Search Results

Search found 19967 results on 799 pages for 'document template'.

Page 645/799 | < Previous Page | 641 642 643 644 645 646 647 648 649 650 651 652  | Next Page >

  • Using Virtualbox Bridge Networking fails connection from Guest OS to Oracle XE running on Host

    - by Licheng
    I am trying to make a JDBC connection from a VirtualBox Ubuntu Guest OS to an Oracle XE database running o Host. However, the connection is refused. Here are the details of my environment: VirtualBox: 4.1.4 Host OS: Windows 7 Guest OS: Ubuntu server 11.4 Networking mode: Bridged network Oracle XE database running on Host Issue: WebLogic server runs on the Ubuntu virtualbox. It attempts to connect to an Oracle XE database running on the Host OS (windows 7) with listening port 1521. On the Guest OS (Ubuntu), I am able to ping the Host computer from the Guest OS. However, when I configured a JDBC data source on the WebLogic server on the Guest OS to connect to the Oracle XE, connection took a long time, and eventually I received an "IO Exception: The Network Adapter could not establish the connection". When I tried "telnet host-ip 1521", no connection was established. With Bridge networking, I can make bi-directional connections between the host and the guest OS (e.g. connection through ssh and ftp). Is there anything I missed in the setup of Bridge networking and the guest/host OS? Note that I was able to make the same connection within a normal networking environment (i.e. not using virtual box). I am not sure whether Bridge networking is a good option for the work described above. Should I use host-only networking mode? If so, any specific configurations I need to perform? I read through the Virtual box document on setting up the host-only network, however, it lacks of details. I followed the procedures described in the manual, and couldn't even connect to the host. Could some experts here enlighten me on this issue? Much appreciated. Licheng

    Read the article

  • Getting Error while running RED5 server - class path resource [red5.xml] cannot be opened because it does not exist

    - by sunil221
    HI , I have installed java version "1.6.0_14" and Ant version 1.8.2 for red5 Server. when i am trying to run red5 server i am getting the following error please help Root: /usr/local/red5 Deploy type: bootstrap Logback selector: org.red5.logging.LoggingContextSelector Setting default logging context: default 11:27:39.838 [main] INFO org.red5.server.Launcher - Red5 Server 1.0.0 RC1 $Rev: 4171 $ (http://code.google.com/p/red5/) Red5 Server 1.0.0 RC1 $Rev: 4171 $ (http://code.google.com/p/red5/) SLF4J: Class path contains multiple SLF4J bindings. SLF4J: Found binding in [jar:file:/usr/local/red5/red5.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: Found binding in [jar:file:/usr/local/red5/lib/logback-classic-0.9.26.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: See http://www.slf4j.org/codes.html#multiple_bindings for an explanation. 11:27:39.994 [main] INFO o.s.c.s.FileSystemXmlApplicationContext - Refreshing org.springframework.context.support.FileSystemXmlApplicationContext@39d85f79: startup date [Mon Dec 21 11:27:39 EST 2009]; root of context hierarchy 11:27:40.149 [main] INFO o.s.b.f.xml.XmlBeanDefinitionReader - Loading XML bean definitions from class path resource [red5.xml] Exception org.springframework.beans.factory.BeanDefinitionStoreException: IOException parsing XML document from class path resource [red5.xml]; nested exception is java.io.FileNotFoundException: class path resource [red5.xml] cannot be opened because it does not exist Bootstrap complete

