Search Results

Search found 16838 results on 674 pages for 'writing patterns dita cms'.

Page 637/674 | < Previous Page | 633 634 635 636 637 638 639 640 641 642 643 644  | Next Page >

  • How to change button's image in visual c++ at run time?

    - by karikari
    After trying and error for many times, I decided to ask here. My objective is I wanted to change the feature of my IE toolbar button. The button is firstly setup by IE at IE startup using the function CRebarHandler::onSetRedraw and CRebarHandler::setButtonMenu2(). And then, I create a call from another cpp file, to call CRebarHandler::setButtonMenu2(). I intent to change just the button's image. I assigned the ID of the image correctly. But somehow it does not work. When I put other code inside this function,like a code for writing to file, it is proven work. Means, it is properly being called from the other file. But the thing is, the code for the button inside CRebarHandler::setButtonMenu2() seems does not work. Need help. Here is the code I am working on (I modify John Lister's button code): LRESULT CRebarHandler::onSetRedraw(UINT uMsg, WPARAM wParam, LPARAM lParam, BOOL& bHandled){ bHandled=false; if (m_ieVer==6){ if (!m_hWndToolbar) scanForToolbarSlow(); if (m_hWndToolbar){ findButton(m_hWndToolbar); if (m_buttonID>0) setButtonMenu(); } } return S_OK; } void CRebarHandler::setButtonMenu(){ HIMAGELIST hImageList = ImageList_Create(32, 32,ILC_COLOR16 | ILC_MASK,1, 0); HINSTANCE module = _AtlBaseModule.GetResourceInstance(); TBBUTTONINFO inf; inf.cbSize=sizeof(inf); inf.dwMask = TBIF_IMAGE; char psBuffer[128]; FILE *pPipe; float f = 0; pPipe = _popen("javaw -jar c:\\simmetrics.jar c:\\chtml.txt c:\\thtml.txt", "rt" ); char* p = fgets(psBuffer, 128, pPipe); std::istringstream iss(p); iss >> f; if (f > 0.9) { inf.iImage = 1; SendMessage(m_hWndToolbar, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); iss.clear(); f = 0; } else { inf.iImage = 2; SendMessage(m_hWndToolbar, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); iss.clear(); f = 0; } iss.clear(); f = 0; } void CRebarHandler::setButtonMenu2(){ TBBUTTONINFO inf; inf.cbSize=sizeof(inf); inf.dwMask = TBIF_IMAGE; inf.iImage = 1; //green SendMessage(NULL, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); }

    Read the article

  • Implementing Skip List in C++

    - by trikker
    [SOLVED] So I decided to try and create a sorted doubly linked skip list... I'm pretty sure I have a good grasp of how it works. When you insert x the program searches the base list for the appropriate place to put x (since it is sorted), (conceptually) flips a coin, and if the "coin" lands on a then that element is added to the list above it(or a new list is created with element in it), linked to the element below it, and the coin is flipped again, etc. If the "coin" lands on b at anytime then the insertion is over. You must also have a -infinite stored in every list as the starting point so that it isn't possible to insert a value that is less than the starting point (meaning that it could never be found.) To search for x, you start at the "top-left" (highest list lowest value) and "move right" to the next element. If the value is less than x than you continue to the next element, etc. until you have "gone too far" and the value is greater than x. In this case you go back to the last element and move down a level, continuing this chain until you either find x or x is never found. To delete x you simply search x and delete it every time it comes up in the lists. For now, I'm simply going to make a skip list that stores numbers. I don't think there is anything in the STL that can assist me, so I will need to create a class List that holds an integer value and has member functions, search, delete, and insert. The problem I'm having is dealing with links. I'm pretty sure I could create a class to handle the "horizontal" links with a pointer to the previous element and the element in front, but I'm not sure how to deal with the "vertical" links (point to corresponding element in other list?) If any of my logic is flawed please tell me, but my main questions are: How to deal with vertical links and whether my link idea is correct Now that I read my class List idea I'm thinking that a List should hold a vector of integers rather than a single integer. In fact I'm pretty positive, but would just like some validation. I'm assuming the coin flip would simply call int function where rand()%2 returns a value of 0 or 1 and if it's 0 then a the value "levels up" and if it's 0 then the insert is over. Is this incorrect? How to store a value similar to -infinite? Edit: I've started writing some code and am considering how to handle the List constructor....I'm guessing that on its construction, the "-infinite" value should be stored in the vectorname[0] element and I can just call insert on it after its creation to put the x in the appropriate place.

    Read the article

  • error with passing my object with serializable?

    - by Jony Scherman
    i was trying to send my object class GastronomyElement to another activity but i have got this error java.lang.RuntimeException: Parcelable encountered IOException writing serializable object (name = com.example.despegarteproject.classes.GastronomyElement) i have seen another posts like this but i couldn not solve it. this is my class code public class GastronomyElement implements Serializable { String id, name, formattedAddress, formattedPhoneNumber, reference, photo; List<String> photos; Boolean openNow; Horarios horarios; List<Review> reviews; String priceLevel; double latitude, longitude; Double rating; public String getName () { return name; } public void setName (String name) { this.name = name; } public String getId () { return id; } public void setId (String id) { this.id = id; } public String getFormattedAddress () { return formattedAddress; } public void setFormattedAddress (String formattedAddress) { this.formattedAddress = formattedAddress; } public String getReference () { return reference; } public void setReference (String reference) { this.reference = reference; } public String getPhoto () { return photo; } public void setPhoto (String photo) { this.photo = photo; } public List<String> getPhotos () { return photos; } public void setPhotos (List<String> photos) { this.photos = photos; } public double getLatitude() { return latitude; } public void setLatitude (double latitude) { this.latitude = latitude; } public double getLongitude() { return longitude; } public void setLongitude (double longitude) { this.longitude = longitude; } public Double getRating () { return rating; } public void setRating (Double rating) { this.rating = rating; } public Boolean getOpenNow () { return openNow; } public void setOpenNow (Boolean openNow) { this.openNow = openNow; } public Horarios getHorarios () { return horarios; } public void setHorarios (Horarios horarios) { this.horarios = horarios; } public String getPriceLevel () { return priceLevel; } public void setPriceLevel (String priceLevel) { this.priceLevel = priceLevel; } public String getFormattedPhoneNumber () { return formattedPhoneNumber; } public void setFormattedPhoneNumber (String formattedPhoneNumber) { this.formattedPhoneNumber = formattedPhoneNumber; } public List<Review> getReviews () { return reviews; } public void setReviews (List<Review> reviews) { this.reviews = reviews; } } and this is how i am sending it Intent act = new Intent (context, ActivityLugarDetalles.class); act.putExtra("elementDetails", elementDetails); startActivity(act); i would appreciate your help! thank you!

