Search Results

Search found 16731 results on 670 pages for 'memory limit'.

Page 637/670 | < Previous Page | 633 634 635 636 637 638 639 640 641 642 643 644  | Next Page >

  • Class template specializations with shared functionality

    - by Thomas
    I'm writing a simple maths library with a template vector type: template<typename T, size_t N> class Vector { public: Vector<T, N> &operator+=(Vector<T, N> const &other); // ... more operators, functions ... }; Now I want some additional functionality specifically for some of these. Let's say I want functions x() and y() on Vector<T, 2> to access particular coordinates. I could create a partial specialization for this: template<typename T> class Vector<T, 3> { public: Vector<T, 3> &operator+=(Vector<T, 3> const &other); // ... and again all the operators and functions ... T x() const; T y() const; }; But now I'm repeating everything that already existed in the generic template. I could also use inheritance. Renaming the generic template to VectorBase, I could do this: template<typename T, size_t N> class Vector : public VectorBase<T, N> { }; template<typename T> class Vector<T, 3> : public VectorBase<T, 3> { public: T x() const; T y() const; }; However, now the problem is that all operators are defined on VectorBase, so they return VectorBase instances. These cannot be assigned to Vector variables: Vector<float, 3> v; Vector<float, 3> w; w = 5 * v; // error: no conversion from VectorBase<float, 3> to Vector<float, 3> I could give Vector an implicit conversion constructor to make this possible: template<typename T, size_t N> class Vector : public VectorBase<T, N> { public: Vector(VectorBase<T, N> const &other); }; However, now I'm converting from Vector to VectorBase and back again. Even though the types are the same in memory, and the compiler might optimize all this away, it feels clunky and I don't really like to have potential run-time overhead for what is essentially a compile-time problem. Is there any other way to solve this?

    Read the article

  • Few iPhone noob questions

    - by mshsayem
    Why should I declare local variables as 'static' inside a method? Like: static NSString *cellIdentifier = @"Cell"; Is it a performance advantage? (I know what 'static' does; in C context) What does this syntax mean?[someObj release], someObj = nil; Two statements? Why should I assign nil again? Is not 'release' enough? Should I do it for all objects I allocate/own? Or for just view objects? Why does everyone copy NSString, but retains other objects (in property declaration)? Yes, NSStrings can be changed, but other objects can be changed also, right? Then why 'copy' for just NSString, not for all? Is it just a defensive convention? Shouldn't I release constant NSString? Like here:NSString *CellIdentifier = @"Cell"; Why not? Does the compiler allocate/deallocate it for me? In some tutorial application I observed these (Built with IB): Properties(IBOutlet, with same ivar name): window, someLabel, someTextField, etc etc... In the dealloc method, although the window ivar was released, others were not. My question is: WHY? Shouldn't I release other ivars(labels, textField) as well? Why not? Say, I have 3 cascaded drop-down lists. I mean, based on what is selected on the first list, 2nd list is populated and based on what is selected on the second list, 3rd list is populated. What UI components can reflect this best? How is drop-down list presented in iPhone UI? Tableview with UIPicker? When should I update the 2nd, 3rd list? Or just three labels which have touch events? Can you give me some good example tutorials about Core-Data? (Not just simple data fetching and storing on 2/3 tables with 1/2 relationship) How can I know whether my app is leaking memory? Any tools?

    Read the article

  • How to allow multiple filters to be selected - pagination?

    - by NewSOuser
    Hey, I am still trying to allow multiple filters to be selected for my pagination script but not sure how to do it being very new to php and programing in general. So in my pagination, when a user clicks the 'marketing' button(link) it queries the database just for the category that = marketing. The same goes for the other 2 filter buttons as seen in the script below. (automotive, sports). The problem is, I want to be able to select multiple filters like only marketing and auomotive or automotive and sports, for example if I click the marketing filter and then the automotive, it would display the categories that equal marketing, and automotive. I have no idea how to accomplish this, so I have come to the experts to help me out. This is the script I am working on: <h3>Filter results by:</h3> <a href='pagi_test.php?category=marketing'>marketing</a> <a href='pagi_test.php?category=automotive'>automotive</a> <a href='pagi_test.php?category=sports'>sports</a> <br /> <h3>Results:</h3> <?php //connecting to the database $error = "Could not connect to the database"; mysql_connect('localhost','root','root') or die($error); mysql_select_db('ajax_demo') or die($error); //max displayed per page $per_page = 3; //get start variable $start = $_GET['start']; $category = mysql_real_escape_string($_GET['category']); //count records $record_count = mysql_num_rows(mysql_query("SELECT * FROM explore WHERE category='$category'")); //count max pages $max_pages = $record_count / $per_page; //may come out as decimal if (!$start) $start = 0; //display data $get = mysql_query("SELECT * FROM explore WHERE category='$category' LIMIT $start, $per_page"); ?> <table width="800px"> <?php while ($row = mysql_fetch_assoc($get)) { // get data $id = $row['id']; $site_name = $row['site_name']; $site_description = $row['site_description']; ?> <tr> <td><?php echo $id; ?></td> <td><?php echo $site_name; ?></td> <td><?php echo $site_description; ?></td> </tr> <?php } //setup prev and next variables $prev = $start - $per_page; $next = $start + $per_page; //show prev button if (!($start<=0)) echo "<a href='pagi_test.php?category=$category&start=$prev'>Prev</a> "; //show page numbers //set variable for first page $i=1; for ($x=0;$x<$record_count;$x=$x+$per_page) { if ($start!=$x) echo " <a href='pagi_test.php?category=$category&start=$x'>$i</a> "; else echo " <a href='pagi_test.php?category=$category&start=$x'><b>$i</b></a> "; $i++; } //show next button if (!($start>=$record_count-$per_page)) echo " <a href='pagi_test.php?category=$category&start=$next'>Next</a>"; ?> Any help on this would be great. Thank you. -- EDIT -- If anyone has a better method of doing a pagination system with multiple filters than the one above, please let me know.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • BufferedReader no longer buffering after a while?

