Search Results

Search found 4702 results on 189 pages for 'accented strings'.

Page 64/189 | < Previous Page | 60 61 62 63 64 65 66 67 68 69 70 71  | Next Page >

  • (C++) While reading a file (ifstream), is there any way to direct it to make a new line?

    - by Enzo
    While reading a file (ifstream), is there any way to direct it to make a new line? For instance, I would like for THIS to happen: myfilearray[1]array[2]endl; Obviously, the "endl" just isn't allowed. Is there another way to do this? Edit---thanks for the quick responses guys! From a text file, I'm trying to store two strings from that file into arrays and then do the same with the next line (or until I desire, using a for loop) Using strings is important to me as it will make my future program a lot more flexible.

    Read the article

  • Whats the difference between a C++ and a Cocoa Project in Xcode?

    - by david
    I need to work with TagLib for my project. I've created a framework (and I tried using it as a lib) but the compiler cannot find #include < strings on compiling (No such file or Directory). I've created a test C++ project and it #includes < strings just fine. I've looked at the project settings and I cannot find a difference between them. But the standard cocoa projects obviously so not have the search path set to include C++ libraries (Or am I completely getting it wrong?). I've searched for a solution but no one else seems to have run into this problem.

    Read the article

  • fastest in objC: IsEqualToString:@"" or length > 0?

    - by Cœur
    I'd like to know which one is fastest for testing a non-empty NSString for iOS 4.0+ (iPhone 3G). Note: the strings to test will be 99% of the time from 2 to 100 chars length. if ([foo length] > 0) or if ([foo isEqualToString:@""] == NO && foo != nil) I think it depends if isEqualToString: compares the length first (and in that case first way is faster) or if isEqualToString: compares first character of strings first (and in that case second way might be faster). ps: I already know isEqualToString: is faster than isEqual: which is itself faster than compare:.

    Read the article

  • Converting image to byte/encoding it? - RichTextBox

    - by user1667191
    I have strings that are "Images", although they are in "String" format. Here's how one of the strings look like: {\pict\wmetafile8\picw820\pich900\picwgoal465\pichgoal510 010009000003ac1000000000f60900000000f6090000..etc.. It goes on like this for a few more lines. The guy that got this said he converted the image by pasting it in a richtextbox and getting that string. How can I go about getting the same result? Sorry for the lack of info. Just not sure how this is called.

    Read the article

  • Is there a way to specify java annotations in antlr grammar files?

    - by Steve B.
    I'm looking for a way to include a few additional strings in output .java files generated from antlr. Is there a comprehensive listing of available directives? For example, given parser output like this: package com.foo.bar; //<-- this can be generated with @header { .... } //antlr generated import org.antlr.runtime.*; ... //<-- is there a way to generate anything here? public class MyParser { //<--- or here? public void f1(){ ... } } Is there a way to generate strings that appear after the import statements (e.g. class-level annotations) or possibly method annotations?

    Read the article

  • Get the top nth values from a rectangular array

    - by user355925
    I am reading a txt file for strings that represent integers. The file is space delimited. I have created an array[10,2]. Everytime the strings 1~10 is found in the file I increment array[n,0] by 1. I also feed array[n,1] with numbers 1~10. i.e. txt file contents: 1/1/1 10/1/2001 1 1 10 2 2 3 1 5 10 word word 3 3 etc.. streamreader reads 1/1/1 and determines that is is not 1~10 streamreader reads 10/1/2001 and determines that it is not 1~10 streamreader reads 1 and ++array[0,0] streamreader reads 1 and ++array[0,0] streamreader reads 10 and ++array[9,0] etc.. The result will be: '1' was found 3 times '2' was found 2 times '3' was found 3 times '5' was found 1 time '10' was found 2 times My problem is that I need this array placed in order(sorted) by value of column 0 so that it would be: 1 3 2 10 5

    Read the article

  • Pass variable number of variables to a class in PHP

    - by user325282
    I need to pass a variable number of strings to instantiate different classes. I can always do a switch on the size of the array: switch(count($a)) { case 1: new Class(${$a[0]}); break; case 2: new Class(${$a[0]}, ${$a[1]}); break; etc... There has to be a better way to do this. If I have an array of strings ("variable1", "variable2", 'variable3", ...), how can I instantiate a Class without manually accounting for every possibility?