    Read the article

  • Modify audio pitch of recorded clip (m4v)

    - by devcube
    I'm writing an app in which I'm trying to change the pitch of the audio when I'm recording a movie (.m4v). Or by modifying the audio pitch of the movie afterwards. I want the end result to be a movie (.m4v) that has the original length (i.e. same visual as original) but with modified sound pitch, e.g. a "chipmunk voice". A realtime conversion is to prefer if possible. I've read alot about changing audio pitch in iOS but most examples focus on playback, i.e. playing the sound with a different pitch. In my app I'm recording a movie (.m4v / AVFileTypeQuickTimeMovie) and saving it using standard AVAssetWriter. When saving the movie I have access to the following elements where I've tried to manipulate the audio (e.g. modify the pitch): audio buffer (CMSampleBufferRef) audio input writer (AVAssetWriterAudioInput) audio input writer options (e.g. AVNumberOfChannelsKey, AVSampleRateKey, AVChannelLayoutKey) asset writer (AVAssetWriter) I've tried to hook into the above objects to modify the audio pitch, but without success. I've also tried with Dirac as described here: Real Time Pitch Change In iPhone Using Dirac And OpenAL with AL_PITCH as described here: Piping output from OpenAL into a buffer And the "BASS" library from un4seen: Change Pitch/Tempo In Realtime I haven't found success with any of the above libs, most likely because I don't really know how to use them, and where to hook them into the audio saving code. There seems to be alot of librarys that have similar effects but focuses on playback or custom recording code. I want to manipulate the audio stream I've already got (AVAssetWriterAudioInput) or modify the saved movie clip (.m4v). I want the video to be unmodifed visually, i.e. played at the same speed. But I want the audio to go faster (like a chipmunk) or slower (like a ... monster? :)). Do you have any suggestions how I can modify the pitch in either real time (when recording the movie) or afterwards by converting the entire movie (.m4v file)? Should I look further into Dirac, OpenAL, SoundTouch, BASS or some other library? I want to be able to share the movie to others with modified audio, that's the reason I can't rely on modifying the pitch for playback only. Any help is appreciated, thanks!

    Read the article

  • Should I skip authorization, with CanCan, of an action that instantiates a resource?

    - by irkenInvader
    I am writing a web app to pick random lists of cards from larger, complete sets of cards. I have a Card model and a CardSet model. Both models have a full RESTful set of 7 actions (:index, :new, :show, etc). The CardSetsController has an extra action for creating random sets: :random. # app/models/card_set.rb class CardSet < ActiveRecord::Base belongs_to :creator, :class_name => "User" has_many :memberships has_many :cards, :through => :memberships # app/models/card.rb class Card < ActiveRecord::Base belongs_to :creator, :class_name => "User" has_many :memberships has_many :card_sets, :through => :memberships I have added Devise for authentication and CanCan for authorizations. I have users with an 'editor' role. Editors are allowed to create new CardSets. Guest users (Users who have not logged in) can only use the :index and :show actions. These authorizations are working as designed. Editors can currently use both the :random and the :new actions without any problems. Guest users, as expected, cannot. # app/controllers/card_sets_controller.rb class CardSetsController < ApplicationController before_filter :authenticate_user!, :except => [:show, :index] load_and_authorize_resource I want to allow guest users to use the :random action, but not the :new action. In other words, they can see new random sets, but not save them. The "Save" button on the :random action's view is hidden (as designed) from the guest users. The problem is, the first thing the :random action does is build a new instance of the CardSet model to fill out the view. When cancan tries to load_and_authorize_resource a new CardSet, it throws a CanCan::AccessDenied exception. Therefore, the view never loads and the guest user is served a "You need to sign in or sign up before continuing" message. # app/controllers/card_sets_controllers.rb def random @card_set = CardSet.new( :name => "New Set of 10", :set_type => "Set of 10" ) I realize that I can tell load_and_authorize_resource to skip the :random action by passing :except => :random to the call, but that just feels "wrong" for some reason. What's the "right" way to do this? Should I create the new random set without instantiating a new CardSet? Should I go ahead and add the exception?

    Read the article

  • Basic shared memory program in C

    - by nicopuri
    Hi, I want to make a basic chat application in C using Shared memory. I am working in Linux. The application consist in writing the client and the server can read, and if the server write the client can read the message. I tried to do this, but I can't achieve the communication between client and server. The code is the following: Server.c int main(int argc, char **argv) { char *msg; static char buf[SIZE]; int n; msg = getmem(); memset(msg, 0, SIZE); initmutex(); while ( true ) { if( (n = read(0, buf, sizeof buf)) 0 ) { enter(); sprintf(msg, "%.*s", n, buf); printf("Servidor escribe: %s", msg); leave(); }else{ enter(); if ( strcmp(buf, msg) ) { printf("Servidor lee: %s", msg); strcpy(buf, msg); } leave(); sleep(1); } } return 0; } Client.c int main(int argc, char **argv) { char *msg; static char buf[SIZE-1]; int n; msg = getmem(); initmutex(); while(true) { if ( (n = read(0, buf, sizeof buf)) 0 ) { enter(); sprintf(msg, "%.*s", n, buf); printf("Cliente escribe: %s", msg); leave(); }else{ enter(); if ( strcmp(buf, msg) ) { printf("Cliente lee: %s", msg); strcpy(buf, msg); } leave(); sleep(1); } } printf("Cliente termina\n"); return 0; } The shared memory module is the folowing: #include "common.h" void fatal(char *s) { perror(s); exit(1); } char * getmem(void) { int fd; char *mem; if ( (fd = shm_open("/message", O_RDWR|O_CREAT, 0666)) == -1 ) fatal("sh_open"); ftruncate(fd, SIZE); if ( !(mem = mmap(NULL, SIZE, PROT_READ|PROT_WRITE, MAP_SHARED, fd, 0)) ) fatal("mmap"); close(fd); return mem; } static sem_t *sd; void initmutex(void) { if ( !(sd = sem_open("/mutex", O_RDWR|O_CREAT, 0666, 1)) ) fatal("sem_open"); } void enter(void) { sem_wait(sd); } void leave(void) { sem_post(sd); }

    Read the article

  • Parsing XML wont display all items.