    - by BobTurbo
    Sorry I can't post code but I have a bufferedreader with 50000000 bytes set as the buffer size. It works as you would expect for half an hour, the HDD light flashing every two minutes or so, reading in the big chunk of data, and then going quiet again as the CPU processes it. But after about half an hour (this is a very big file), the HDD starts thrashing as if it is reading one byte at a time. It is still in the same loop and I think I checked free ram to rule out swapping (heap size is default). Probably won't get any helpful answers, but worth a try. OK I have changed heap size to 768mb and still nothing. There is plenty of free memory and java.exe is only using about 300mb. Now I have profiled it and heap stays at about 200MB, well below what is available. CPU stays at 50%. Yet the HDD starts thrashing like crazy. I have.. no idea. I am going to rewrite the whole thing in c#, that is my solution. Here is the code (it is just a throw-away script, not pretty): BufferedReader s = null; HashMap<String, Integer> allWords = new HashMap<String, Integer>(); HashSet<String> pageWords = new HashSet<String>(); long[] pageCount = new long[78592]; long pages = 0; Scanner wordFile = new Scanner(new BufferedReader(new FileReader("allWords.txt"))); while (wordFile.hasNext()) { allWords.put(wordFile.next(), Integer.parseInt(wordFile.next())); } s = new BufferedReader(new FileReader("wikipedia/enwiki-latest-pages-articles.xml"), 50000000); StringBuilder words = new StringBuilder(); String nextLine = null; while ((nextLine = s.readLine()) != null) { if (a.matcher(nextLine).matches()) { continue; } else if (b.matcher(nextLine).matches()) { continue; } else if (c.matcher(nextLine).matches()) { continue; } else if (d.matcher(nextLine).matches()) { nextLine = s.readLine(); if (e.matcher(nextLine).matches()) { if (f.matcher(s.readLine()).matches()) { pageWords.addAll(Arrays.asList(words.toString().toLowerCase().split("[^a-zA-Z]"))); words.setLength(0); pages++; for (String word : pageWords) { if (allWords.containsKey(word)) { pageCount[allWords.get(word)]++; } else if (!word.isEmpty() && allWords.containsKey(word.substring(0, word.length() - 1))) { pageCount[allWords.get(word.substring(0, word.length() - 1))]++; } } pageWords.clear(); } } } else if (g.matcher(nextLine).matches()) { continue; } words.append(nextLine); words.append(" "); }

    Read the article

  • Multi-tier applications using L2S, WCF and Base Class

    - by Gena Verdel
    Hi all. One day I decided to build this nice multi-tier application using L2S and WCF. The simplified model is : DataBase-L2S-Wrapper(DTO)-Client Application. The communication between Client and Database is achieved by using Data Transfer Objects which contain entity objects as their properties. abstract public class BaseObject { public virtual IccSystem.iccObjectTypes ObjectICC_Type { get { return IccSystem.iccObjectTypes.unknownType; } } [global::System.Data.Linq.Mapping.ColumnAttribute(Storage = "_ID", AutoSync = AutoSync.OnInsert, DbType = "BigInt NOT NULL IDENTITY", IsPrimaryKey = true, IsDbGenerated = true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order = 1)] public virtual long ID { //get; //set; get { return _ID; } set { _ID = value; } } } [DataContract] public class BaseObjectWrapper<T> where T : BaseObject { #region Fields private T _DBObject; #endregion #region Properties [DataMember] public T Entity { get { return _DBObject; } set { _DBObject = value; } } #endregion } Pretty simple, isn't it?. Here's the catch. Each one of the mapped classes contains ID property itself so I decided to override it like this [global::System.Data.Linq.Mapping.TableAttribute(Name="dbo.Divisions")] [global::System.Runtime.Serialization.DataContractAttribute()] public partial class Division : INotifyPropertyChanging, INotifyPropertyChanged { [global::System.Data.Linq.Mapping.ColumnAttribute(Storage="_ID", AutoSync=AutoSync.OnInsert, DbType="BigInt NOT NULL IDENTITY", IsPrimaryKey=true, IsDbGenerated=true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order=1)] public override long ID { get { return this._ID; } set { if ((this._ID != value)) { this.OnIDChanging(value); this.SendPropertyChanging(); this._ID = value; this.SendPropertyChanged("ID"); this.OnIDChanged(); } } } } Wrapper for division is pretty straightforward as well: public class DivisionWrapper : BaseObjectWrapper<Division> { } It worked pretty well as long as I kept ID values at mapped class and its BaseObject class the same(that's not very good approach, I know, but still) but then this happened: private CentralDC _dc; public bool UpdateDivision(ref DivisionWrapper division) { DivisionWrapper tempWrapper = division; if (division.Entity == null) { return false; } try { Table<Division> table = _dc.Divisions; var q = table.Where(o => o.ID == tempWrapper.Entity.ID); if (q.Count() == 0) { division.Entity._errorMessage = "Unable to locate entity with id " + division.Entity.ID.ToString(); return false; } var realEntity = q.First(); realEntity = division.Entity; _dc.SubmitChanges(); return true; } catch (Exception ex) { division.Entity._errorMessage = ex.Message; return false; } } When trying to enumerate over the in-memory query the following exception occurred: Class member BaseObject.ID is unmapped. Although I'm stating the type and overriding the ID property L2S fails to work. Any suggestions?

    Read the article

  • What's the best-practice way to update an Adapter's underlying data?

    - by skyler
    I'm running into an IllegalStateException updating an underlying List to an Adapter (might be an ArrayAdapter or an extension of BaseAdapter, I don't remember). I do not have or remember the text of the exception at the moment, but it says something to the effect of the List's content changing without the Adapter having been notified of the change. This List /may/ be updated from another thread other than the UI thread (main). After I update this list (adding an item), I call notifyDataSetChanged. The issue seems to be that the Adapter, or ListView attached to the Adapter attempts to update itself before this method is invoked. When this happens, the IllegalStateException is thrown. If I set the ListView's visibility to GONE before the update, then VISIBLE again, no error occurs. But this isn't always practical. I read somewhere that you cannot modify the underlying this from another thread--this would seem to limit an MVC pattern, as with this particular List, I want to add items from different threads. I assumed that as long as I called notifyDataSetChanged() I'd be safe--that the Adapter didn't revisit the underlying List until this method was invoked but this doesn't seem to be the case. I suppose what I'm asking is, can it be safe to update the underlying List from threads other than the UI? Additionally, if I want to modify the data within an Adapter, do I modify the underlying List or the Adapter itself (via its add(), etc. methods). Modifying the data through the Adapter seems wrong. I came across a thread on another site from someone who seems to be having a similar problem to mine: http://osdir.com/ml/Android-Developers/2010-04/msg01199.html (this is from where I grabbed the Visibility.GONE and .VISIBLE idea). To give you a better idea of my particular problem, I'll describe a bit of how my List, Adapter, etc. are set up. I've an object named Queue that contains a LinkedList. Queue extends Observable, and when things are added to its internal list through its methods, I call setChanged() and notifyListeners(). This Queue object can have items added or removed from any number of threads. I have a single "queue view" Activity that contains an Adapter. This Activity, in its onCreate() method, registers an Observer listener to my Queue object. In the Observer's update() method I call notifyDataSetChanged() on the Adapter. I added a lot of log output and determined that when this IllegalStateExcption occurs that my Observer callback was never invoked. So it's as if the Adapter noticed the List's change before the Observer had a chance to notify its Observers, and call my method to notify the Adapter that the contents had changed. So I suppose what I'm asking is, is this a good way to rig-up an Adapter? Is this a problem because I'm updating the Adapter's contents from a thread other than the UI thread? If this is the case, I may have a solution in mind (give the Queue object a Handler to the UI thread when it's created, and make all List modifications using that Handler, but this seems improper). I realize that this is a very open-ended post, but I'm a bit lost on this and would appreciate any comments on what I've written.

