Search Results

Search found 3864 results on 155 pages for 'split'.

Page 65/155 | < Previous Page | 61 62 63 64 65 66 67 68 69 70 71 72  | Next Page >

  • Creating a modular web app?

    - by Khou
    If i was to design this application in modules (ie split a large app in smaller modular applications) I might design it like this, is this correct? MainApplicaionX the following 5 modules? Company Customer Employee Supplier Banking if Not How would you create this into a modular app?

    Read the article

  • jquery autocomplete IE 9 not working

    - by Al3mor
    I am trying to autocomplete in a input, It is working fine in Chrome,Safari&Firefox . It is not working on IE 9 alone. Please help. $("#name").autocomplete({ select: function(event, iu) { id = event.toElement.innerText.split('-') $("#id_estudiante").val(id[1]); $("#FinancieroGrid").load('php/Financiero/librerias/FindStudent.php?action='+id[1].replace(' ','')); }, source:'php/Financiero/function/getstuden.php', minLength:1 });

    Read the article

  • vim plugin to show current Perl subroutine

    - by Andrew
    I'm trying to make a vim plugin that will split the window on load and simulate a info bar at the top of my terminal. I've got it sorta working but I think I've either reached limits of my knowledge of vim syntax or there's a logic problem in my code. The desired effect would be to do a reverse search for any declaration of a Perl subroutine form my current location in the active buffer and display the line in the top buffer. I'm also trying to make it skip that buffer when I switch buffers with <C-R>. My attempt at that so far can be seen in the mess of nested if statements. Anyway, here's the code. I would greatly appreciate feedback from anyone. (pastebin pastebin.com/8cuMPn1Q) let s:current_function_bufname = 'Current\ Function\/Subroutine' function! s:get_current_function_name(no_echo) let lnum = line(".") let col = col(".") if a:no_echo let s:current_function_name = getline(search("^[^s]sub .$", 'bW')) else echohl ModeMsg echo getline(search("^[^s]sub .$", 'bW')) "echo getline(search("^[^ \t#/]\{2}.[^:]\s$", 'bW')) echohl None endif endfunction let s:previous_winbufnr = 1 let s:current_function_name = '' let s:current_function_buffer_created = 0 let s:current_function_bufnr = 2 function! s:show_current_function() let total_buffers = winnr('$') let current_winbufnr = winnr() if s:previous_winbufnr != current_winbufnr if bufname(current_winbufnr) == s:current_function_bufname if s:previous_winbufnr < current_winbufnr let i = current_winbufnr + 1 if i total_buffers let i = 1 endif if i == s:current_function_bufnr let i = i + 1 endif if i total buffers let i = 1 endif exec i.'wincmd w' else let i = current_winbufnr - 1 if i < 1 let i = total_buffers endif if i == s:current_function_bufnr let i = i - 1 endif if i < 1 let i = total_buffers endif try exec i.'wincmd w' finally exec total_buffers.'wincmd w' endtry endif endif let s:previous_winbufnr = current_winbufnr return 1 endif if s:current_function_buffer_created == 0 exec 'top 1 split '.s:current_function_bufname call s:set_as_scratch_buffer() let s:current_function_buffer_created = 1 let s:current_function_bufnr = winnr() endif call s:activate_buffer_by_name(s:current_function_bufname) setlocal modifiable call s:get_current_function_name(1) call setline(1, s:current_function_name) setlocal nomodifiable call s:activate_buffer_by_name(bufname(current_winbufnr)) endfunction function! s:set_as_scratch_buffer() setlocal noswapfile setlocal nomodifiable setlocal bufhidden=delete setlocal buftype=nofile setlocal nobuflisted setlocal nonumber setlocal nowrap setlocal cursorline endfunction function! s:activate_buffer_by_name(name) for i in range(1, winnr('$')) let name = bufname(winbufnr(i)) let full_name = fnamemodify(bufname(winbufnr(i)), ':p') if name == a:name || full_name == a:name exec i.'wincmd w' return 1 endif endfor return 0 endfunction set laststatus=2 autocmd! CursorMoved,CursorMovedI,BufWinEnter * call s:show_current_function() (pastebin pastebin.com/8cuMPn1Q) similar to VIM: display custom reference bar on top of window and http://vim.wikia.com/wiki/Show_current_function_name_in_C_programs