    Read the article

  • NRPE Warning threshold must be a positive integer

    - by Frida
    OS: Ubuntu 12.10 Server 64bits I've installed Icinga, with ido2db, pnp4nagios and icinga-web (last release, following the instruction given in the documentation, installation with apt, etc). I am using icinga-web to monitor my hosts. For the moment, I have just my localhost, and all is perfect. I am trying to add a host and monitor it with NRPE (version 2.12): root@server:/etc/icinga# /usr/lib/nagios/plugins/check_nrpe -H client NRPE v2.12 The configuration looks good. I've created a file in /etc/icinga/objects/client.cfg as below on the server: root@server:/etc/icinga/objects# cat client.cfg define host{ use generic-host ; Name of host template to use host_name client alias client.toto address xx.xx.xx.xx } # Service Definitions define service{ use generic-service host_name client service_description CPU Load check_command check_nrpe_1arg!check_load } define service{ use generic-service host_name client service_description Number of Users check_command check_nrpe_1arg!check_users } And add in my /etc/icinga/commands.cfg: # this command runs a program $ARG1$ with no arguments define command { command_name check_nrpe command_line /usr/lib/nagios/plugins/check_nrpe -H $HOSTADDRESS$ -c $ARG1$ -a $ARG2$ } # this command runs a program $ARG1$ with no arguments define command { command_name check_nrpe_1arg command_line /usr/lib/nagios/plugins/check_nrpe -H $HOSTADDRESS$ -c $ARG1$ } But it does not work. These are the logs from the client: Dec 3 19:45:12 client nrpe[604]: Connection from xx.xx.xx.xx port 32641 Dec 3 19:45:12 client nrpe[604]: Host address is in allowed_hosts Dec 3 19:45:12 client nrpe[604]: Handling the connection... Dec 3 19:45:12 client nrpe[604]: Host is asking for command 'check_users' to be run... Dec 3 19:45:12 client nrpe[604]: Running command: /usr/lib/nagios/plugins/check_users -w -c Dec 3 19:45:12 client nrpe[604]: Command completed with return code 3 and output: check_users: Warning t hreshold must be a positive integer#012Usage:check_users -w -c Dec 3 19:45:12 client nrpe[604]: Return Code: 3, Output: check_users: Warning threshold must be a positive integer#012Usage:check_users -w -c Dec 3 19:44:49 client nrpe[32582]: Connection from xx.xx.xx.xx port 32129 Dec 3 19:44:49 client nrpe[32582]: Host address is in allowed_hosts Dec 3 19:44:49 client nrpe[32582]: Handling the connection... Dec 3 19:44:49 client nrpe[32582]: Host is asking for command 'check_load' to be run... Dec 3 19:44:49 client nrpe[32582]: Running command: /usr/lib/nagios/plugins/check_load -w -c Dec 3 19:44:49 client nrpe[32582]: Command completed with return code 3 and output: Warning threshold mu st be float or float triplet!#012#012Usage:check_load [-r] -w WLOAD1,WLOAD5,WLOAD15 -c CLOAD1,CLOAD5,CLO AD15 Dec 3 19:44:49 client nrpe[32582]: Return Code: 3, Output: Warning threshold must be float or float trip let!#012#012Usage:check_load [-r] -w WLOAD1,WLOAD5,WLOAD15 -c CLOAD1,CLOAD5,CLOAD15 Dec 3 19:44:49 client nrpe[32582]: Connection from xx.xx.xx.xx closed. Have you any ideas?

    Read the article

  • o3d javascript uncaught referenceerror

    - by David
    hey, im new to javascript and am intersted in creating a small o3d script: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Test Game Website</title> </head> <body> <script type="text/javascript" src="o3djs/base.js"></script> <script type = "text/javascript" id="myscript"> o3djs.require('o3djs.camera'); window.onload = init; function init(){ document.write("jkjewfjnwle"); } </script> <div align="background"> <div id="game_container" style="margin: 0px auto; clear: both; background-image: url('./tmp.png'); width: 800px; height:600px; padding: 0px; background-repeat: no-repeat; padding-top: 1px;"></div> </div> </body> </html> the browser cant seem to find o3djs/base.js in this line <script type="text/javascript" src="o3djs/base.js"></script> and gives me an uncaught referenceerror at this line o3djs.require('o3djs.camera'); Obviously, because it can't find the o3djs/base.js... I have installed the o3d pluggin from google and they say that should be IT ive tried on firefox, ie and chrome thanks

    Read the article

  • Integration of SharePoint 2010 with TFS2010

    - by Kabir Rao
    We have performed following steps as of now- Install TFS2010 10.0.30319.1 (RTM) on Windows Server 2008 R2 Enterprise(app tier) SQL 2008 SP1 with Cumulative update 2 on Windows Server 2008 R2 Enterprise(data tier) Reporting Service is installed on app tier. After this installation worked fine we installed SharePoint 2010 on app tier. After installation we followed http://blogs.msdn.com/b/team_foundation/archive/2010/03/06/configuring-sharepoint-server-2010-beta-for-dashboard-compatibility-with-tfs-2010-beta2-rc.aspx for configuration. We are not able to perform the last step described in the link as following error occured- TF249063: The following Web service is not available: http://apptier:31254/_vti_bin/TeamFoundationIntegrationService.asmx. This Web service is used for the Team Foundation Server Extensions for SharePoint Products. The underlying error is: The remote server returned an error: (404) Not Found.. Verify that the following URL points to a valid SharePoint Web application and that the application is available: http://apptier:31254. If the URL is correct and the Web application is operating normally, verify that a firewall is not blocking access to the Web application. We have also noticed that Document Folder in Team project also have red x. Please help. Thanks upfront.