    Read the article

  • Getting instance crashes on IntelliJ IDEA with scala plugin.

    - by egervari
    I am building a scala web project using scala test, lift, jpa, hibernate, mercurial plugin, etc. I am getting instant crashes, where the ide just bombs, the window shuts down, and it gives no error messages whatsoever when I am doing any amount of copy/pasting of code. This started happening once my project got to about 100 unit tests. This problem is incredibly annoying, because when the crash happens, 30-60 seconds of activity is not saved. Even IDEA will forget which files were last opened and will forget where the cursor was, which makes it really hard to continue where you left off after the crash. A lot can happen in 60 seconds! Now, I've given up, because it seems like all sorts of things cause the IntelliJ IDEA to crash over and over. For example, if I were to copy and paste this code, to write a similar test for another collection type, it would crash shortly after: it should "cascade save and delete status messages" in { val statusMessage = new StatusMessage("message") var user = userDao.find(1).get user.addToStatusMessages(statusMessage) userDao.save(user) statusMessage.isPersistent should be (true) userDao.delete(user) statusMessageDao.find(statusMessage.id) should equal (None) } There is nothing special about this piece of code. It's code that is working just fine. However, IDEA bombs shortly after I paste something like this. For example, I might change StatusMessage to the new class I want to test cascading on... and then have to import that class into the test... and BOOM... it crashed. On windows 7, the IDEA window literally just minimizes and crashes with no warning. The next time I startup IDEA, it has no memory of what happened. Now, I've had this problem before. I posted it way back on IDEA's YouTrack. I was told to invalidate my caches. That never fixed it then, and it's not fixing it now. Please help. This error is fairly random, but it's happening constantly now. I could program for hours and not see it before... and the fact that my work just gets destroyed and I can't remember what I did during the last minute causes me to swear at my monitor at a db level higher than my stereo can go.

    Read the article

  • .NET Windows Service with timer stops responding

    - by Biri
    I have a windows service written in c#. It has a timer inside, which fires some functions on a regular basis. So the skeleton of my service: public partial class ArchiveService : ServiceBase { Timer tickTack; int interval = 10; ... protected override void OnStart(string[] args) { tickTack = new Timer(1000 * interval); tickTack.Elapsed += new ElapsedEventHandler(tickTack_Elapsed); tickTack.Start(); } protected override void OnStop() { tickTack.Stop(); } private void tickTack_Elapsed(object sender, ElapsedEventArgs e) { ... } } It works for some time (like 10-15 days) then it stops. I mean the service shows as running, but it does not do anything. I make some logging and the problem can be the timer, because after the interval it does not call the tickTack_Elapsed function. I was thinking about rewrite it without a timer, using an endless loop, which stops the processing for the amount of time I set up. This is also not an elegant solution and I think it can have some side effects regarding memory. The Timer is used from the System.Timers namespace, the environment is Windows 2003. I used this approach in two different services on different servers, but both is producing this behavior (this is why I thought that it is somehow connected to my code or the framework itself). Does somebody experienced this behavior? What can be wrong? Edit: I edited both services. One got a nice try-catch everywhere and more logging. The second got a timer-recreation on a regular basis. None of them stopped since them, so if this situation remains for another week, I will close this question. Thank you for everyone so far. Edit: I close this question because nothing happened. I mean I made some changes, but those changes are not really relevant in this matter and both services are running without any problem since then. Please mark it as "Closed for not relevant anymore".

    Read the article

  • How do I create a thread-safe write-once read-many value in Java?

    - by Software Monkey
    This is a problem I encounter frequently in working with more complex systems and which I have never figured out a good way to solve. It usually involves variations on the theme of a shared object whose construction and initialization are necessarily two distinct steps. This is generally because of architectural requirements, similar to applets, so answers that suggest I consolidate construction and initialization are not useful. By way of example, let's say I have a class that is structured to fit into an application framework like so: public class MyClass { private /*ideally-final*/ SomeObject someObject; MyClass() { someObject=null; } public void startup() { someObject=new SomeObject(...arguments from environment which are not available until startup is called...); } public void shutdown() { someObject=null; // this is not necessary, I am just expressing the intended scope of someObject explicitly } } I can't make someObject final since it can't be set until startup() is invoked. But I would really like it to reflect it's write-once semantics and be able to directly access it from multiple threads, preferably avoiding synchronization. The idea being to express and enforce a degree of finalness, I conjecture that I could create a generic container, like so: public class WoRmObject<T> { private T object; WoRmObject() { object=null; } public WoRmObject set(T val) { object=val; return this; } public T get() { return object; } } and then in MyClass, above, do: private final WoRmObject<SomeObject> someObject; MyClass() { someObject=new WoRmObject<SomeObject>(); } public void startup() { someObject.set(SomeObject(...arguments from environment which are not available until startup is called...)); } Which raises some questions for me: Is there a better way, or existing Java object (would have to be available in Java 4)? Is this thread-safe provided that no other thread accesses someObject.get() until after it's set() has been called. The other threads will only invoke methods on MyClass between startup() and shutdown() - the framework guarantees this. Given the completely unsynchronized WoRmObject container, it is ever possible under either JMM to see a value of object which is neither null nor a reference to a SomeObject? In other words, does has the JMM always guaranteed that no thread can observe the memory of an object to be whatever values happened to be on the heap when the object was allocated.

    Read the article

  • writing XML with Xerces 3.0.1 and C++ on windows

    - by Jon
    Hi, i have the following function i wrote to create an XML file using Xerces 3.0.1, if i call this function with a filePath of "foo.xml" or "../foo.xml" it works great, but if i pass in "c:/foo.xml" then i get an exception on this line XMLFormatTarget *formatTarget = new LocalFileFormatTarget(targetPath); can someone explain why my code works for relative paths, but not absolute paths please? many thanks. const int ABSOLUTE_PATH_FILENAME_PREFIX_SIZE = 9; void OutputXML(xercesc::DOMDocument* pmyDOMDocument, std::string filePath) { //Return the first registered implementation that has the desired features. In this case, we are after a DOM implementation that has the LS feature... or Load/Save. DOMImplementation *implementation = DOMImplementationRegistry::getDOMImplementation(L"LS"); // Create a DOMLSSerializer which is used to serialize a DOM tree into an XML document. DOMLSSerializer *serializer = ((DOMImplementationLS*)implementation)->createLSSerializer(); // Make the output more human readable by inserting line feeds. if (serializer->getDomConfig()->canSetParameter(XMLUni::fgDOMWRTFormatPrettyPrint, true)) serializer->getDomConfig()->setParameter(XMLUni::fgDOMWRTFormatPrettyPrint, true); // The end-of-line sequence of characters to be used in the XML being written out. serializer->setNewLine(XMLString::transcode("\r\n")); // Convert the path into Xerces compatible XMLCh*. XMLCh *tempFilePath = XMLString::transcode(filePath.c_str()); // Calculate the length of the string. const int pathLen = XMLString::stringLen(tempFilePath); // Allocate memory for a Xerces string sufficent to hold the path. XMLCh *targetPath = (XMLCh*)XMLPlatformUtils::fgMemoryManager->allocate((pathLen + ABSOLUTE_PATH_FILENAME_PREFIX_SIZE) * sizeof(XMLCh)); // Fixes a platform dependent absolute path filename to standard URI form. XMLString::fixURI(tempFilePath, targetPath); // Specify the target for the XML output. XMLFormatTarget *formatTarget = new LocalFileFormatTarget(targetPath); //XMLFormatTarget *myFormTarget = new StdOutFormatTarget(); // Create a new empty output destination object. DOMLSOutput *output = ((DOMImplementationLS*)implementation)->createLSOutput(); // Set the stream to our target. output->setByteStream(formatTarget); // Write the serialized output to the destination. serializer->write(pmyDOMDocument, output); // Cleanup. serializer->release(); XMLString::release(&tempFilePath); delete formatTarget; output->release(); }

