page

    Read the article

  • Managing Database Clusters - A Whole Lot Simpler

    - by mat.keep(at)oracle.com
    Clustered computing brings with it many benefits: high performance, high availability, scalable infrastructure, etc.  But it also brings with it more complexity.Why ?  Well, by its very nature, there are more "moving parts" to monitor and manage (from physical, virtual and logical hosts) to fault detection and failover software to redundant networking components - the list goes on.  And a cluster that isn't effectively provisioned and managed will cause more downtime than the standalone systems it is designed to improve upon.  Not so great....When it comes to the database industry, analysts already estimate that 50% of a typical database's Total Cost of Ownership is attributable to staffing and downtime costs.  These costs will only increase if a database cluster is to hard to properly administer.Over the past 9 months, monitoring and management has been a major focus in the development of the MySQL Cluster database, and on Tuesday 12th January, the product team will be presenting the output of that development in a new webinar.Even if you can't make the date, it is still worth registering so you will receive automatic notification when the on-demand replay is availableIn the webinar, the team will cover:    * NDBINFO: released with MySQL Cluster 7.1, NDBINFO presents real-time status and usage statistics, providing developers and DBAs with a simple means of pro-actively monitoring and optimizing database performance and availability.    * MySQL Cluster Manager (MCM): available as part of the commercial MySQL Cluster Carrier Grade Edition, MCM simplifies the creation and management of MySQL Cluster by automating common management tasks, delivering higher administration productivity and enhancing cluster agility. Tasks that used to take 46 commands can be reduced to just one!    * MySQL Cluster Advisors & Graphs: part of the MySQL Enterprise Monitor and available in the commercial MySQL Cluster Carrier Grade Edition, the Enterprise Advisor includes automated best practice rules that alert on key performance and availability metrics from MySQL Cluster data nodes.You'll also learn how you can get started evaluating and using all of these tools to simplify MySQL Cluster management.This session will last round an hour and will include interactive Q&A throughout. You can learn more about MySQL Cluster Manager from this whitepaper and on-line demonstration.  You can also download the packages from eDelivery (just select "MySQL Database" as the product pack, select your platform, click "Go" and then scroll down to get the software).While managing clusters will never be easy, the webinar will show hou how it just got a whole lot simpler !

    Read the article

  • Agile SOA Governance: SO-Aware and Visual Studio Integration

    - by gsusx
    One of the major limitations of traditional SOA governance platforms is the lack of integration as part of the development process. Tools like HP-Systinet or SOA Software are designed to operate by models on which the architects dictate the governance procedures and policies and the rest of the team members follow along. Consequently, those procedures are frequently rejected by developers and testers given that they can’t incorporate it as part of their daily activities. Having SOA governance products...(read more)

    Read the article

  • Interesting links week #24 and #25

    - by erwin21
    Below a list of interesting links that I found this week: Interaction: Design Usability and All About It Frontend: CSS Lint – CSS Cleaning Tool 10 HTML Entity Crimes You Really Shouldn’t Commit Development: OWASP Top 10 for .NET developers part 7: Insecure Cryptographic Storage C#/.NET Fundamentals: Choosing the Right Collection Class Mobile: Tips to Design a Website for Mobile Marketing: 30 (New) Google Ranking Factors You May Over- or Underestimate Other: 5 Little-Known Web Files That Can Enhance Your Website Interested in more interesting links follow me at twitter http://twitter.com/erwingriekspoor

    Read the article

  • Flash Web Design with the Help of Flash Professionals

    Flash has often been criticized by web specialists for its relatively slow loading time. It?s also been targeted by many people who have experienced loading problem of a Flash site on the web. But no... [Author: David Jackson - Web Design and Development - August 31, 2009]

    Read the article

  • SQLAuthority News – Pluralsight Course Review – Practices for Software Startups – Part 1 of 2