    - by Nauman A
    I have this code but the toast wont display any message what is wrong with my code.. I can get the value from link, linknext but title wont bring out any value. ( I am not very bright with writing code so please suggest anything you may feel like. final Button button = (Button) findViewById(R.id.Button01); button.setOnClickListener(new View.OnClickListener() { public void onClick(View v) { // Perform action on click try { URL url = new URL( "http://somelink.com=" + Link.setFirst_link); DocumentBuilderFactory dbf = DocumentBuilderFactory.newInstance(); DocumentBuilder db = dbf.newDocumentBuilder(); Document doc = db.parse(new InputSource(url.openStream())); doc.getDocumentElement().normalize(); NodeList nodeList = doc.getElementsByTagName("item"); /** Assign textview array lenght by arraylist size */ for (int i = 0; i < nodeList.getLength(); i++) { Node node = nodeList.item(i); Element fstElmnt = (Element) node; NodeList nameList = fstElmnt.getElementsByTagName("link"); Element nameElement = (Element) nameList.item(0); nameList = nameElement.getChildNodes(); String img = (((Node) nameList.item(0)).getNodeValue()); NodeList websiteList = fstElmnt.getElementsByTagName("linknext"); Element websiteElement = (Element) websiteList.item(0); websiteList = websiteElement.getChildNodes(); String nextlink = (((Node) websiteList.item(0)).getNodeValue()); Link.setFirst_link = nextlink; Drawable drawable = LoadImageFromWebOperations(img); imgView.setImageDrawable(drawable); NodeList titleList = fstElmnt.getElementsByTagName("title"); Element titleElement = (Element) titleList.item(0); websiteList = titleElement.getChildNodes(); String title = (((Node) titleList.item(0)).getNodeValue()); Context context = getApplicationContext(); CharSequence text = title; int duration = Toast.LENGTH_SHORT; Toast toast = Toast.makeText(context, text, duration); toast.show(); } } catch (Exception e) { System.out.println("XML Pasing Excpetion = " + e); } } }); /** Set the layout view to display */ } Here is the xml file <?xml version="1.0"?> <maintag> <item> <link>http://image.com/357769.jpg?40</link> <linknext>http://www.image.com</linknext> <title>imagename</title> </item> </maintag>

    Read the article

  • Bad_alloc exception when using new for a struct c++

    - by bsg
    Hi, I am writing a query processor which allocates large amounts of memory and tries to find matching documents. Whenever I find a match, I create a structure to hold two variables describing the document and add it to a priority queue. Since there is no way of knowing how many times I will do this, I tried creating my structs dynamically using new. When I pop a struct off the priority queue, the queue (STL priority queue implementation) is supposed to call the object's destructor. My struct code has no destructor, so I assume a default destructor is called in that case. However, the very first time that I try to create a DOC struct, I get the following error: Unhandled exception at 0x7c812afb in QueryProcessor.exe: Microsoft C++ exception: std::bad_alloc at memory location 0x0012f5dc.. I don't understand what's happening - have I used up so much memory that the heap is full? It doesn't seem likely. And it's not as if I've even used that pointer before. So: first of all, what am I doing that's causing the error, and secondly, will the following code work more than once? Do I need to have a separate pointer for each struct created, or can I re-use the same temporary pointer and assume that the queue will keep a pointer to each struct? Here is my code: struct DOC{ int docid; double rank; public: DOC() { docid = 0; rank = 0.0; } DOC(int num, double ranking) { docid = num; rank = ranking; } bool operator>( const DOC & d ) const { return rank > d.rank; } bool operator<( const DOC & d ) const { return rank < d.rank; } }; //a lot of processing goes on here; when a matching document is found, I do this: rank = calculateRanking(table, num); //if the heap is not full, create a DOC struct with the docid and rank and add it to the heap if(q.size() < 20) { doc = new DOC(num, rank); q.push(*doc); doc = NULL; } //if the heap is full, but the new rank is greater than the //smallest element in the min heap, remove the current smallest element //and add the new one to the heap else if(rank > q.top().rank) { q.pop(); cout << "pushing doc on to queue" << endl; doc = new DOC(num, rank); q.push(*doc); } Thank you very much, bsg.

    Read the article

  • Methodology for a Rails app

    - by Aaron Vegh
    I'm undertaking a rather large conversion from a legacy database-driven Windows app to a Rails app. Because of the large number of forms and database tables involved, I want to make sure I've got the right methodology before getting too far. My chief concern is minimizing the amount of code I have to write. There are many models that interact together, and I want to make sure I'm using them correctly. Here's a simplified set of models: class Patient < ActiveRecord::Base has_many :PatientAddresses has_many :PatientFileStatuses end class PatientAddress < ActiveRecord::Base belongs_to :Patient end class PatientFileStatus < ActiveRecord::Base belongs_to :Patient end The controller determines if there's a Patient selected; everything else is based on that. In the view, I will be needing data from each of these models. But it seems like I have to write an instance variable in my controller for every attribute that I want to use. So I start writing code like this: @patient = Patient.find(session[:patient]) @patient_addresses = @patient.PatientAddresses @patient_file_statuses = @patient.PatientFileStatuses @enrollment_received_when = @patient_file_statuses[0].EnrollmentReceivedWhen @consent_received = @patient_file_statuses[0].ConsentReceived @consent_received_when = @patient_file_statuses[0].ConsentReceivedWhen The first three lines grab the Patient model and its relations. The next three lines are examples of my providing values to the view from one of those relations. The view has a combination of text fields and select fields to show the data above. For example: <%= select("patientfilestatus", "ConsentReceived", {"val1"="val1", "val2"="val2", "Written"="Written"}, :include_blank=true )% <%= calendar_date_select_tag "patient_file_statuses[EnrollmentReceivedWhen]", @enrollment_complete_when, :popup=:force % (BTW, the select tag isn't really working; I think I have to use collection_select?) My questions are: Do I have to manually declare the value of every instance variable in the controller, or can/should I do it within the view? What is the proper technique for displaying a select tag for data that's not the primary model? When I go to save changes to this form, will I have to manually pick out the attributes for each model and save them individually? Or is there a way to name the fields such that ActiveRecord does the right thing? Thanks in advance, Aaron.