    Read the article

  • C - What is the proper format to allow a function to show an error was encountered?

    - by BrainSteel
    I have a question about what a function should do if the arguments to said function don't line up quite right, through no fault of the function call. Since that sentence doesn't make much sense, I'll offer my current issue. To keep it simple, here is the most relevant and basic function I have. float getYValueAt(float x, PHYS_Line line, unsigned short* error) *error = 0; if(x < line.start.x || x > line.end.x){ *error = 1; return -1; } if(line.slope.value != 0){ //line's equation: y - line.start.y = line.slope.value(x - line.start.x) return line.slope.value * (x - line.start.x) + line.start.y; } else if(line.slope.denom == 0){ if(line.start.x == x) return line.start.y; else{ *error = 1; return -1; } } else if(line.slope.num == 0){ return line.start.y; } } The function attempts to find the point on a line, given a certain x value. However, under some circumstances, this may not be possible. For example, on the line x = 3, if 5 is passed as a value, we would have a problem. Another problem arises if the chosen x value is not within the interval the line is on. For this, I included the error pointer. Given this format, a function call could work as follows: void foo(PHYS_Line some_line){ unsigned short error = 0; float y = getYValueAt(5, some_line, &error); if(error) fooey(); else do_something_with_y(y); } My question pertains to the error. Note that the value returned is allowed to be negative. Returning -1 does not ensure that an error has occurred. I know that it is sometimes preferred to use the following method to track an error: float* getYValueAt(float x, PHYS_Line line); and then return NULL if an error occurs, but I believe this requires dynamic memory allocation, which seems even less sightly than the solution I was using. So, what is standard practice for an error occurring?

    Read the article

  • Rewrite code from Threads to AnyEvent

    - by user1779868
    I wrote a code: use LWP::UserAgent; use HTTP::Cookies; use threads; use threads::shared; $| = 1; $threads = 50; my @urls : shared = loadf('url.txt'); my @thread_list = (); $thread_list[$_] = threads->create(\&thread) for 0 .. $threads - 1; $_->join for @thread_list; thread(); sub thread { my ($web, $ck) = browser(); while(1) { my $url = shift @urls; if(!$url) { last; } $code = $web->get($url)->code; print "[+] $url - code: $code\n"; if($code == 200) { open F, ">>200.txt"; print F $url."\n"; close F; } elsif($code == 301) { open F, ">>301.txt"; print F $url."\n"; close F; } else { open F, ">>else.txt"; print F "$url code - $code\n"; close F; } } } sub loadf { open (F, "<".$_[0]) or erroropen($_[0]); chomp(my @data = <F>); close F; return @data; } sub browser { my $web = new LWP::UserAgent; my $ck = new HTTP::Cookies; $web->cookie_jar($ck); $web->agent('Opera/9.80 (Windows 7; U; en) Presto/2.9.168 Version/11.50'); $web->timeout(5); return $web, $ck; } After its working for some time physical storage is full. Can u help me to re-write it with AnyEvent. I tried but my code didn't work. I read that it will help me to safe some memory. Thanks a lot to any helpers.

    Read the article

  • Primary language - C++/Qt, C#, Java?

    - by Airjoe
    I'm looking for some input, but let me start with a bit of background (for tl;dr skip to end). I'm an IT major with a concentration in networking. While I'm not a CS major nor do I want to program as a vocation, I do consider myself a programmer and do pretty well with the concepts involved. I've been programming since about 6th grade, started out with a proprietary game creation language that made my transition into C++ at college pretty easy. I like to make programs for myself and friends, and have been paid to program for local businesses. A bit about that- I wrote some programs for a couple local businesses in my senior year in high school. I wrote management systems for local shops (inventory, phone/pos orders, timeclock, customer info, and more stuff I can't remember). It definitely turned out to be over my head, as I had never had any formal programming education. It was a great learning experience, but damn was it crappy code. Oh yeah, by the way, it was all vb6. So, I've used vb6 pretty extensively, I've used c++ in my classes (intro to programming up to algorithms), used Java a little bit in another class (had to write a ping client program, pretty easy) and used Java for some simple Project Euler problems to help learn syntax and such when writing the program for the class. I've also used C# a bit for my own simple personal projects (simple programs, one which would just generate an HTTP request on a list of websites and notify if one responded unexpectedly or not at all, and another which just held a list of things to do and periodically reminded me to do them), things I would've written in vb6 a year or two ago. I've just started using Qt C++ for some undergrad research I'm working on. Now I've had some formal education, I [think I] understand organization in programming a lot better (I didn't even use classes in my vb6 programs where I really should have), how it's important to structure code, split into functions where appropriate, document properly, efficiency both in memory and speed, dynamic and modular programming etc. I was looking for some input on which language to pick up as my "primary". As I'm not a "real programmer", it will be mostly hobby projects, but will include some 'real' projects I'm sure. From my perspective: QtC++ and Java are cross platform, which is cool. Java and C# run in a virtual machine, but I'm not sure if that's a big deal (something extra to distribute, possibly a bit slower? I think Qt would require additional distributables too, right?). I don't really know too much more than this, so I appreciate any help, thanks! TL;DR Am an avocational programmer looking for a language, want quick and straight forward development, liked vb6, will be working with database driven GUI apps- should I go with QtC++, Java, C#, or perhaps something else?

    Read the article

  • Rails: (Devise) Two different methods for new users?