    Read the article

  • PHP 5.3 on IIS gives 404 error in CGI mode

    - by reinier
    Slowly losing my mind here. I had PHP 5.2 working fine (ISAPI) under IIS, but for some extension I needed 5.3. So no worries, I installed this but it turns out ISAPI is not supplied anymore. I followed the install tutorials for fastcgi and ended up with a 500 internal server error for every PHP page served. So my current situation is: I have fastcgi removed. In my websites I have added PHP (head, get, post) and routed them to c:\php\php-cgi.exe. Result: every PHP page I try (even the ones with just text) gives 404 not found error. Any HTML file I put in the same folder, serves without a hitch. Who can help me please... How hard can something like this be right? For me apparently very hard. Extra information: ran the installer as suggested below. Set it to use fastcgi. my fcgiext.ini file looks like this now: [types] php=c:\php\php-cgi.exe [c:\php\php-cgi.exe] exepath=c:\php\php-cgi.exe from the command-line a 3 line PHP file with just phpinfo(); works fine from the server the same PHP file with just phpinfo(); results in the internal server 500 error. from the server a PHP file with just text works fine when changing the document types in IIS management console and point the PHP extension directly to c:\php\php-cgi.exe results in 404 for every PHP file the php.ini is the php.ini.production file which came in the distribution. No edits were made. Setting the IIS PHP handler directly to PHP (not via fastcgi) c:\php\php-cgi.exe results in the following: display a PHP page with only text....works fine display a page with only phpinfo(); results in 404 not found

    Read the article

  • Getting Error while running RED5 server - class path resource [red5.xml] cannot be opened because it does not exist

    - by sunil221
    HI , I have installed java version "1.6.0_14" and Ant version 1.8.2 for red5 Server. when i am trying to run red5 server i am getting the following error please help Root: /usr/local/red5 Deploy type: bootstrap Logback selector: org.red5.logging.LoggingContextSelector Setting default logging context: default 11:27:39.838 [main] INFO org.red5.server.Launcher - Red5 Server 1.0.0 RC1 $Rev: 4171 $ (http://code.google.com/p/red5/) Red5 Server 1.0.0 RC1 $Rev: 4171 $ (http://code.google.com/p/red5/) SLF4J: Class path contains multiple SLF4J bindings. SLF4J: Found binding in [jar:file:/usr/local/red5/red5.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: Found binding in [jar:file:/usr/local/red5/lib/logback-classic-0.9.26.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: See http://www.slf4j.org/codes.html#multiple_bindings for an explanation. 11:27:39.994 [main] INFO o.s.c.s.FileSystemXmlApplicationContext - Refreshing org.springframework.context.support.FileSystemXmlApplicationContext@39d85f79: startup date [Mon Dec 21 11:27:39 EST 2009]; root of context hierarchy 11:27:40.149 [main] INFO o.s.b.f.xml.XmlBeanDefinitionReader - Loading XML bean definitions from class path resource [red5.xml] Exception org.springframework.beans.factory.BeanDefinitionStoreException: IOException parsing XML document from class path resource [red5.xml]; nested exception is java.io.FileNotFoundException: class path resource [red5.xml] cannot be opened because it does not exist Bootstrap complete

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Remote search system for samba shares

    - by fostandy
    I have several shares residing on a samba server in a small business environment that I would like to provide search facilities for. Ideally this would be something like google desktop with some extra features (see below), but lacking this the idea is to take what I can get, or at least get an idea for what is out there. Using google desktop search as a reference model, the principle additional requirement is that it is usable from clients over the network. In addition there are some other notes (note that none of these are hard requirements) The content is always files, residing on a single server, accessible from samba shares. Standard ms office document fare Also a lot of rars and zips which it is necessary to search inside. Permissions support, allowing for user-based control to reflect current permission access in samba shares. The userbase will remain fairly static, so manual management of users is fine. majority of users will be Windows based I know there are plenty of search indexers out there: beagle and tracker seem to be the most popular. Most do not seem to offer access control and web-based/remote search does not seem to be high priority. I've also seen a recent post on the samba mailing list asking for pretty much the exact same thing. (They mention a product called IBM OmniFind Yahoo! Edition and while their initial reception seems positive, I am pretty skeptical. RHEL 4? Firefox 2? Updated much?) What else is out there? Are you in a similar situation? What do you use?