    Read the article

  • Decode base64 data as array in Python

    - by skerit
    I'm using this handy Javascript function to decode a base64 string and get an array in return. This is the string: base64_decode_array('6gAAAOsAAADsAAAACAEAAAkBAAAKAQAAJgEAACcBAAAoAQAA') This is what's returned: 234,0,0,0,235,0,0,0,236,0,0,0,8,1,0,0,9,1,0,0,10,1,0,0,38,1,0,0,39,1,0,0,40,1,0,0 The problem is I don't really understand the javascript function: var base64chars = 'ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/'.split(""); var base64inv = {}; for (var i = 0; i < base64chars.length; i++) { base64inv[base64chars[i]] = i; } function base64_decode_array (s) { // remove/ignore any characters not in the base64 characters list // or the pad character -- particularly newlines s = s.replace(new RegExp('[^'+base64chars.join("")+'=]', 'g'), ""); // replace any incoming padding with a zero pad (the 'A' character is zero) var p = (s.charAt(s.length-1) == '=' ? (s.charAt(s.length-2) == '=' ? 'AA' : 'A') : ""); var r = []; s = s.substr(0, s.length - p.length) + p; // increment over the length of this encrypted string, four characters at a time for (var c = 0; c < s.length; c += 4) { // each of these four characters represents a 6-bit index in the base64 characters list // which, when concatenated, will give the 24-bit number for the original 3 characters var n = (base64inv[s.charAt(c)] << 18) + (base64inv[s.charAt(c+1)] << 12) + (base64inv[s.charAt(c+2)] << 6) + base64inv[s.charAt(c+3)]; // split the 24-bit number into the original three 8-bit (ASCII) characters r.push((n >>> 16) & 255); r.push((n >>> 8) & 255); r.push(n & 255); } // remove any zero pad that was added to make this a multiple of 24 bits return r; } What's the function of those "<<<" and "" characters. Or is there a function like this for Python?

    Read the article

  • MySQL create view from concat value

    - by cnotethegr8
    Lets say I have a table as follows, +----+-------------+ | id | value | +----+-------------+ | 1 | aa,bb,cc,dd | | 2 | ee,ff,gg,hh | +----+-------------+ I want to be able to search this table to see if id = 1 AND value = 'cc'. Im assuming a good way of doing this is to grab the id = 1 row and split its values into separate rows in a new view. Something like, +-----+ | val | +-----+ | aa | | bb | | cc | | dd | +-----+ I would like to do all of this in MySQL. How can i do this, and is there possibly a better way to do it?