    - by neezer
    I have a Rails 3 app with authentication setup using Devise with the registerable module enabled. I want to have new users who sign up using our outside register form to use the full Devise registerable module, which is happening now. However, I also want the admin user to be able to create new users directly, bypassing (I think) Devise's registerable module. With registerable disabled, my standard UsersController works as I want it to for the admin user, just like any other Rail scaffold. However, now new users can't register on their own. With registerable enabled, my standard UsersController is never called for the new user action (calling Devise::RegistrationsController instead), and my CRUD actions don't seem to work at all (I get dumped back onto my root page with no new user created and no flash message). Here's the log from the request: Started POST "/users" for 127.0.0.1 at 2010-12-20 11:49:31 -0500 Processing by Devise::RegistrationsController#create as HTML Parameters: {"utf8"=>"?", "authenticity_token"=>"18697r4syNNWHfMTkDCwcDYphjos+68rPFsaYKVjo8Y=", "user"=>{"email"=>"[email protected]", "password"=>"[FILTERED]", "password_confirmation"=>"[FILTERED]", "role"=>"manager"}, "commit"=>"Create User"} SQL (0.9ms) ... User Load (0.6ms) SELECT "users".* FROM "users" WHERE ("users"."id" = 2) LIMIT 1 SQL (0.9ms) ... Redirected to http://test-app.local/ Completed 302 Found in 192ms ... but I am able to register new users through the outside form. How can I get both of these methods to work together, such that my admin user can manually create new users and guest users can register on their own? I have my Users controller setup for standard CRUD: class UsersController < ApplicationController load_and_authorize_resource def index @users = User.where("id NOT IN (?)", current_user.id) # don't display the current user in the users list; go to account management to edit current user details end def new @user = User.new end def create @user = User.new(params[:user]) if @user.save flash[:notice] = "#{ @user.email } created." redirect_to users_path else render :action => 'new' end end def edit end def update params[:user].delete(:password) if params[:user][:password].blank? params[:user].delete(:password_confirmation) if params[:user][:password].blank? and params[:user][:password_confirmation].blank? if @user.update_attributes(params[:user]) flash[:notice] = "Successfully updated User." redirect_to users_path else render :action => 'edit' end end def delete end def destroy redirect_to users_path and return if params[:cancel] if @user.destroy flash[:notice] = "#{ @user.email } deleted." redirect_to users_path end end end And my routes setup as follows: TestApp::Application.routes.draw do devise_for :users devise_scope :user do get "/login", :to => "devise/sessions#new", :as => :new_user_session get "/logout", :to => "devise/sessions#destroy", :as => :destroy_user_session end resources :users do get :delete, :on => :member end authenticate :user do root :to => "application#index" end root :to => "devise/session#new" end

    Read the article

  • Merge entries in XMLfile (SimpleXML in PHP)

    - by Cudos
    Hello. I have this in my XML file: <product name="iphone"> <variant name="iphone" product_number="12345" price="500" picture="iphone.jpg"> <description><![CDATA[iphone]]></description> <short_description><![CDATA[]]></short_description> <deliverytime><![CDATA[]]></deliverytime> <options> <option group="Color" option="Black" /> </options> </variant> </product> <product name="iphone"> <variant name="iphone" product_number="12345" price="500" picture="iphone.jpg"> <description><![CDATA[iphone]]></description> <short_description><![CDATA[]]></short_description> <deliverytime><![CDATA[]]></deliverytime> <options> <option group="Color" option="White" /> </options> </variant> </product> I want to merge it into this (Note that I merge the options tag): <product name="iphone"> <variant name="iphone" product_number="12345" price="500" picture="iphone.jpg"> <description><![CDATA[iphone]]></description> <short_description><![CDATA[]]></short_description> <deliverytime><![CDATA[]]></deliverytime> <options> <option group="Color" option="Black" /> <option group="Color" option="White" /> </options> </variant> </product> Preferably I want to do it all in the memory since I will process it further afterwards.

    Read the article

  • nodejs async.waterfall method

    - by user1513388
    Update 2 Complete code listing var request = require('request'); var cache = require('memory-cache'); var async = require('async'); var server = '172.16.221.190' var user = 'admin' var password ='Passw0rd' var dn ='\\VE\\Policy\\Objects' var jsonpayload = {"Username": user, "Password": password} async.waterfall([ //Get the API Key function(callback){ request.post({uri: 'http://' + server +'/sdk/authorize/', json: jsonpayload, headers: {'content_type': 'application/json'} }, function (e, r, body) { callback(null, body.APIKey); }) }, //List the credential objects function(apikey, callback){ var jsonpayload2 = {"ObjectDN": dn, "Recursive": true} request.post({uri: 'http://' + server +'/sdk/Config/enumerate?apikey=' + apikey, json: jsonpayload2, headers: {'content_type': 'application/json'} }, function (e, r, body) { var dns = []; for (var i = 0; i < body.Objects.length; i++) { dns.push({'name': body.Objects[i].Name, 'dn': body.Objects[i].DN}) } callback(null, dns, apikey); }) }, function(dns, apikey, callback){ // console.log(dns) var cb = []; for (var i = 0; i < dns.length; i++) { //Retrieve the credential var jsonpayload3 = {"CredentialPath": dns[i].dn, "Pattern": null, "Recursive": false} console.log(dns[i].dn) request.post({uri: 'http://' + server +'/sdk/credentials/retrieve?apikey=' + apikey, json: jsonpayload3, headers: {'content_type': 'application/json'} }, function (e, r, body) { // console.log(body) cb.push({'cl': body.Classname}) callback(null, cb, apikey); console.log(cb) }); } } ], function (err, result) { // console.log(result) // result now equals 'done' }); Update: I'm building a small application that needs to make multiple HTTP calls to a an external API and amalgamates the results into a single object or array. e.g. Connect to endpoint and get auth key - pass auth key to step 2 Connect to endpoint using auth key and get JSON results - create an object containing summary results and pass to step 3. Iterate over passed object summary results and call API for each item in the object to get detailed information for each summary line Create a single JSON data structure that contains the summary and detail information. The original question below outlines what I've tried so far! Original Question: Will the async.waterfall method support multiple callbacks? i.e. Iterate over an array thats passed from a previous item in the chain, then invoke multiple http requests each of which would have their own callbacks. e.g, sync.waterfall([ function(dns, key, callback){ var cb = []; for (var i = 0; i < dns.length; i++) { //Retrieve the credential var jsonpayload3 = {"Cred": dns[i].DN, "Pattern": null, "Recursive": false} console.log(dns[i].DN) request.post({uri: 'http://' + vedserver +'/api/cred/retrieve?apikey=' + key, json: jsonpayload3, headers: {'content_type': 'application/json'} }, function (e, r, body) { console.log(body) cb.push({'cl': body.Classname}) callback(null, cb, key); }); } }

    Read the article

  • Is it Bad Practice to use C++ only for the STL containers?