    Read the article

  • IIS 7.5 / Windows 7: Error 500.19, error code 0x800700b7

    - by nikhiljoshi
    I have been trying to resolve this issue. I am using Windows 7 and VS2008 +iis7.5. My project is stuck because of this error. The error says: Error Summary HTTP Error 500.19 - Internal Server Error The requested page cannot be accessed because the related configuration data for the page is invalid. `Detailed Error Information Module IIS Web Core Notification BeginRequest Handler Not yet determined Error Code 0x800700b7 Config Error There is a duplicate 'system.web.extensions/scripting/scriptResourceHandler' section defined Config File \\?\C:\inetpub\wwwroot\test23\web.config Requested URL http://localhost:80/test23 Physical Path C:\inetpub\wwwroot\test23 Logon Method Not yet determined Logon User Not yet determined Config Source 15: <sectionGroup name="scripting" type="System.Web.Configuration.ScriptingSectionGroup, System.Web.Extensions, Version=3.5.0.0, Culture=neutral, PublicKeyToken=31BF3856AD364E35"> 16: <section name="scriptResourceHandler" type="System.Web.Configuration.ScriptingScriptResourceHandlerSection, System.Web.Extensions, Version=3.5.0.0, Culture=neutral, PublicKeyToken=31BF3856AD364E35" requirePermission="false" allowDefinition="MachineToApplication"/> 17: <sectionGroup name="webServices" type="System.Web.Configuration.ScriptingWebServicesSectionGroup, System.Web.Extensions, Version=3.5.0.0, Culture=neutral, PublicKeyToken=31BF3856AD364E35"> ` I followed the instructions in this Microsoft solution document, but it didn't help. http://support.microsoft.com/kb/942055

    Read the article

  • Windows 2008 R2 CA and auto-enrollment: how to get rid of >100,000 issued certificates?

    - by HopelessN00b
    The basic problem I'm having is that I have 100,000 useless machine certificates cluttering up my CA, and I'd like to delete them, without deleting all certs, or time jumping the server ahead, and invalidating some of the useful certs on there. This came about as a result of accepting a couple defaults with our Enterprise Root CA (2008 R2) and using a GPO to auto-enroll client machines for certificates to allow 802.1x authentication to our corporate wireless network. Turns out that the default Computer (Machine) Certificate Template will happily allow machines to re-enroll instead of directing them to use the certificate they already have. This is creating a number of problems for the guy (me) who was hoping to use the Certificate Authority as more than a log of every time a workstation's been rebooted. (The scroll bar on the side is lying, if you drag it to the bottom, the screen pauses and loads the next few dozen certs.) Does anyone know how to DELETE 100,000 or so time-valid, existing certificates from a Windows Server 2008R2 CA? When I go to delete a certificate now, now, I get an error that it cannot be delete because it's still valid. So, ideally, some way to temporarily bypass that error, as Mark Henderson's provided a way to delete the certificates with a script once that hurdle is cleared. (Revoking them is not an option, as that just moves them to Revoked Certificates, which we need to be able to view, and they can't be deleted from the revoked "folder" either.) Update: I tried the site @MarkHenderson linked, which is promising, and offers much better certificate manageability, buts still doesn't quite get there. The rub in my case seems to be that the certificates are still "time-valid," (not yet expired) so the CA doesn't want to let them be deleted from existence, and this applies to revoked certs as well, so revoking them all and then deleting them won't work either. I've also found this technet blog with my Google-Fu, but unfortunately, they seemed to only have to delete a very large number of certificate requests, not actual certificates. Finally, for now, time jumping the CA forward so the certificates I want to get rid of expire, and therefore can be deleted with the tools at the site Mark linked is not a great option, as would expire a number of valid certificates we use that have to be manually issued. So it's a better option than rebuilding the CA, but not a great one.

    Read the article

  • Change the Default Date setting in Word 2010

    - by Chris
    I am using Word 2010 and Windows 7. You know how when you start typing a date in Word it will automatically suggest what it thinks you want? Like if I start typing “6/29”, a little grey bubble will display “6/29/13 (Press ENTER to Insert)”. How do I get it so the bubble will display the year in a 4 digit format, such as "6/29/2013 (Press Enter to Insert)"? The below picture is how it looks when typing a date into Word. I have already gone to the Date & Time option under the Insert menu and the date format that I want is already selected. I think this is only for using quickparts anyway, so the date automatically updates when you open a document. The Region and Language settings under the Control Panel are correct as well. I thought at one point I found it somewhere under options, but I am sure I looked through everything many times and I can’t find it. I posted this exact question at the Microsoft website and someone replied: Go to the Windows Control Panel and click on Clock, Language and Region and then on Change the date, time, or number format and then modify the Short date format so that it is what you want to be used. So please don't suggest this again, because in my question I did say that I already tried this and it doesn't work, at least not for Word, in this situation. Thanks.