    - by pinaldave
    This is first part of the two part series of Practices for Software Startup Pluralsight Course. The course is written by Stephen Forte (Blog | Twitter). Stephen Forte is the Chief Strategy Officer of the venture backed company, Telerik, a leading vendor of developer and team productivity tools. Stephen is also a Certified Scrum Master, Certified Scrum Professional, PMP, and also speaks regularly at industry conferences around the world. He has written several books on application and database development.  Stephen is also a board member of the Scrum Alliance. Startups – Everybodies Dream Start-up companies are an important topic right now – everyone wants to start their own business.  It is also important to remember that all companies were a start up at one point – from your corner store to the giants like Microsoft and Apple.  Research proves that not every start-up succeeds, in fact, most will fail before their first year.  There are many reasons for this, and this could be due to the fact that there are many stages to a start-up company, and stumbling at any of these stages can lead to failure.  It is important to understand what makes a start-up company succeed at all its hurdles to become successful.  It is even important to define success.  For most start-ups this would mean becoming their own independently functioning company or to be bought out for a hefty profit by a larger company.  The idea of making a hefty profit by living your dream is extremely important, and you can even think of start-ups as the new craze.  That’s why studying them is so important – they are very popular, but things have changed a lot since their inception. Starting the Startups Beginning a start-up company used to be difficult, but now facilities and information is widely available, and it is much easier.  But that means it is much easier to fail, also.  Previously to start your own company, everything was planned and organized, resources were ensured and backed up before beginning; even the idea of starting your own business was a big thing.  Now anybody can do it, and the steps are simple and outlines everywhere – you can get online software and easily outsource , cloud source, or crowdsource a lot of your material.  But without the type of planning previously required, things can often go badly. New Products – New Ideas – New World There are so many fantastic new products, but they don’t reach success all the time.  I find start-up companies very interesting, and whenever I meet someone who is interested in the subject or already starting their own company, I always ask what they are doing, their plans, goals, market, etc.  I am sorry to say that in most cases, they cannot answer my questions.  It is true that many fantastic ideas fail because of bad decisions.  These bad decisions were not made intentionally, but people were simply unaware of what they should be doing.  This will always lead to failure.  But I am happy to say that all these issues can be gone because Pluralsight is now offering a course all about start-ups by Stephen Forte.  Stephen is a start up leader.  He has successfully started many companies and most are still going strong, or have gone on to even bigger and better things. Beginning Course on Startup I have always thought start-ups are a fascinating subject, and decided to take his course, but it is three hours long.  This would be hard to fit into my busy work day all at once, so I decided to do half of his course before my daughter wakes up, and the other half after she goes to sleep.  The course is divided into six modules, so this would be easy to do.  I began the first chapter early in the morning, at 5 am.  Stephen jumped right into the middle of the subject in the very first module – designing your business plan.  The first question you will have to answer to yourself, to others, and to investors is: What is your product and when will we be able to see it?  So a very important concept is a “minimal viable product.”  This means setting goals for yourself and your product.  We all have large dreams, but your minimal viable product doesn’t have to be your final vision at the very first.  For example: Apple is a giant company, but it is still evolving.  Steve Jobs didn’t envision the iPhone 6 at the very beginning.  He had to start at the first iPhone and do his market research, and the idea evolved into the technology you see now.  So for yourself, you should decide a beginning and stop point.  Do your market research.  Determine who you want to reach, what audience you want for your product.  You can have a great idea that simply will not work in the market, do need, bottlenecks, lack of resources, or competition.  There is a lot of research that needs to be done before you even write a business plan, and Stephen covers it in the very first chapter. The Team – Unique Key to Success After jumping right into the subject in the very first module, I wondered what Stephen could have in store for me for the rest of the course.  Chapter number two is building a team.  Having a team is important regardless of what your startup is.  You can be a true visionary with endless ideas and energy, but one person can still not do everything.  It is important to decide from the very beginning if you will have cofounders, team leaders, and how many employees you’ll need.  Even more important, you’ll need to decide what kind of team you want – what personalities, skills, and type of energy you want each of your employees to bring.  Do you want to have an A+ team with a B- idea, or do you have a B- idea that needs an A+ team to sell it?  Stephen asks all the hard questions!  I was especially impressed by his insight on developing.  You have to decide if you need developers, how many, and what their skills should be. I found this insight extremely useful for everyday usage, not just for start-up companies.  I would apply this kind of information in management at any position.  An amazing team will build an amazing product – and that doesn’t matter if you’re a start-up company or a small team working for a much larger business. Customer Development – The Ultimate Obective Chapter three was about customer development. According to Stephen, there are four different steps to develop a customer base.  The first question to ask yourself is if you are envisioning a large customer base buying a few products each, or a small, dedicated base that buys a lot of your product – quantity vs. Quality.  He also discusses how to earn, retain, and get more customers.  He also says that each customer should be placed in a different role – some will be like investors, who regularly spend with you and invest their money in your business.  It is then your job to take that investment and turn it into a better product in the future.  You need to deal with their money properly – think of it is as theirs as investors, not yours as profit.  At the end of this module I felt that only Stephen could provide this kind of insight, and then he listed all the resources he took his information from.  I have never seen a group of people so passionate about their customers. It was indeed a long day for me. In tomorrow’s part 2 we will discuss rest of the three module and also will see a quick video of the Practices for Software Startup Pluralsight Course. Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: Best Practices, PostADay, SQL, SQL Authority, SQL Query, SQL Server, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • Thursday Community Keynote: "By the Community, For the Community"