    - by gmatt
    First a little background ... In what follows, I use C,C++ and Java for coding (general) algorithms, not gui's and fancy program's with interfaces, but simple command line algorithms and libraries. I started out learning about programming in Java. I got pretty good with Java and I learned to use the Java containers a lot as they tend to reduce complexity of book keeping while guaranteeing great performance. I intermittently used C++, but I was definitely not as good with it as with Java and it felt cumbersome. I did not know C++ enough to work in it without having to look up every single function and so I quickly reverted back to sticking to Java as much as possible. I then made a sudden transition into cracking and hacking in assembly language, because I felt I was concentrated too much attention on a much too high level language and I needed more experience with how a CPU interacts with memory and whats really going on with the 1's and 0's. I have to admit this was one of the most educational and fun experiences I've had with computers to date. For obviously reasons, I could not use assembly language to code on a daily basis, it was mostly reserved for fun diversions. After learning more about the computer through this experience I then realized that C++ is so much closer to the "level of 1's and 0's" than Java was, but I still felt it to be incredibly obtuse, like a swiss army knife with far too many gizmos to do any one task with elegance. I decided to give plain vanilla C a try, and I quickly fell in love. It was a happy medium between simplicity and enough "micromanagent" to not abstract what is really going on. However, I did miss one thing about Java: the containers. In particular, a simple container (like the stl vector) that expands dynamically in size is incredibly useful, but quite a pain to have to implement in C every time. Hence my code currently looks like almost entirely C with containers from C++ thrown in, the only feature I use from C++. I'd like to know if its consider okay in practice to use just one feature of C++, and ignore the rest in favor of C type code?

    Read the article

  • DataGridView live display of datatable using virtual mode

    - by Chris
    I have a DataGridView that will display records (log entries) from a database. The amount of records that can exist at a time is very large. I would like to use the virtual mode feature of the DataGridView to display a page of data, and to minimize the amount of data that has to be transferred across a network at a given time. Polling for data is out of the question. There will be several clients running at a time, all of which are on the same network and viewing the records. If they all poll for data, the network will run very slowly. The data is read-only to the user; they won't be able to edit any of it, just view it. I need to know when updates occur in the database, and I need to update the screen with those updates accordingly using virtual mode. If a page of data a user is viewing contains data that has change, he/she will see those updates on that page. If updates were made to data in the database, but not in the data the user is viewing, then not much really changes on the user screen (Maybe just the scroll bar if records were added or removed). My current approach is using SQL server change tracking with the sync framework. Each client has a local SQL Server CE instance and database file that is kept in sync with the main database server. I use the information from the synchronization event to see if any changes were made to the main database and were sync'ed to the client. I need to use the DataGridView virtual mode here because I can't have thousands of records loaded into the DataGridView at once, otherwise memory usage goes through the roof. The main challenge right now is knowing how to use virtual mode to provide a seamless experience to the user by allowing them to scroll up and down through the records, and also have records update on the fly without interfering with the user inappropriately. Has anybody dealt with this issue before, and if so, where I can see how they did it? I've gone through some of the MSDN documentation and examples on virtual mode. So far, I haven't found documentation and/or examples on their site that explains how to do what I am trying to accomplish.

    Read the article

  • how to add multiple filters to pagination?

    - by ClarkSKent
    Hey, I am trying to allow multiple filters to be selected for my pagination script. So in my pagination, when a user clicks the 'marketing' button(link) it queries the database just for the category that = marketing. The same goes for the other 2 filter buttons as seen in the script below. (automotive, sports). The problem is, I want to be able to select multiple filters like only marketing and auomotive or automotive and sports, for example if I click the marketing filter and then the automotive, it would display the categories that equal marketing, and automotive. I have no idea how to accomplish this, so I have come to the experts to help me out. This is the script I am working on (I am very new to PHP and programming in general): <h3>Filter results by:</h3> <a href='pagi_test.php?category=marketing'>marketing</a> <a href='pagi_test.php?category=automotive'>automotive</a> <a href='pagi_test.php?category=sports'>sports</a> <br /> <h3>Results:</h3> <?php //connecting to the database $error = "Could not connect to the database"; mysql_connect('localhost','root','root') or die($error); mysql_select_db('ajax_demo') or die($error); //max displayed per page $per_page = 3; //get start variable $start = $_GET['start']; $category = mysql_real_escape_string($_GET['category']); //count records $record_count = mysql_num_rows(mysql_query("SELECT * FROM explore WHERE category='$category'")); //count max pages $max_pages = $record_count / $per_page; //may come out as decimal if (!$start) $start = 0; //display data $get = mysql_query("SELECT * FROM explore WHERE category='$category' LIMIT $start, $per_page"); ?> <table width="800px"> <?php while ($row = mysql_fetch_assoc($get)) { // get data $id = $row['id']; $site_name = $row['site_name']; $site_description = $row['site_description']; ?> <tr> <td><?php echo $id; ?></td> <td><?php echo $site_name; ?></td> <td><?php echo $site_description; ?></td> </tr> <?php } //setup prev and next variables $prev = $start - $per_page; $next = $start + $per_page; //show prev button if (!($start<=0)) echo "<a href='pagi_test.php?category=$category&start=$prev'>Prev</a> "; //show page numbers //set variable for first page $i=1; for ($x=0;$x<$record_count;$x=$x+$per_page) { if ($start!=$x) echo " <a href='pagi_test.php?category=$category&start=$x'>$i</a> "; else echo " <a href='pagi_test.php?category=$category&start=$x'><b>$i</b></a> "; $i++; } //show next button if (!($start>=$record_count-$per_page)) echo " <a href='pagi_test.php?category=$category&start=$next'>Next</a>"; ?>

    Read the article

  • ASA 5540 v8.4(3) vpn to ASA 5505 v8.2(5), tunnel up but I cant ping from 5505 to IP on other side