    Read the article

  • Map a property in the entity framework to a different type

    - by Tom
    I have a SQL Server 2008 database. I have a bunch of fields in TableA that are just strings that corresponds to booleans. So every value is either true or false. The edmx I generated using Entity Framework 4.0 has them as strings. This is technically correct but I would like to have them mapped as Booleans instead. Is this possible? If so how can I accomplish this? Thanks much!

    Read the article

  • In-memory data structure that supports boolean querying

    - by sanity
    I need to store data in memory where I map one or more key strings to an object, as follows: "green", "blue" -> object1 "red", "yellow" -> object2 I need to be able to efficiently receive a list of objects, where the strings match some boolean criteria, such as: ("red" OR "green") AND NOT "blue" I'm working in Java, so the ideal solution would be an off-the-shelf Java library. I am, however, willing to implement something from scratch if necessary. Anyone have any ideas? I'd rather avoid the overhead of an in-memory database if possible, I'm hoping for something comparable in speed to a HashMap (or at least the same order of magnitude).

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How to test Language DLLs?

    - by EKI
    Our application offer the user to display different languages if they have the approppriate Language DLL (say German.DLL, French.DLL, even Chinese.DLL). We have functional test to verify that those DLLs enable the right options in a Combobox and that choosing them will actually translate strings in the UI. I would like to know options to test this translation dll's more in depth, maybe ensuring that all the characters in the selected langauge (and in the file) can be correctly displayed, or that the internal structure of the DLL is consistent, there are no strings exceeding the limits that are expected of them, etc... Any suggestions on what to test and how to test it? Does anyone know specific problems that may arise and we should check? Thanks in advance.

    Read the article

  • How to convert string to integer?

    - by user1260584
    So I'm having a hard time with my situation and need some advice. I'm trying to convert my two Strings that I have into integers, so that I can use them in math equations. Here is what I tried, however it brings me an error in the app. ' equals.setOnClickListener(new View.OnClickListener() { public void onClick(View arg0) { // TODO Auto-generated method stub num1 = edit.getText().toString(); num2 = edit.getText().toString(); int first = Integer.parseInt(num1); int second = Integer.parseInt(num2); edit.setText(first + second); } }); Is there something that I am doing wrong? Thank you for any help. EDIT: Yes this is Java. num1 and num2 are strings that I have previously named. What do you mean by trim?

    Read the article

  • .NET Regex - need matching string for parsing...

    - by TomTom
    Hello, I am a regex idiot and never found a good tutorial (links welcome, as well as a pointer to an interactive VS2010 integrated editor). I need to parse strings in the following form: [a/b]:c/d a, b: double with "." as possible separator. CAN be empty c: double with "." as separator d: integer, positive I.e. valid strings are: [/]:0.25/2 [-0.5/0.5]:0.05/2 [/0.1]:0.05/2 ;) Anyone can help? Thanks

    Read the article

  • Selecting dictionary items by key efficiently in Python

    - by user248237
    suppose I have a dictionary whose keys are strings. How can I efficiently make a new dictionary from that which contains only the keys present in some list? for example: # a dictionary mapping strings to stuff mydict = {'quux': ..., 'bar': ..., 'foo': ...} # list of keys to be selected from mydict keys_to_select = ['foo', 'bar', ...] The way I came up with is: filtered_mydict = [mydict[k] for k in mydict.keys() \ if k in keys_to_select] but I think this is highly inefficient because: (1) it requires enumerating the keys with keys(), (2) it requires looking up k in keys_to_select each time. at least one of these can be avoided, I would think. any ideas? I can use scipy/numpy too if needed.