    Read the article

  • Pasting formatted Excel range into Outlook message

    - by Steph
    Hi everyone, I am using Office 2007 and I would like to use VBA to paste a range of formatted Excel cells into an Outlook message and then mail the message. In the following code (that I lifted from various sources), it runs without error and then sends an empty message... the paste does not work. Can anyone see the problem and better yet, help with a solution? Thanks, -Steph Sub SendMessage(SubjectText As String, Importance As OlImportance) Dim objOutlook As Outlook.Application Dim objOutlookMsg As Outlook.MailItem Dim objOutlookRecip As Outlook.Recipient Dim objOutlookAttach As Outlook.Attachment Dim iAddr As Integer, Col As Integer, SendLink As Boolean 'Dim Doc As Word.Document, wdRn As Word.Range Dim Doc As Object, wdRn As Object ' Create the Outlook session. Set objOutlook = CreateObject("Outlook.Application") ' Create the message. Set objOutlookMsg = objOutlook.CreateItem(olMailItem) Set Doc = objOutlookMsg.GetInspector.WordEditor 'Set Doc = objOutlookMsg.ActiveInspector.WordEditor Set wdRn = Doc.Range wdRn.Paste Set objOutlookRecip = objOutlookMsg.Recipients.Add("[email protected]") objOutlookRecip.Type = 1 objOutlookMsg.Subject = SubjectText objOutlookMsg.Importance = Importance With objOutlookMsg For Each objOutlookRecip In .Recipients objOutlookRecip.Resolve ' Set the Subject, Body, and Importance of the message. '.Subject = "Coverage Requests" 'objDrafts.GetFromClipboard Next .Send End With Set objOutlookMsg = Nothing Set objOutlook = Nothing End Sub

    Read the article

  • Software for handling camera RAW-files

    - by Eikern
    I use a digital SLR as most other photographers do today and have quickly realised that capturing images using camera-RAW files is the way to go. Personally I use Adobe Lightroom to handle my photo library, but I know there are other software available like Apple Aperture. These applications are quite hard to use for a novice, and are quite expensive too. I've often recommended other photographers to switch to camera-raw, but they won't do it because Windows can't handle it natively. Are there any free or cheaper applications out there that can do simple file handling and adjustments? Preferably so simple that my mom can do it. I know Nikon offers a codec that allows you to view NEF-files natively inside Windows, but still limits the uses of the file and slows the system down if the file is big. Does anybody know of a drag-and-drop application that converts camera-raw to JPG on-the-fly? In case I or someone would need to upload an image to the web or use it inside a word-document. Thanks.

    Read the article

  • How do I get a subdomain on Xampp Apache @ localhost?

    - by jasondavis
    **UPDATE- I got it working now, I just had to change to The port number is important here. I just modified my windows HOST file @ C:\Windows\System32\drivers\etc and added this to the end of it 127.0.0.1 images.localhost 127.0.0.1 w-w-w.friendproject-.com 127.0.0.1 friendproject.-com Then I modified my httpd-vhosts.conf file on Apache under Xampp @ C:\webserver\apache\conf\extra Under the part where it shows examples for adding virtualhost I added this code below: NameVirtualHost *:80 <VirtualHost *:80> DocumentRoot /htdocs/images/ ServerName images.localhost </VirtualHost> <VirtualHost *:80> DocumentRoot /htdocs/ ServerName friendproject.com/ </VirtualHost> <VirtualHost *:80> DocumentRoot /htdocs/ ServerName w-ww-.friendproject.c-om/ </VirtualHost> Now the problem is when I go to any of the newly added domains in the browser I get this error below and even worse news is I now get this error even when going to http://localhost/ which worked fine before doing this I realize I can change everything back but I really need to at least get htt-p://im-ages.localhost to work. What do I do? Access forbidden! You don't have permission to access the requested directory. There is either no index document or the directory is read-protected. If you think this is a server error, please contact the webmaster . Error 403 localhost 07/25/09 21:20:14 Apache/2.2.11 (Win32) DAV/2 mod_ssl/2.2.11 OpenSSL/0.9.8i PHP/5.2.9

    Read the article

  • Workstations cannot see new MS Server 2008 domain, but can access DHCP.