    Read the article

  • Mercurial local repository backup

    - by Ricket
    I'm a big fan of backing things up. I keep my important school essays and such in a folder of my Dropbox. I make sure that all of my photos are duplicated to an external drive. I have a home server where I keep important files mirrored across two drives inside the server (like a software RAID 1). So for my code, I have always used Subversion to back it up. I keep the trunk folder with a stable copy of my application, but then I create a branch named with my username, and inside there is my working copy. I make very few changes between commits to that branch, with the understanding that the code in there is my backup. Now I'm looking into Mercurial, and I must admit I haven't truly used it yet so I may have this all wrong. But it seems to me that you have a server-side repository, and then you clone it to a working directory in the form of a local repository. Then as you work on something, you make commits to that local repository, and when things are in a state to be shared with others, you hg push to the parent repository on the server. Between pushes of stable, tested, bug-free code, where is the backup? After doing some thinking, I've come to the conclusion that it is not meant for backup purposes and it assumes you've handled that on your own. I guess I need to keep my Mercurial local repositories in my dropbox or some other backed-up location, since my in-progress code is not pushed to the server. Is this pretty much it, or have I missed something? If you use Mercurial, how do you backup your local repositories? If you had turned on your computer this morning and your hard drive went up in flames (or, more likely, the read head went bad, or the OS corrupted itself, ...), what would be lost? If you spent the past week developing a module, writing test cases for it, documenting and commenting it, and then a virus wipes your local repository away, isn't that the only copy? So then on the flip side, do you create a remote repository for every local repository and push to it all the time? How do you find a balance? How do you ensure your code is backed up? Where is the line between using Mercurial as backup, and using a local filesystem backup utility to keep your local repositories safe?

    Read the article

  • ActionResult - Service

    - by cem
    I bored, writing same code for service and ui. Then i tried to write a converter for simple actions. This converter, converting Service Results to MVC result, seems like good solution for me but anyway i think this gonna opposite MVC pattern. So here, I need help, what you think about algorithm - is this good or not? Thanks ServiceResult - Base: public abstract class ServiceResult { public static NoPermissionResult Permission() { return new NoPermissionResult(); } public static SuccessResult Success() { return new SuccessResult(); } public static SuccessResult<T> Success<T>(T result) { return new SuccessResult<T>(result); } protected ServiceResult(ServiceResultType serviceResultType) { _resultType = serviceResultType; } private readonly ServiceResultType _resultType; public ServiceResultType ResultType { get { return _resultType; } } } public class SuccessResult<T> : ServiceResult { public SuccessResult(T result) : base(ServiceResultType.Success) { _result = result; } private readonly T _result; public T Result { get { return _result; } } } public class SuccessResult : SuccessResult<object> { public SuccessResult() : this(null) { } public SuccessResult(object o) : base(o) { } } Service - eg. ForumService: public ServiceResult Delete(IVUser user, int id) { Forum forum = Repository.GetDelete(id); if (!Permission.CanDelete(user, forum)) { return ServiceResult.Permission(); } Repository.Delete(forum); return ServiceResult.Success(); } Controller: public class BaseController { public ActionResult GetResult(ServiceResult result) { switch (result.ResultType) { case ServiceResultType.Success: var successResult = (SuccessResult)result; return View(successResult.Result); break; case ServiceResultType.NoPermission: return View("Error"); break; default: return View(); break; } } } [HandleError] public class ForumsController : BaseController { [ValidateAntiForgeryToken] [Transaction] [AcceptVerbs(HttpVerbs.Post)] public ActionResult Delete(int id) { ServiceResult result = ForumService.Delete(WebUser.Current, id); /* Custom result */ if (result.ResultType == ServiceResultType.Success) { TempData[ControllerEnums.GlobalViewDataProperty.PageMessage.ToString()] = "The forum was successfully deleted."; return this.RedirectToAction(ec => Index()); } /* Custom result */ /* Execute Permission result etc. */ TempData[ControllerEnums.GlobalViewDataProperty.PageMessage.ToString()] = "A problem was encountered preventing the forum from being deleted. " + "Another item likely depends on this forum."; return GetResult(result); } }