    - by user223833
    I am having problems pinging from a 5505(remote) to IP 10.160.70.10 in the network behind the 5540(HQ side). 5505 inside IP: 10.56.0.1 Out: 71.43.109.226 5540 Inside: 10.1.0.8 out: 64.129.214.27 I Can ping from 5540 to 5505 inside 10.56.0.1. I also ran ASDM packet tracer in both directions, it is ok from 5540 to 5505, but drops the packet from 5505 to 5540. It gets through the ACL and dies at the NAT. Here is the 5505 config, I am sure it is something simple I am missing. ASA Version 8.2(5) ! hostname ASA-CITYSOUTHDEPOT domain-name rngint.net names ! interface Ethernet0/0 switchport access vlan 2 ! interface Ethernet0/1 ! interface Ethernet0/2 ! interface Ethernet0/3 ! interface Ethernet0/4 ! interface Ethernet0/5 ! interface Ethernet0/6 ! interface Ethernet0/7 ! interface Vlan1 nameif inside security-level 100 ip address 10.56.0.1 255.255.0.0 ! interface Vlan2 nameif outside security-level 0 ip address 71.43.109.226 255.255.255.252 ! banner motd ***ASA-CITYSOUTHDEPOT*** banner asdm CITY SOUTH DEPOT ASA5505 ftp mode passive clock timezone EST -5 clock summer-time EDT recurring dns server-group DefaultDNS domain-name rngint.net access-list outside_1_cryptomap extended permit ip host 71.43.109.226 host 10.1.0.125 access-list outside_1_cryptomap extended permit ip 10.56.0.0 255.255.0.0 10.0.0.0 255.0.0.0 access-list outside_1_cryptomap extended permit ip 10.56.0.0 255.255.0.0 10.106.70.0 255.255.255.0 access-list outside_1_cryptomap extended permit ip 10.56.0.0 255.255.0.0 10.106.130.0 255.255.255.0 access-list outside_1_cryptomap extended permit ip host 71.43.109.226 host 10.160.70.10 access-list inside_nat0_outbound extended permit ip host 71.43.109.226 host 10.1.0.125 access-list inside_nat0_outbound extended permit ip 10.56.0.0 255.255.0.0 10.0.0.0 255.0.0.0 access-list inside_nat0_outbound extended permit ip 10.56.0.0 255.255.0.0 10.106.130.0 255.255.255.0 access-list inside_nat0_outbound extended permit ip 10.56.0.0 255.255.0.0 10.106.70.0 255.255.255.0 access-list inside_nat0_outbound extended permit ip host 71.43.109.226 10.106.70.0 255.255.255.0 pager lines 24 logging enable logging buffer-size 25000 logging buffered informational logging asdm warnings mtu inside 1500 mtu outside 1500 icmp unreachable rate-limit 1 burst-size 1 icmp permit any inside no asdm history enable arp timeout 14400 global (outside) 1 interface nat (inside) 0 access-list inside_nat0_outbound nat (inside) 1 0.0.0.0 0.0.0.0 route outside 0.0.0.0 0.0.0.0 71.43.109.225 1 timeout xlate 3:00:00 timeout conn 1:00:00 half-closed 0:10:00 udp 0:02:00 icmp 0:00:02 timeout sunrpc 0:10:00 h323 0:05:00 h225 1:00:00 mgcp 0:05:00 mgcp-pat 0:05:00 timeout sip 0:30:00 sip_media 0:02:00 sip-invite 0:03:00 sip-disconnect 0:02:00 timeout sip-provisional-media 0:02:00 uauth 0:05:00 absolute timeout tcp-proxy-reassembly 0:01:00 timeout floating-conn 0:00:00 dynamic-access-policy-record DfltAccessPolicy aaa-server TACACS+ protocol tacacs+ aaa-server TACACS+ (inside) host 10.106.70.36 key ***** aaa authentication http console LOCAL aaa authentication ssh console LOCAL aaa authorization exec authentication-server http server enable http 192.168.1.0 255.255.255.0 inside http 10.0.0.0 255.0.0.0 inside http 0.0.0.0 0.0.0.0 outside snmp-server host inside 10.106.70.7 community ***** no snmp-server location no snmp-server contact snmp-server community ***** snmp-server enable traps snmp authentication linkup linkdown coldstart crypto ipsec transform-set ESP-3DES-SHA esp-3des esp-sha-hmac crypto ipsec transform-set ESP-AES-128-SHA esp-aes esp-sha-hmac crypto ipsec transform-set ESP-AES-128-MD5 esp-aes esp-md5-hmac crypto ipsec transform-set ESP-AES-192-SHA esp-aes-192 esp-sha-hmac crypto ipsec transform-set ESP-AES-192-MD5 esp-aes-192 esp-md5-hmac crypto ipsec transform-set ESP-AES-256-SHA esp-aes-256 esp-sha-hmac crypto ipsec transform-set ESP-AES-256-MD5 esp-aes-256 esp-md5-hmac crypto ipsec transform-set ESP-3DES-MD5 esp-3des esp-md5-hmac crypto ipsec transform-set ESP-DES-SHA esp-des esp-sha-hmac crypto ipsec transform-set ESP-DES-MD5 esp-des esp-md5-hmac crypto ipsec security-association lifetime seconds 28800 crypto ipsec security-association lifetime kilobytes 4608000 crypto map outside_map 1 match address outside_1_cryptomap crypto map outside_map 1 set pfs group1 crypto map outside_map 1 set peer 64.129.214.27 crypto map outside_map 1 set transform-set ESP-3DES-SHA crypto map outside_map interface outside crypto isakmp enable outside crypto isakmp policy 1 authentication pre-share encryption des hash md5 group 2 lifetime 86400 telnet timeout 5 ssh 10.0.0.0 255.0.0.0 inside ssh 0.0.0.0 0.0.0.0 outside ssh timeout 5 console timeout 0 management-access inside dhcpd auto_config outside ! dhcpd address 10.56.0.100-10.56.0.121 inside dhcpd dns 10.1.0.125 interface inside dhcpd auto_config outside interface inside ! dhcprelay server 10.1.0.125 outside dhcprelay enable inside dhcprelay setroute inside dhcprelay timeout 60 threat-detection basic-threat threat-detection statistics access-list no threat-detection statistics tcp-intercept tftp-server inside 10.1.1.25 CITYSOUTHDEPOT-ASA-Confg webvpn tunnel-group 64.129.214.27 type ipsec-l2l tunnel-group 64.129.214.27 ipsec-attributes pre-shared-key ***** ! ! prompt hostname context

    Read the article

  • ANSI C as core of a C# project? Is this possible?

    - by Nektarios
    I'm writing a NON-GUI app which I want to be cross platform between OS X and Windows. I'm looking at the following architecture, but I don't know if it will work on the windows side: (Platform specific entry point) - ANSI C main loop = ANSI C model code doing data processing / logic = (Platform specific helpers) So the core stuff I'm planning to write in regular ANSI C, because A) it should be platform independent, B) I'm extremely comfortable with C, C) It can do the job and do it well (Platform specific entry point) can be written in whatever necessary to get the job done, this is a small amount of code, doesn't matter to me. (Platform specific helpers) is the sticky thing. This is stuff like parsing XML, accessing databases, graphics toolkit stuff, whatever. Things that aren't easy in C. Things that modern languages/frameworks will give for free. On OS X this code will be written in Objective-C interfacing with Cocoa. On Windows I'm thinking my best bet is to use C# So on Windows my architecture (simplified) looks like (C# or C?) - ANSI C - C# Is this possible? Some thoughts/suggestions so far.. 1) Compile my C core as a .dll -- this is fine, but seems there's no way to call my C# helpers unless I can somehow get function pointers and pass them to my core, but that seems unlikely 2) Compile a C .exe and a C# .exe and have them talk via shared memory or some kind of IPC. I'm not entirely opposed to this but it obviously introduces a lot of complexity so it doesn't seem ideal 3) Instead of C# use C++, it gets me some nice data management stuff and nice helper code. And I can mix it pretty easily. And the work I do could probably easily port to Linux. But I really don't like C++, and I don't want this to turn in to a 3rd-party-library-fest. Not that it's a huge deal, but it's 2010.. anything for basic data management should be built in. And targetting Linux is really not a priority. Note that no "total" alternatives are OK as suggested in other similar questions on SO I've seen; java, RealBasic, mono.. this is an extremely performance intensive application doing soft realtime for game/simulation purposes, I need C & friends here to do it right (maybe you don't, but I do)