    - by Radix
    The XP Pro workstations do not see the new replacement domain upon boot; they only see their cached entry for the old (server 2003) domain controller. The old_server is not connected to the network. I have DHCP working with the same scope as the old_server. In my "before-asking" search for a solution I came across the following two articles, and I recall doing things as suggested by the articles. http://www.windowsreference.com/windows-server-2008/how-to-setup-dhcp-server-in-windows-server-2008-step-by-step-guide/ http://www.windowsreference.com/windows-server-2008/step-by-step-guide-for-windows-server-2008-domain-controller-and-dns-server-setup/ The only possible issue is: I was under the impression that the domain netbios needed to match the DC's netbios. The DC netbios is city01 while the domain's FQDN is city.domain.org (I think this is mistaken and should have been just domain.org) But, the second link led me to a post which I believe answers my question. I did as they instructed by opening Local Area Connection Properties, then selecting TCP/IPv4 and setting the sole preferred DNS server to the local hosts static IP (10.10.1.1). Search for "Your problems should clear up" for the post I'm referencing: http://forums.techarena.in/active-directory/1032797.htm Have I misunderstood their instructions? I am hoping to reach the point where I can define users and user groups. Also, does TechNet have a single theoretical overview document I could read. I really don't like treating comps as magic. I will be watching this closely and will quickly answer any questions. If I've left anything out it is because I did not know it was needed. PS: I am loath to ask obviously basic questions, but I am tired and wish to fix this before tomorrow. Also, this is my first server installation, thank you for your help.

    Read the article

  • Apple Service Diagnostic application on USB key?

    - by Matt 'Trouble' Esse
    I found the following in a text file, and I would like to use the Apple Service Diagnostic Application from a bootable USB key but I cannot find where to download it or set it up? Also is this free software or does it require a separate licence? It sounds like it would be a useful tool for diagnosing Mac problems. The Apple Service Diagnostic application is designed to run both EFI and Mac OS X tests from an external USB hard drive. Apple Service Diagnostic (EFI) runs low-level tests of the hardware directly and does not require Mac OS X, while Apple Service Diagnostic (OS) uses Mac OS X to run tests. Booting and Using the Apple Service Diagnostic Application - Before using Apple Service Diagnostic, disconnect any Ethernet network, USB, and audio cables. - With the USB hard drive containing ASD 3S123 plugged into a USB port, restart the computer and hold down the option key as the computer boots up into the Startup Manager. To run ASD (EFI) select the "ASD EFI 3S123" drive icon and press return or select it with a mouse click. To run ASD (OS) select the "ASD OS 3S123" drive icon and press return or select it with a mouse click. ASD (EFI) will load in 20-30 seconds; ASD (OS) will load in 2-3 minutes. - After running ASD (OS) or ASD (EFI), press the Restart button to restart the computer back into the normal startup volume, or hold down the option key to get back to the Startup Manager. ASD is no longer delivered as an image to be restored onto a DVD. ASD 3S117 and newer versions requires installation onto an external USB hard drive. For more information, please refer to the document "Installing ASD on a USB hard drive".

    Read the article

  • Apache2 with lighttpd as proxy

    - by andrzejp
    Hi, I am using apache2 as web server. I would like to help him lighttpd as a proxy for static content. Unfortunately I can not well set up lighttpd and apache2. (OS: Debian) Important things from lighttpd.config: server.modules = ( "mod_access", "mod_alias", "mod_accesslog", "mod_proxy", "mod_status", ) server.document-root = "/www/" server.port = 82 server.bind = "localhost" $HTTP["remoteip"] =~ "127.0.0.1" { alias.url += ( "/doc/" => "/usr/share/doc/", "/images/" => "/usr/share/images/" ) $HTTP["url"] =~ "^/doc/|^/images/" { dir-listing.activate = "enable" } } I would like to use lighttpd in only one site operating as a virtual directory on apache2. Configuration of this virtual directory: ProxyRequests Off ProxyPreserveHost On ProxyPass /images http://0.0.0.0:82/ ProxyPass /imagehosting http://0.0.0.0:82/ ProxyPass /pictures http://0.0.0.0:82/ ProxyPassReverse / http://0.0.0.0:82/ ServerName MY_VALUES ServerAlias www.MY_VALUES UseCanonicalName Off DocumentRoot /www/MYAPP/forum <Directory "/www/MYAPP/forum"> DirectoryIndex index.htm index.php AllowOverride None ... As you can see (or not;)) my service is physically located at the path: / www / myapp / forum and I would like to support lighttpd dealt with folders: / www / myapp / forum / images / www / myapp / forum / imagehosting / www / myapp / forum / pictures and left the rest (PHP scripts) for apache After running lighttpd and apache2 working party, but did not show up any images of these locations. What is wrong?

    Read the article

  • When to use Truecrypt, and when not to?