    Read the article

  • Error with connection in my database servlet

    - by Zerobu
    Hello, I am writing a Database servlet, all seems well except that there seems to be an error in my connection import java.io.IOException; import java.sql.Connection; import java.sql.DriverManager; import java.sql.PreparedStatement; import java.sql.ResultSet; import java.sql.SQLException; import java.sql.Statement; import java.util.ArrayList; import javax.servlet.RequestDispatcher; import javax.servlet.ServletContext; import javax.servlet.ServletException; import javax.servlet.http.HttpServlet; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; public class DBServlet3 extends HttpServlet { private static final long serialVersionUID = 1L; @Override public void init() throws ServletException { super.init(); try { String jdbcDriverClass= getServletContext().getInitParameter( "jdbcDriverClass" ); if (jdbcDriverClass == null) throw new ServletException( "Could not find jdbcDriverClass initialization parameter" ); Class.forName( jdbcDriverClass ); } catch (ClassNotFoundException e) { throw new ServletException( "Could not load JDBC driver class", e ); } } @Override protected void doGet( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { RequestDispatcher dispatcher= request.getRequestDispatcher( "/db.jsp" ); ServletContext application= getServletContext(); ArrayList<String> names= new ArrayList<String>(); try { Connection connection= null; Statement statement= null; ResultSet results= null; try { String jdbcUrl= application.getInitParameter( "jdbcUrl" ); String jdbcUser= application.getInitParameter( "jdbcUser" ); String jdbcPassword= application.getInitParameter( "jdbcPassword" ); connection= DriverManager.getConnection( jdbcUrl, jdbcUser, jdbcPassword ); statement= connection.createStatement(); results= statement.executeQuery( "SELECT * FROM students" ); while (results.next()) { String name= results.getString( "name" ); names.add( name ); } } finally { if (results != null) results.close(); if (statement != null) statement.close(); if (connection != null) connection.close(); } } catch (SQLException e) { throw new ServletException( e ); } request.setAttribute( "names", names ); dispatcher.forward( request, response ); } @Override protected void doPost( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { String sql= "INSERT INTO students VALUES (" + request.getParameter( "id" ) + ", '" + request.getParameter( "name" ) + "')"; sql= "INSERT INTO students VALUES (?, ?, ?, ?)"; PreparedStatement statement= connection.prepareStatement( sql ); //error on this line statement.setString( 1, request.getParameter( "id" ) ); statement.setString( 2, request.getParameter( "name" ) ); } }

    Read the article

  • Arbitrary Form Processing with Drupal

    - by Aaron
    I am writing a module for my organization to cache XML feeds to static files to an arbitrary place on our webserver. I am new at Drupal development, and would like to know if I am approaching this the right way. Basically I: Expose a url via the menu hook, where a user can enter in a an output directory on the webserver and press the "dump" button and then have PHP go to drupal and get the feed xml. I don't need help with that functionality, because I actually have a prototype working in Python (outside of Drupal).. Provide a callback for the form where I can do my logic, using the form parameters. Here's the menu hook: function ncbi_cache_files_menu() { $items = array(); $items['admin/content/ncbi_cache_files'] = array( 'title' => 'NCBI Cache File Module', 'description' => 'Cache Guide static content to files', 'page callback' => 'drupal_get_form', 'page arguments' => array( 'ncbi_cache_files_show_submit'), 'access arguments' => array( 'administer site configuration' ), 'type' => MENU_NORMAL_ITEM, ); return $items; } I generate the form in: function ncbi_cache_files_show_submit() { $DEFAULT_OUT = 'http://myorg/foo'; $form[ 'ncbi_cache_files' ] = array( '#type' => 'textfield', '#title' => t('Output Directory'), '#description' => t('Where you want the static files to be dumped. This should be a directory that www has write access to, and should be accessible from the foo server'), '#default_value' => t( $DEFAULT_OUT ), '#size' => strlen( $DEFAULT_OUT ) + 5, ); $form['dump'] = array( '#type' => 'submit', '#value' => 'Dump', '#submit' => array( 'ncbi_cache_files_dump'), ); return system_settings_form( $form ); } Then the functionality is in the callback: function ncbi_cache_files_dump( $p, $q) { //dpm( get_defined_vars() ); $outdir = $p['ncbi_cache_files']['#post']['ncbi_cache_files']; drupal_set_message('outdir: ' . $outdir ); } The question: Is this a decent way of processing an arbitrary form in Drupal? I not really need to listen for any drupal hooks, because I am basically just doing some URL and file processing. What are those arguments that I'm getting in the callback ($q)? That's the form array I guess, with the post values? Is this the best way to get the form parameters to work on? Thanks for any advice.

    Read the article

  • Class template specializations with shared functionality

    - by Thomas
    I'm writing a simple maths library with a template vector type: template<typename T, size_t N> class Vector { public: Vector<T, N> &operator+=(Vector<T, N> const &other); // ... more operators, functions ... }; Now I want some additional functionality specifically for some of these. Let's say I want functions x() and y() on Vector<T, 2> to access particular coordinates. I could create a partial specialization for this: template<typename T> class Vector<T, 3> { public: Vector<T, 3> &operator+=(Vector<T, 3> const &other); // ... and again all the operators and functions ... T x() const; T y() const; }; But now I'm repeating everything that already existed in the generic template. I could also use inheritance. Renaming the generic template to VectorBase, I could do this: template<typename T, size_t N> class Vector : public VectorBase<T, N> { }; template<typename T> class Vector<T, 3> : public VectorBase<T, 3> { public: T x() const; T y() const; }; However, now the problem is that all operators are defined on VectorBase, so they return VectorBase instances. These cannot be assigned to Vector variables: Vector<float, 3> v; Vector<float, 3> w; w = 5 * v; // error: no conversion from VectorBase<float, 3> to Vector<float, 3> I could give Vector an implicit conversion constructor to make this possible: template<typename T, size_t N> class Vector : public VectorBase<T, N> { public: Vector(VectorBase<T, N> const &other); }; However, now I'm converting from Vector to VectorBase and back again. Even though the types are the same in memory, and the compiler might optimize all this away, it feels clunky and I don't really like to have potential run-time overhead for what is essentially a compile-time problem. Is there any other way to solve this?

    Read the article

  • Can I avoid a threaded UDP socket in Python dropping data?