    - by Janice J. Heiss
    Sharat Chander, JavaOne Community Chairperson, began Thursday's Community Keynote. As part of the morning’s theme of "By the Community, For the Community," Chander noted that 60% of the material at the 2012 JavaOne conference was presented by Java Community members. "So next year, when the call for papers starts, put-in your submissions," he urged.From there, Gary Frost, Principal Member of Technical Staff, AMD, expanded upon Sunday's Strategy Keynote exploration of Project Sumatra, an OpenJDK project targeted at bringing Java to heterogeneous computing platforms (which combine the CPU and the parallel processor of the GPU into a single piece of silicon). Sumatra entails enhancing the JVM to make maximum use of these advanced platforms. Within this development space, AMD created the Aparapi API, which converts Java bytecode into OpenCL for execution on such GPU devices. The Aparapi API was open sourced in September 2011.Whether it was zooming-in on a Mandelbrot set, "the game of life," or a swarm of 10,000 Dukes in a space-bound gravitational dance, Frost's demos, using an Aparapi/OpenCL implementation, produced stunningly faster display results. He indicated that the Java 9 timeframe is where they see Project Sumatra coming to ultimate fruition, employing the Lamdas of Java 8.Returning to the theme of the keynote, Donald Smith, Director, Java Product Management, Oracle, explored a mind map graphic demonstrating the importance of Community in terms of fostering innovation. "It's the sharing and mixing of culture, the diversity, and the rapid prototyping," he said. Within this topic, Smith, brought up a panel of representatives from Cloudera, Eclipse, Eucalyptus, Perrone Robotics, and Twitter--ideal manifestations of community and innovation in the world of Java.Marten Mickos, CEO, Eucalyptus Systems, explored his company's open source cloud software platform, written in Java, and used by gaming companies, technology companies, media companies, and more. Chris Aniszczyk, Operations Engineering,Twitter, noted the importance of the JVM in terms of their multiple-language development environment. Mike Olson, CEO, Cloudera, described his company's Apache Hadoop-based software, support, and training. Mike Milinkovich, Executive Director, Eclipse Foundation, noted that they have about 270 tools projects at Eclipse, with 267 of them written in Java. Milinkovich added that Eclipse will even be going into space in 2013, as part of the control software on various experiments aboard the International Space Station. Lastly, Paul Perrone, CEO, Perrone Robotics, detailed his company's robotics and automation software platform built 100% on Java, including Java SE and Java ME--"on rat, to cat, to elephant-sized systems." Milinkovic noted that communities are by nature so good at innovation because of their very openness--"The more open you make your innovation process, the more ideas are challenged, and the more developers are focused on justifying their choices all the way through the process."From there, Georges Saab, VP Development Java SE OpenJDK, continued the topic of innovation and helping the Java Community to "Make the Future Java." Martijn Verburg, representing the London Java Community (winner of a Duke's Choice Award 2012 for their activity in OpenJDK and JCP), soon joined Saab onstage. Verburg detailed the LJC's "Adopt a JSR" program--"to get day-to-day developers more involved in the innovation that's happening around them."  From its London launching pad, the innovative program has spread to Brazil, Morocco, Latvia, India, and more.Other active participants in the program joined Verburg onstage--Ben Evans, London Java Community; James Gough, Stackthread; Bruno Souza, SOUJava; Richard Warburton, jClarity; and Cecelia Borg, Oracle--OpenJDK Onboarding. Together, the group explored the goals and tasks inherent in the Adopt a JSR program--from organizing hack days (testing prototype implementations), to managing mailing lists and forums, to triaging issues, to evangelism—all with the goal of fostering greater community/developer involvement, but equally importantly, building better open standards. “Come join us, and make your ecosystem better!" urged Verburg.Paul Perrone returned to profile the latest in his company's robotics