    - by tm77
    I have about 30 (this number will most likely grow over the next few years to 50 or more) unencrypted laptops that I have been tasked to encrypt (entire drive). These machines will be used off site regularly by my users. These machines are running Windows 7 and XP (about 50/50), but more Windows 7 every month. I have experience with Truecrypt, and have had no issues. It appears to be THE solution for a free solution. My concern with Truecrypt is that my users will have 2 passswords needed to login to their machines. Also, I need to choose to either have 1 password for my organization, or carefully document each machine's password (management nightmare). In my mind, choosing between a managed and a free encryption solution is primarily based on the NUMBER of machines that will be encrypted and supported. Two questions: From a management standpoint, what is the tipping point of users where a managed solution would pay for itself over Truecrypt? What are some good third party solutions? (I will consider Bitlocker, but the price to upgrade Windows 7 licenses is a turn-off) I would love to hear from some admins with experience in supporting encrypted machines in a corporate environment. Many thanks in advance!

    Read the article

  • Can not copy files from NTFS partition

    - by Ali
    I am experiencing a weird problem. I was running Xubuntu on my laptop until yesterday that I had to delete Xubuntu and install Windows. I had a NTFS partition on my Xubuntu that I kept some files on it. Today after installing windows I wanted to move all the files from that partition to an external HDD. I selected all files and folders and clicked on Copy, then I went to the HDD and clicked on paste but nothing happened. I can not do that. I do not know why. I copy the files, and wherever I click paste, nothing happens. If I try to copy the files and folders one by one, I can copy some of them, but some of them do not move. The other problem I have is that I can not open some files, in particular pdf files. When I click on pdf files I get this error: There was an error opening this document. This file cannot be found. Also, I cannot play some mp4 files. I can not open some jpg and txt files. I get this error The directory name is invalid. So in summary, after removing Xubuntu and installing windows 7 I have the following problems with one of the NTFS partitions on my internal drive: Can not copy or cut all folders and files from that partition to any other partition - I also do not get any errors. Can copy some folders and files Can not access some pdf, jpeg, txt and mp4 files and get the above errors. I should also mention I did not change anything for this partition during the installation or formatting the other partitions.

    Read the article

  • How this could happen to my ftp server?

    - by srisar
    hi, again me, i just dont get why i m getting this message, when i try to connect my ftp server thorugh my wan address (112.135.26.115) its saying me, 530 user access denied but when i give the same data to http://ftptest.net the result is as follows... Status: Resolving address of 112.135.26.115 Status: Connecting to 112.135.26.115 Status: Connected, waiting for welcome message Reply: 220-FileZilla Server version 0.9.34 beta Reply: 220-written by Tim Kosse ([email protected]) Reply: 220 Please visit http://sourceforge.net/projects/filezilla/ Status: CLNT http://ftptest.net on behalf of 112.135.26.115 Reply: 200 Don't care Status: USER saravana Reply: 331 Password required for saravana Status: PASS ********* Reply: 230 Logged on Status: SYST Reply: 215 UNIX emulated by FileZilla Status: FEAT Reply: 211-Features: Reply: MDTM Reply: REST STREAM Reply: SIZE Reply: MLST type*;size*;modify*; Reply: MLSD Reply: AUTH SSL Reply: AUTH TLS Reply: UTF8 Reply: CLNT Reply: MFMT Reply: 211 End Status: PWD Reply: 257 "/" is current directory. Status: Current path is / Status: TYPE I Reply: 200 Type set to I Status: PASV Reply: 227 Entering Passive Mode (112,135,26,115,43,9) Status: MLSD Reply: 150 Connection accepted Listing: type=dir;modify=20100322113235; it_is_working!_Andrejs_Cainikovs_from_serverfault.com Listing: type=file;modify=20100322110559;size=5; New Text Document.txt Reply: 226 Transfer OK Status: Success can anyone say why this happens to me? please im trying the whole day!!

    Read the article

  • Dynamic virtual host configuration in Apache

    - by Kostas Andrianopoulos
    I want to make a virtual host in Apache with dynamic configuration for my websites. For example something like this would be perfect. <VirtualHost *:80> AssignUserId $domain webspaces ServerName $subdomain.$domain.$tld ServerAdmin admin@$domain.$tld DocumentRoot "/home/webspaces/$domain.$tld/subdomains/$subdomain" <Directory "/home/webspaces/$domain.$tld/subdomains/$subdomain"> .... </Directory> php_admin_value open_basedir "/tmp/:/usr/share/pear/:/home/webspaces/$domain.$tld/subdomains/$subdomain" </VirtualHost> $subdomain, $domain, $tld would be extracted from the HTTP_HOST variable using regex at request time. No more loads of configuration, no more apache reloading every x minutes, no more stupid logic. Notice that I use mpm-itk (AssignUserId directive) so each virtual host runs as a different user. I do not intend to change this part. Since now I have tried: - mod_vhost_alias but this allows dynamic configuration of only the document root. - mod_macro but this still requires the arguments of the vhost to be declared explicitly for each vhost. - I have read about mod_vhs and other modules which store configuration in a SQL or LDAP server which is not acceptable as there is no need for configuration! Those 3 necessary arguments can be generated at runtime. - I have seen some Perl suggestions like this, but as the author states $s->add_config would add a directive after every request, thus leading to a memory leak, and $r->add_config seems not to be a feasible solution.