    - by 666craig
    First off, I'm new to Python and learning on the job, so be gentle! I'm trying to write a threaded Python app for Windows that reads data from a UDP socket (thread-1), writes it to file (thread-2), and displays the live data (thread-3) to a widget (gtk.Image using a gtk.gdk.pixbuf). I'm using queues for communicating data between threads. My problem is that if I start only threads 1 and 3 (so skip the file writing for now), it seems that I lose some data after the first few samples. After this drop it looks fine. Even by letting thread 1 complete before running thread 3, this apparent drop is still there. Apologies for the length of code snippet (I've removed the thread that writes to file), but I felt removing code would just prompt questions. Hope someone can shed some light :-) import socket import threading import Queue import numpy import gtk gtk.gdk.threads_init() import gtk.glade import pygtk class readFromUDPSocket(threading.Thread): def __init__(self, socketUDP, readDataQueue, packetSize, numScans): threading.Thread.__init__(self) self.socketUDP = socketUDP self.readDataQueue = readDataQueue self.packetSize = packetSize self.numScans = numScans def run(self): for scan in range(1, self.numScans + 1): buffer = self.socketUDP.recv(self.packetSize) self.readDataQueue.put(buffer) self.socketUDP.close() print 'myServer finished!' class displayWithGTK(threading.Thread): def __init__(self, displayDataQueue, image, viewArea): threading.Thread.__init__(self) self.displayDataQueue = displayDataQueue self.image = image self.viewWidth = viewArea[0] self.viewHeight = viewArea[1] self.displayData = numpy.zeros((self.viewHeight, self.viewWidth, 3), dtype=numpy.uint16) def run(self): scan = 0 try: while True: if not scan % self.viewWidth: scan = 0 buffer = self.displayDataQueue.get(timeout=0.1) self.displayData[:, scan, 0] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 1] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 2] = numpy.fromstring(buffer, dtype=numpy.uint16) gtk.gdk.threads_enter() self.myPixbuf = gtk.gdk.pixbuf_new_from_data(self.displayData.tostring(), gtk.gdk.COLORSPACE_RGB, False, 8, self.viewWidth, self.viewHeight, self.viewWidth * 3) self.image.set_from_pixbuf(self.myPixbuf) self.image.show() gtk.gdk.threads_leave() scan += 1 except Queue.Empty: print 'myDisplay finished!' pass def quitGUI(obj): print 'Currently active threads: %s' % threading.enumerate() gtk.main_quit() if __name__ == '__main__': # Create socket (IPv4 protocol, datagram (UDP)) and bind to address socketUDP = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) host = '192.168.1.5' port = 1024 socketUDP.bind((host, port)) # Data parameters samplesPerScan = 256 packetsPerSecond = 1200 packetSize = 512 duration = 1 # For now, set a fixed duration to log data numScans = int(packetsPerSecond * duration) # Create array to store data data = numpy.zeros((samplesPerScan, numScans), dtype=numpy.uint16) # Create queue for displaying from readDataQueue = Queue.Queue(numScans) # Build GUI from Glade XML file builder = gtk.Builder() builder.add_from_file('GroundVue.glade') window = builder.get_object('mainwindow') window.connect('destroy', quitGUI) view = builder.get_object('viewport') image = gtk.Image() view.add(image) viewArea = (1200, samplesPerScan) # Instantiate & start threads myServer = readFromUDPSocket(socketUDP, readDataQueue, packetSize, numScans) myDisplay = displayWithGTK(readDataQueue, image, viewArea) myServer.start() myDisplay.start() gtk.gdk.threads_enter() gtk.main() gtk.gdk.threads_leave() print 'gtk.main finished!'

    Read the article

  • how do i know how many clients are calling my WCF service function

    - by ZhengZhiren
    i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

    Read the article

  • Inserting checkbox values

    - by rabeea
    hey i have registration form that has checkboxes along with other fields. i cant insert the selected checkbox values into the data base. i have made one field in the database for storing all checked values. this is the code for checkbox part in the form: Websites, IT and Software Writing and Content <pre><input type="checkbox" name="expertise[]" value="Design and Media"> Design and Media <input type="checkbox" name="expertise[]" value="Data entry and Admin"> Data entry and Admin </pre> <pre><input type="checkbox" name="expertise[]" value="Engineering and Skills"> Engineering and Science <input type="checkbox" name="expertise[]" value="Seles and Marketing"> Sales and Marketing </pre> <pre><input type="checkbox" name="expertise[]" value="Business and Accounting"> Business and Accounting <input type="checkbox" name="expertise[]" value="Others"> Others </pre> and this is the corresponding php code for inserting data $checkusername=mysql_query("SELECT * FROM freelancer WHERE fusername='{$_POST['username']}'"); if (mysql_num_rows($checkusername)==1) { echo "username already exist"; } else { $query = "insert into freelancer(ffname,flname,fgender,femail,fusername,fpwd,fphone,fadd,facc,facc_name,fbank_details,fcity,fcountry,fexpertise,fprofile,fskills,fhourly_rate,fresume) values ('".$_POST['first_name']."','".$_POST['last_name']."','".$_POST['gender']."','".$_POST['email']."','".$_POST['username']."','".$_POST['password']."','".$_POST['phone']."','".$_POST['address']."','".$_POST['acc_num']."','".$_POST['acc_name']."','".$_POST['bank']."','".$_POST['city']."','".$_POST['country']."','".implode(',',$_POST['expertise'])."','".$_POST['profile']."','".$_POST['skills']."','".$_POST['rate']."','".$_POST['resume']."')"; $result = ($query) or die (mysql_error()); this code inserts data for all fields but the checkbox value field remains empty???

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Simple html page using Bootstrap

    - by Athashri
    I am writing a simple HTML page using the Twitter Bootstrap. But the navbar and links are rendered as normal HTML on the browser. I have referred to multiple sites but the same steps are given everywhere. I am not sure where I am going wrong. Code: <!DOCTYPE HTML> <html> <head> <meta charset="utf-8"> <link rel= "stylesheet" href= "css/bootstrap.css" type="text/css"> <title> Bootstrap example</title> </head> <body> <script src="https://ajax.googleapis.com/ajax/libs/jquery/1.11.0/jquery.min.js"></script> <script src="js/bootstrap.js"></script> <h1>Hello, world!</h1> <div class ="container"> <h1><a href="#">Bootstrap Site</a></h1> <div class="navbar"> <div class="navbar-inner"> <div class="container"> <ul class="nav"> <li class="active"><a href="#">Home</a></li> <li><a href="#">Projects</a></li> <li><a href="#">Services</a></li> <li><a href="#">Downloads</a></li> <li><a href="#">About</a></li> <li><a href="#">Contact</a></li> </ul> </div> </div> </div> </div> </body> </html>