    Read the article

  • [N]Hibernate: view-like fetching properties of associated class

    - by chiccodoro
    (Felt quite helpless in formulating an appropriate title...) In my C# app I display a list of "A" objects, along with some properties of their associated "B" objects and properties of B's associated "C" objects: A.Name B.Name B.SomeValue C.Name Foo Bar 123 HelloWorld Bar Hello 432 World ... To clarify: A has an FK to B, B has an FK to C. (Such as, e.g. BankAccount - Person - Company). I have tried two approaches to load these properties from the database (using NHibernate): A fast approach and a clean approach. My eventual question is how to do a fast & clean approach. Fast approach: Define a view in the database which joins A, B, C and provides all these fields. In the A class, define properties "BName", "BSomeValue", "CName" Define a hibernate mapping between A and the View, whereas the needed B and C properties are mapped with update="false" insert="false" and do actually stem from B and C tables, but Hibernate is not aware of that since it uses the view. This way, the listing only loads one object per "A" record, which is quite fast. If the code tries to access the actual associated property, "A.B", I issue another HQL query to get B, set the property and update the faked BName and BSomeValue properties as well. Clean approach: There is no view. Class A is mapped to table A, B to B, C to C. When loading the list of A, I do a double left-join-fetch to get B and C as well: from A a left join fetch a.B left join fetch a.B.C B.Name, B.SomeValue and C.Name are accessed through the eagerly loaded associations. The disadvantage of this approach is that it gets slower and takes more memory, since it needs to created and map 3 objects per "A" record: An A, B, and C object each. Fast and clean approach: I feel somehow uncomfortable using a database view that hides a join and treat that in NHibernate as if it was a table. So I would like to do something like: Have no views in the database. Declare properties "BName", "BSomeValue", "CName" in class "A". Define the mapping for A such that NHibernate fetches A and these properties together using a join SQL query as a database view would do. The mapping should still allow for defining lazy many-to-one associations for getting A.B.C My questions: Is this possible? Is it [un]artful? Is there a better way?

    Read the article

  • A case-insensitive related implementation problem

    - by Robert
    Hi All, I am going through a final refinement posted by the client, which needs me to do a case-insesitive query. I will basically walk through how this simple program works. First of all, in my Java class, I did a fairly simple webpage parsing: title=(String)results.get("title"); doc = docBuilder.parse("http://" + server + ":" + port + "/exist/rest/db/wb/xql/media_lookup.xql?" + "&title=" + title); This Java statement references an XQuery file "media_lookup.xql" which is stored on localhost, and the only parameter we are passing is the string "title". Secondly, let's take at look at that XQuery file: $title := request:get-parameter('title',""), $mediaNodes := doc('/db/wb/portfolio/media_data.xml'), $query := $mediaNodes//media[contains(title,$title)], Then it will evaluate that query. This XQuery will get the "title" parameter that are passes from our Java class, and query the "media_data" xml file stored in the database, which contains a bunch of media nodes with a 'title' element node. As you may expect, this simple query will just match those media nodes whose 'title' element contains a substring of what the value of string 'title' is. So if our 'title' is "Chi", it will return media nodes whose title may be "Chicago" or "Chicken". The refinment request posted by the client is that there should be NO case-sensitivity. The very intuitive way is to modify the XQuery statement by using a lower-case funtion in it, like: $query := $mediaNodes//media[contains(lower-case(title/text(),lower-case($title))], However, the question comes: this modified query will run my machine into memory overflow. Since my "media_data.xml" is quite huge and contains thouands of millions of media nodes, I assume the lower-case() function will run on each of the entries, thus causing the machine to crash. I've talked with some experienced XQuery programmer, and they think I should use an index to solve this problem, and I will definitely research into that. But before that, I am just posting this problem here to get other ideas or any suggestions, do you think any other way may help? for example, could I tweak the Java parse statement to realize the case-insensitivity? Since I think I saw some people did some string concatination by using "contains." in Java before passing it to the server. Any idea or help is welcomed, thanks in advance.

    Read the article

  • C - How to use both aio_read() and aio_write().

    - by Slav
    I implement game server where I need to both read and write. So I accept incoming connection and start reading from it using aio_read() but when I need to send something, I stop reading using aio_cancel() and then use aio_write(). Within write's callback I resume reading. So, I do read all the time but when I need to send something - I pause reading. It works for ~20% of time - in other case call to aio_cancel() fails with "Operation now in progress" - and I cannot cancel it (even within permanent while cycle). So, my added write operation never happens. How to use these functions well? What did I missed? EDIT: Used under Linux 2.6.35. Ubuntu 10 - 32 bit. Example code: void handle_read(union sigval sigev_value) { /* handle data or disconnection */ } void handle_write(union sigval sigev_value) { /* free writing buffer memory */ } void start() { const int acceptorSocket = socket(AF_INET, SOCK_STREAM, 0); struct sockaddr_in addr; memset(&addr, 0, sizeof(struct sockaddr_in)); addr.sin_family = AF_INET; addr.sin_addr.s_addr = INADDR_ANY; addr.sin_port = htons(port); bind(acceptorSocket, (struct sockaddr*)&addr, sizeof(struct sockaddr_in)); listen(acceptorSocket, SOMAXCONN); struct sockaddr_in address; socklen_t addressLen = sizeof(struct sockaddr_in); for(;;) { const int incomingSocket = accept(acceptorSocket, (struct sockaddr*)&address, &addressLen); if(incomingSocket == -1) { /* handle error ... */} else { //say socket to append outcoming messages at writing: const int currentFlags = fcntl(incomingSocket, F_GETFL, 0); if(currentFlags < 0) { /* handle error ... */ } if(fcntl(incomingSocket, F_SETFL, currentFlags | O_APPEND) == -1) { /* handle another error ... */ } //start reading: struct aiocb* readingAiocb = new struct aiocb; memset(readingAiocb, 0, sizeof(struct aiocb)); readingAiocb->aio_nbytes = MY_SOME_BUFFER_SIZE; readingAiocb->aio_fildes = socketDesc; readingAiocb->aio_buf = mySomeReadBuffer; readingAiocb->aio_sigevent.sigev_notify = SIGEV_THREAD; readingAiocb->aio_sigevent.sigev_value.sival_ptr = (void*)mySomeData; readingAiocb->aio_sigevent.sigev_notify_function = handle_read; if(aio_read(readingAiocb) != 0) { /* handle error ... */ } } } } //called at any time from server side: send(void* data, const size_t dataLength) { //... some thread-safety precautions not needed here ... const int cancellingResult = aio_cancel(socketDesc, readingAiocb); if(cancellingResult != AIO_CANCELED) { //this one happens ~80% of the time - embracing previous call to permanent while cycle does not help: if(cancellingResult == AIO_NOTCANCELED) { puts(strerror(aio_return(readingAiocb))); // "Operation now in progress" /* don't know what to do... */ } } //otherwise it's okay to send: else { aio_write(...); } }

    Read the article

< Previous Page | 633 634 635 636 637 638 639 640 641 642 643 644  | Next Page >