    Read the article

  • Using varible in re.match in python

    - by screwuphead
    I am trying to create an array of things to match in a description line. So I cant ignore them later on in my script. Below is a sample script that I have been working on, on the side. Basically I am trying to take a bunch of strings and match it against a bunch of other strings. AKA: asdf or asfs or wrtw in string = true continue with script if not print this. import re ignorelist = ['^test', '(.*)set'] def guess(a): for ignore in ignorelist: if re.match(ignore, a): return('LOSE!') else: return('WIN!') a = raw_input('Take a guess: ') print guess(a) Thanks

    Read the article

  • Is there a way to create a string that matches a given C# regex?

    - by Chris Phillips
    My application has a feature that parses text using a regular expression to extract special values. I find myself also needing to create strings that follow the same format. Is there a way to use the already defined regular expression to create those strings? For example, assume my regex looks something like this: public static Regex MyRegex = new Regex( @"sometext_(?<group1>\d*)" ); I'd like to be able to use MyRegex to create a new string, something like: var created = MyRegex.ToString( new Dictionary<string, string>() {{ "group1", "data1" }}; Such that created would then have the value "sometextdata1".

    Read the article

  • C#: Resource file refactoring

    - by Svish
    Does anyone know of a good tool for refactoring resources in a visual studio 2008 solution? We have a number of resource files with translated text in an assembly used for localizing our application. But they have gotten a bit messy... I would like to rename some of the keys, and move some of them into other resource files. And I would like those changes be done in my code, and the translated versions of the resource files as well. Maybe a some analysis on what strings are missing in the translated versions, and what strings have been removed from the original as well... Does anyone know of a good visual studio extension or ReSharper plugin that can help me with this? Right now it is kind of a pain, because I have to first rename the key in the base resource file, then in the localized versions. And then compile to get all the compile errors resulting from the key which now have a different name, and then go through and fix them all... very annoying =/

    Read the article

  • construct a unique number for a string in java

    - by praveen
    We have a requirement of reading/writing more than 10 million strings into a file. Also we do not want duplicates in the file. Since the strings would be flushed to a file as soon as they are read we are not maintaining it in memory. We cannot use hashcode because of collisions in the hash code due to which we might miss a string as duplicate. Two other approaches i found in my googling: 1.Use a message digest algorithm like MD5 - but it might be too costly to calculate and store. 2.Use a checksum algorithm. [i am not sure if this produces a unique key for a string- can someone please confirm] Is there any other approach avaiable. Thanks.

    Read the article

  • RESTful enums. string or Id?

    - by GazTheDestroyer
    I have a RESTful service that exposes enums. Should I expose them as localised strings, or plain integers? My leaning is toward integers for easy conversion at the service end, but in that case the client needs to grab a list of localised strings from somewhere in order to know what the enums mean. Am I just creating extra steps for nothing? There seems to be little information I can find about which is commonly done in RESTful APIs. EDIT: OK. Let's say I'm writing a website that stores information about people's pets. I could have an AnimalType enum 0 Dog 1 Cat 2 Rabbit etc. When people grab a particular pet resource, say /pets/1, I can either provide a meaningful localised string for the animal type, or just provide the ID and force them to do another look up via a /pets/types resource. Or should I provide both?

    Read the article

  • foreach statement (get string values)

    - by nhoyti
    Can someone please help me out? My code for splitting the strings is working however, i still need to use the splitted string my page. How can i achieve this? Here's my current code private void SplitStrings() { List<string> listvalues = new List<string>(); listvalues = (List<string>)Session["mylist"]; string[] strvalues = listvalues.ToArray(); if (listvalues != null) { foreach (string strElement in listvalues) { string[] prods = strElement.ToString().Split("|".ToCharArray()); string prodName = prods[0].ToString(); Response.Write(prodName); } } } link text how can i replace the response.write with any label or literal? when i tried to use a literal on the code it displays one single string not all of the strings that's been splitted. any ideas?

    Read the article

< Previous Page | 60 61 62 63 64 65 66 67 68 69 70 71  | Next Page >