    Read the article

  • FILE_NOT_FOUND when trying to open COM port C++

    - by Moutabreath
    I am trying to open a com port for reading and writing using C++ but I can't seem to pass the first stage of actually opening it. I get an INVALID_HANDLE_VALUE on the handle with GetLastError FILE_NOT_FOUND. I have searched around the web for a couple of days I'm fresh out of ideas. I have searched through all the questions regarding COM on this website too. I have scanned through the existing ports (or so I believe) to get the name of the port right. I also tried combinations of _T("COM1") with the slashes, without the slashes, with colon, without colon and without the _T I'm using windows 7 on 64 bit machine. this is the code i got I'll be glad for any input on this void SendToCom(char* data, int len) { DWORD cbNeeded = 0; DWORD dwPorts = 0; EnumPorts(NULL, 1, NULL, 0, &cbNeeded, &dwPorts); //What will be the return value BOOL bSuccess = FALSE; LPCSTR COM1 ; BYTE* pPorts = static_cast<BYTE*>(malloc(cbNeeded)); bSuccess = EnumPorts(NULL, 1, pPorts, cbNeeded, &cbNeeded, &dwPorts); if (bSuccess){ PORT_INFO_1* pPortInfo = reinterpret_cast<PORT_INFO_1*>(pPorts); for (DWORD i=0; i<dwPorts; i++) { //If it looks like "COMX" then size_t nLen = _tcslen(pPortInfo->pName); if (nLen > 3) { if ((_tcsnicmp(pPortInfo->pName, _T("COM"), 3) == 0) ){ COM1 =pPortInfo->pName; //COM1 ="\\\\.\\COM1"; HANDLE m_hCommPort = CreateFile( COM1 , GENERIC_READ|GENERIC_WRITE, // access ( read and write) 0, // (share) 0:cannot share the COM port NULL, // security (None) OPEN_EXISTING, // creation : open_existing FILE_FLAG_OVERLAPPED, // we want overlapped operation NULL // no templates file for COM port... ); if (m_hCommPort==INVALID_HANDLE_VALUE) { DWORD err = GetLastError(); if (err == ERROR_FILE_NOT_FOUND) { MessageBox(hWnd,"ERROR_FILE_NOT_FOUND",NULL,MB_ABORTRETRYIGNORE); } else if(err == ERROR_INVALID_NAME) { MessageBox(hWnd,"ERROR_INVALID_NAME",NULL,MB_ABORTRETRYIGNORE); } else { MessageBox(hWnd,"unkown error",NULL,MB_ABORTRETRYIGNORE); } } else{ WriteAndReadPort(m_hCommPort,data); } } pPortInfo++; } } } }

    Read the article

  • How do I write sql data into a textbox after a submit type event

    - by Matt
    Finishing up some homework and Im having trouble with figuring out how to take information generated in sql column(a primary key set up to assign a record number to a customer example 1046) at submit and writing it to my redirected recipt page. I call it recipt.aspx. Any takers Professor says to use a datareader...but things go bad after that. public partial class _Default : System.Web.UI.Page { String cnStr = "EDITED FOR THE PURPOSE OF NOT DISPLAYED SQL SERVERta Source=111.11.111.11; uid=xxxxxxx; password=xxxx; database=xxxxxx; "; String insertStr; SqlDataReader reader; SqlConnection myConnection = new SqlConnection(); protected void submitbutton_Click(object sender, EventArgs e) { myConnection.ConnectionString = cnStr; try { //more magic happens as myConnection opens myConnection.Open(); insertStr = "insert into connectAssignment values ('" + TextBox2.Text + "','" + TextBox3.Text + "','" + TextBox4.Text + "','" + TextBox5.Text + "','" + bigtextthing.Text + "','" + DropDownList1.SelectedItem.Value + "')"; //magic happens as Connection string is assigned to connection object and passes in the SQL statment //associate the command to the the myConnection connection object SqlCommand cmd = new SqlCommand(insertStr, myConnection); cmd.ExecuteNonQuery(); Session["passmyvalue1"] = TextBox2.Text; Session["passmyvalue2"] = TextBox3.Text; Session["passmyvalue3"] = TextBox4.Text; Session["passmyvalue4"] = TextBox5.Text; Session["passmyvalue5"] = bigtextthing.Text; Session["I NEED SOME HELP RIGHT HERE"] =Textbox6.Text; Response.Redirect("receipt.aspx"); } catch { bigtextthing.Text = "Error submitting" + "Possible casues: Internet is down,server is down, check your settings!"; } finally { myConnection.Close(); TextBox2.Text = ""; TextBox3.Text = ""; TextBox4.Text = ""; TextBox5.Text = ""; bigtextthing.Text = ""; } //reset validators? } The recipt page public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { if(Session["passmyvalue1"] != null) { TextBox1.Text = (string)Session["passmyvalue1"]; TextBox2.Text = (string)Session["passmyvalue2"]; TextBox3.Text = (string)Session["passmyvalue3"]; TextBox4.Text = (string)Session["passmyvalue4"]; TextBox5.Text = (string)Session["passmyvalue5"]; TextBox6.Text = I don't know ; } } } THanks for the help

    Read the article

  • JavaScript regular expression literal persists between function calls

    - by Charles Anderson
    I have this piece of code: function func1(text) { var pattern = /([\s\S]*?)(\<\?(?:attrib |if |else-if |else|end-if|search |for |end-for)[\s\S]*?\?\>)/g; var result; while (result = pattern.exec(text)) { if (some condition) { throw new Error('failed'); } ... } } This works, unless the throw statement is executed. In that case, the next time I call the function, the exec() call starts where it left off, even though I am supplying it with a new value of 'text'. I can fix it by writing var pattern = new RegExp('.....'); instead, but I don't understand why the first version is failing. How is the regular expression persisting between function calls? (This is happening in the latest versions of Firefox and Chrome.) Edit Complete test case: <!DOCTYPE HTML> <html> <head> <meta http-equiv="Content-type" content="text/html;charset=UTF-8"> <title>Test Page</title> <style type='text/css'> body { font-family: sans-serif; } #log p { margin: 0; padding: 0; } </style> <script type='text/javascript'> function func1(text, count) { var pattern = /(one|two|three|four|five|six|seven|eight)/g; log("func1"); var result; while (result = pattern.exec(text)) { log("result[0] = " + result[0] + ", pattern.index = " + pattern.index); if (--count <= 0) { throw "Error"; } } } function go() { try { func1("one two three four five six seven eight", 3); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } try { func1("one two three four five six seven eight", 99); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } } function log(msg) { var log = document.getElementById('log'); var p = document.createElement('p'); p.innerHTML = msg; log.appendChild(p); } </script> </head> <body><div> <input type='button' id='btnGo' value='Go' onclick='go();'> <hr> <div id='log'></div> </div></body> </html> The regular expression continues with 'four' as of the second call on FF and Chrome, not on IE7 or Opera.