work around Java--including the AARDBOTS family of smaller robotic vehicles, running the Perrone MAX platform on top of the Java JVM. Perrone took his "Rumbles" four-wheeled robot out for a spin onstage--a roaming, ARM-based security-bot vehicle, complete with IR, ultrasonic, and "cliff" sensors (the latter, for the raised stage at JavaOne). As an ultimate window into the future of robotics, Perrone displayed a "head-set" controller--a sensor directed at the forehead to monitor brainwaves, for the someday-implementation of brain-to-robot control.Then, just when it seemed this might be the end of the day's futuristic offerings, a mystery voice from offstage pronounced "I've got some toys"--proving to be guest-visitor James Gosling, there to explore his cutting-edge work with Liquid Robotics. While most think of robots as something with wheels or arms or lasers, Gosling explained, the Liquid Robotics vehicle is an entirely new and innovative ocean-going 'bot. Looking like a floating surfboard, with an attached set of underwater wings, the autonomous devices roam the oceans using only the energy of ocean waves to propel them, and a single actuated rudder to steer. "We have to accomplish all guidance just by wiggling the rudder," Gosling said. The devices offer applications from self-installing weather buoy, to pollution monitoring station, to marine mammal monitoring device, to climate change data gathering, to even ocean life genomic sampling. The early versions of the vehicle used C code on very tiny industrial micro controllers, where they had to "count the bytes one at a time."  But the latest generation vehicles, which just hit the water a week or so ago, employ an ARM processor running Linux and the ARM version of JDK 7. Gosling explained that vehicle communication from remote locations is achieved via the Iridium satellite network. But because of the costs of this communication path, the data must be sent in very small bursts--using SBD short burst data. "It costs $1/kb, so that rules everything in the software design,” said Gosling. “If you were trying to stream a Netflix video over this, it would cost a million dollars a movie. …We don't have a 'big data' problem," he quipped. There are currently about 150 Liquid Robotics vehicles out traversing the oceans. Gosling demonstrated real time satellite tracking of several vehicles currently at sea, noting that Java is actually particularly good at AI applications--due to the language having garbage collection, which facilitates complex data structures. To close-out his time onstage, Gosling of course participated in the ceremonial Java tee-shirt toss out to the audience…In parting, Chander passed the JavaOne Community Chairperson baton to Stephen Chin, Java Technology Evangelist, Oracle. Onstage in full motorcycle gear, Chin noted that he'll soon be touring Europe by motorcycle, meeting Java Community Members and streaming live via UStream--the ultimate manifestation of community and technology!  He also reminded attendees of the upcoming JavaOne Latin America 2012, São Paulo, Brazil (December 4-6, 2012), and stated that the CFP (call for papers) at the conference has been extended for one more week. "Remember, December is summer in Brazil!" Chin said.

    Read the article

  • Wireless Networking 802.11n

    It';s been years in development but this September it looks like 802.11n Wi-Fi will finally become a standard... well, an official standard anyway. Presently the majority of the wireless hardware you... [Author: Chris Holgate - Computers and Internet - April 08, 2010]

    Read the article

  • Catch the Replay! Steve Miranda on The Bill Kutik Radio Show®

    - by Jay Richey, HCM Product Marketing
    Steve Miranda, Senior Vice President for Oracle Fusion Development, was the guest star on this past Wednesday's The Bill Kutik Radio Show®.  Catch the replay or download to iTunes to hear Bill's hard-hitting questions and Steve's candid answers.  http://www.knowledgeinfusion.com/ondemand/docs/DOC-9903 Produced by Knowledge Infusion and hosted by independent industry analyst Bill Kutik, the bi-weekly interview show provides leading HR business content and insight into up-to-the-minute trends.

    Read the article

< Previous Page | 632 633 634 635 636 637 638 639 640 641 642 643  | Next Page >