    Read the article

  • Which linux distributions offer seamless support for UEFI and an LVM root out of the box?

    - by Jannik Jochem
    My new ultrabook (an Asus UX32VD) requires UEFI in order to boot from the internal harddisk. I use an LVM partition which contains my root fs and dual-boot Windows 8. I somehow managed to get this working on Sabayon Linux, however the overall process was pretty painful, and system upgrades keep breaking my configuration because everything depends on a hand-configured kernel and a hand-crafted GRUB2 configuration. This causes a lot of hassle and distractions for me, so I am considering to switch to a different distribution. However, I cannot find any concrete resources that precisely document the state of UEFI support in the popular distributions. As an example, the length of the Ubuntu wiki page on UEFI suggests that installing on UEFI systems is a non-trivial process, and this AskUbuntu thread on encrypted LVM on UEFI systems suggests that LVM might also be a problem. I know that this question seems somewhat open-ended, so I'll formulate concrete questions: Are there any Linux distributions with an installer that supports installing to an LVM root in a UEFI boot setting where Windows 8 is dual-booted? Which distributions support UEFI without having to jump through hoops in order to bootstrap into a UEFI-booted system or requiring manual configuration of the boot manager?

    Read the article

  • Mystery Print Separator Page

    - by Jesse Bradlee
    Good morning! After a recent site upgrade to WebSphere 7.0 from 6.1 on an AIX server, our users reported a print separator page appearing on a certain type of report, and only on one printer. Trouble is, no one (devs, sysadmins, users) knows where it came from or where to turn it off. Based on the info, the first step was to check the app, but we don't have print separators in our code. The report they're using also lacks even an option to separate. Then I asked the WebSphere gurus but they shook their heads. Ditto the network/print server team. If anyone can identify the source of this separator, I can take that back to the relevant team and have it switched off. They look like this (some whitespace removed for brevity): *################################################## *################################################## *################################################## *************************************************** TITLE: [document name] TIME PRINTED: Fri Sep 20 08:21:45 2013 TIME QUEUED: Fri Sep 20 08:21:45 2013 PRINTED AT: hp@hp41 (generic) @ [app name] SUBMITTED BY: root DELIVER TO: =====> root <===== *************************************************** FLAG VALUES: a-0, b=0, d=a, f=, g=1, h=, i=0, j=+, l=00, p=10, t=0, v=6, w=3--, x=2, A=1, B=gn, C=!, H=, J=+, L=+, N=1, P=[printer name]:hp@hp41, X=ISO8859-1, Z=+, 0=ibm.850 *************************************************** Thank you!

    Read the article

  • Basic multicast network performance problems

    - by davedavedave
    I've been using mpong from 29west's mtools package to get some basic idea of multicast latency across various Cisco switches: 1Gb 2960G, 10Gb 4900M and 10Gb Nexus N5548P. The 1Gb is just for comparison. I have the following results for ~400 runs of mpong on each switch (sending 65536 "ping"-like messages to a receiver which then sends back -- all over multicast). Numbers are latencies measured in microseconds. Switch Average StdDev Min Max 2960 (1Gb) 109.68463 0.092816 109.4328 109.9464 4900M (10Gb) 705.52359 1.607976 703.7693 722.1514 NX 5548(10Gb) 58.563774 0.328242 57.77603 59.32207 The result for 4900M is very surprising. I've tried unicast ping and I see the 4900 has ~10us higher latency than the N5548P (average 73us vs 64us). Iperf (with no attempt to tune it) shows both 10Gb switches give me 9.4Gbps line speed. The two machines are connected to the same switch and we're not doing any multicast routing. OS is RHEL 6. 10Gb NICs are HP 10GbE PCI-E G2 Dual-port NICs (I believe they are rebranded Mellanox cards). The 4900 switch is used in a project with tight access control so I'm waiting for approval before I can access it and check the config. The other two I have full access to configure. I've looked at the Cisco document[2] detailing differences between NX-OS and IOS w.r.t multicast so I've got some ideas to try out but this isn't an area where I have much expertise. Does anyone have any idea what I should be looking at once I get access to the switch? [1] http://docwiki.cisco.com/wiki/Cisco_NX-OS/IOS_Multicast_Comparison

    Read the article

< Previous Page | 641 642 643 644 645 646 647 648 649 650 651 652  | Next Page >