    Read the article

  • how to use window.onload?

    - by Patrick
    I'm refactoring a website using MVC. What was a set of huge pages with javascript, php, html etc etc is becoming a series of controllers and views. I'm trying to do it in a modular way so views are split in 'modules' that I can reuse in other pages when needed eg. "view/searchform displays only one div with the searchform "view/display_events displays a list of events and so on. One of the old pages was supposed to load a google map with a marker on it. Amongst the rest of the code, I can identify the relevant bits as follows <head> <script src="http://maps.google.com/maps?file=api&amp;v=2&amp;key=blablabla" type="text/javascript"></script> <script type="text/javascript"> //<![CDATA[ function load() { if (GBrowserIsCompatible()) { var map = new GMap2(document.getElementById("map")); var point = new GLatLng(<?php echo ($info->lat && $info->lng) ? $info->lat .",". $info->lng : "51.502759,-0.126171"; ?>); map.setCenter(new GLatLng(<?php echo ($info->lat && $info->lng) ? $info->lat .",". $info->lng : "51.502759,-0.126171"; ?>), 15); map.addControl(new GLargeMapControl()); map.addControl(new GScaleControl()); map.addOverlay(new GMarker(point)); var marker = createMarker(point,GIcon(),"CIAO"); map.addOverlay(marker); } } //]]> </script> </head> ...then <body onload="load()" onunload="GUnload()"> ...and finally this div where the map should be displayed <div id="map" style="width: 440px; height: 300px"> </div> Don't know much about js, but my understanding is that a) I have to include the scripts in the view module I'm writing (directly in the HTML? I would prefer to load a separate script) b) I have to trigger that function using the equivalent of body onload... (obviously there's no body tag in my view. In my ignorance I've tried div onload=.... but didn't seem to be working :) What do you suggest I do? I've read about window.onload but don't know what's the correct syntax for that. please keep in mind that other parts of the page include other js functions (eg, google adsense) that are called after the footer.

    Read the article

  • Where are the function literals in c++?

    - by academicRobot
    First of all, maybe literals is not the right term for this concept, but its the closest I could think of (not literals in the sense of functions as first class citizens). The idea is that when you make a conventional function call, it compiles to something like this: callq <immediate address> But if you make a function call using a function pointer, it compiles to something like this: mov <memory location>,%rax callq *%rax Which is all well and good. However, what if I'm writing a template library that requires a callback of some sort with a specified argument list and the user of the library is expected to know what function they want to call at compile time? Then I would like to write my template to accept a function literal as a template parameter. So, similar to template <int int_literal> struct my_template {...};` I'd like to write template <func_literal_t func_literal> struct my_template {...}; and have calls to func_literal within my_template compile to callq <immediate address>. Is there a facility in C++ for this, or a work around to achieve the same effect? If not, why not (e.g. some cataclysmic side effects)? How about C++0x or another language? Solutions that are not portable are fine. Solutions that include the use of member function pointers would be ideal. I'm not particularly interested in being told "You are a <socially unacceptable term for a person of low IQ>, just use function pointers/functors." This is a curiosity based question, and it seems that it might be useful in some (albeit limited) applications. It seems like this should be possible since function names are just placeholders for a (relative) memory address, so why not allow more liberal use (e.g. aliasing) of this placeholder. p.s. I use function pointers and functions objects all the the time and they are great. But this post got me thinking about the don't pay for what you don't use principle in relation to function calls, and it seems like forcing the use of function pointers or similar facility when the function is known at compile time is a violation of this principle, though a small one.

    Read the article

  • Displaying an Image in an activity using URI

    - by evkwan
    Hi, I'm writing an application that uses Intent(MediaStore.ACTION_IMAGE_CAPTURE) to capture and image. On the process of capturing the image, I noted the output of the image's URI. Right after finishing the camera activity, I wish to display the image using this specific URI. The method I used to capture images is: private void saveFullImage() { Intent intent = new Intent(MediaStore.ACTION_IMAGE_CAPTURE); File file = new File(Environment.getExternalStorageDirectory(), "test.jpg"); outputFileUri = Uri.fromFile(file); intent.putExtra(MediaStore.EXTRA_OUTPUT, outputFileUri); startActivityForResult(intent, TAKE_PICTURE); } Which is a method taken from Reto Meier's book Professional Android 2 Application Development. The method works fine, and I assume that the URI of the picture I just took is stored in the outputFileUri variable. Then at this point of the code is where I want to display the picture: @Override protected void onActivityResult(int requestCode, int resultCode, Intent data) { if (requestCode == TAKE_PICTURE) { //I want to display the picture I just took here //using the URI } } I'm not sure how to do it. I tried creating a new layout object and a new ImageView object using the method setImageURI(outputFileUri). My main layout (xml) did not have a ImageView object. But even when I set the contentView to the new layout with the ImageView attached to it, it doesn't display anything. I tried creating a Bitmap object from the URI and set it to the ImageView, but I get an unexpected error and forced exit. I have seen examples from here here which creates a Bitmap from URI, but it's not displaying it? My question is just how to display an image in the middle of a running activity? Do I need to get the File Path (like this) in order to display it? If I make a Bitmap out of the URI, how do I display the Bitmap? I'm just probably missing something simple...so any help would be a greatly appreciated! Also additional question for thought: If I were to take multiple pictures, would you recommend me to use the SimpleCursorAdapter instead? Thanks!

    Read the article

< Previous Page | 633 634 635 636 637 638 639 640 641 642 643 644  | Next Page >