    Read the article

  • If conditon showing alert even when the condition is false

    - by Adrian
    I have problem with if condition. I write a script who should showing alert when value from field #customer-age is less than 21 (the calculated age of person). The problem is - the alert is showing every time - when the value is less and greater than 21. My html code is: <div class="type-text"> <label for="birthday">Date1:</label> <input type="text" size="20" id="birthday" name="birthday" value="" readonly="readonly" /> </div> <div class="type-text"> <span id="customer-age" readonly="readonly"></span> </div> <span id="date_from_start">23/11/2012</span> and script looks like: function getAge() { var sday = $('#date_from_start').html(); var split_date1 = sday.split("/"); var todayDate = new Date(split_date1[2],split_date1[1] - 1,split_date1[0]); var bday = $('#birthday').val(); var split_date2 = bday.split("/"); var birthDate = new Date(split_date2[2],split_date2[1] - 1,split_date2[0]); var age = todayDate.getFullYear() - birthDate.getFullYear(); var m = todayDate.getMonth() - birthDate.getMonth(); if (m < 0 || (m === 0 && todayDate.getDate() < birthDate.getDate())) { age--; } return age; } var startDate = new Date("1935,01,01"); $('#birthday').datepicker({ dateFormat: 'dd/mm/yy', dayNamesMin: ['Nie', 'Pon', 'Wt', 'Sr', 'Czw', 'Pt', 'Sob'], dayNames: ['Niedziela','Poniedzialek','Wtorek','Sroda','Czwartek','Piatek','Sobota'], monthNamesShort: ['Sty', 'Lut', 'Mar', 'Kwi', 'Maj', 'Cze', 'Lip', 'Sie', 'Wrz', 'Paz', 'Lis', 'Gru'], changeMonth: true, changeYear: true, numberOfMonths: 1, constrainInput: true, firstDay: 1, dateFormat: 'dd/mm/yy', yearRange: '-77:-18', defaultDate: startDate, onSelect: function(dateText, inst) { $('#customer-age').html(getAge(new Date(dateText))); var cage = $('#customer-age').val(); if (cage < 21) { alert('< 21 year'); } else { } }, maxDate: +0 }); The workin code you can check on http://jsfiddle.net/amarcinkowski/DmYBt/

    Read the article

  • Detect if a key does is bound to something in vim

    - by WishCow
    I'd like to know if there is a way to figure out if a key does something in vim. I know that I can use :map to see user-defined mappings, but is there something for the built-in stuff? For example, I always had CTRL-W bound to close tab, because I thought that it was unused. After half a year, I found out that there are some sequences that use it, like CTRL-W CTRL-S to split the window, and it was a nightmare to retrain myself.

    Read the article

  • Control characters as delimiters

    - by Gio Borje
    I have a nodejs TCP server and a client. Basic network communication happens. Client sends "data + STX_CHARACTER + data + ETX_CHARACTER" (just an example). How do I split the string using the STX Control Character as a delimiter or how do I reference the character at all in Javascript.

    Read the article

  • Best practice to modularise a large Grails app?

    - by Mulone
    Hi all, A Grails app I'm working on is becoming pretty big, and it would be good to refactor it into several modules, so that we don't have to redeploy the whole thing every time. In your opinion, what is the best practice to split a Grails app in several modules? In particular I'd like to create a package of domain classes + relevant services and use it in the app as a module. Is this possible? Is it possible to do it with plugins? Cheers, Mulone

    Read the article

  • how to unpack the contents of a javascript file?

    - by altvali
    Hi all! You know how those packed js files look like, right? eval(function(p,a,c,k,e,d){ ... } ('obfuscated-string'.split('|'),0,{})) It just so happens to be that i have to tweak some large legacy code that looks like that and i want to find a way to turn this into a more readable version. If that's not possible, can i at least get rid of the eval?

    Read the article

  • Regular expression for pipe delimited and double quoted string

    - by Hiren Amin
    I have a string something like this: "2014-01-23 09:13:45|\"10002112|TR0859657|25-DEC-2013>0000000000000001\"|10002112" I would like to split by pipe apart from anything wrapped in double quotes so I have something like (similar to how csv is done): [0] => 2014-01-23 09:13:45 [1] => 10002112|TR0859657|25-DEC-2013>0000000000000001 [2] => 10002112 I would like to know if there is a regular expression that can do this?

    Read the article

  • What is a good way of Enhancing contrast of color images?

    - by erjik
    I split color image for 3 channels and made a contrast enhancement of each channel. Then merged them together, I like the image at the result, but it has different colors. Black objects became yellow and so on... EDIT: The algorithm I used is to calculate the 5th percentile and the 95th percentile as min and max values, and then expand the values of image so that it will have min and max values as 0 and 255. If there is a better approach please tell me.

    Read the article

  • How do I solve "405 Method Not Allowed" for our subversion setup?

    - by macke
    We're serving our source code using VisualSVN running on Windows Server 2003. Recently, we split a portion of a project into a new project in it's own repository, and then linked it back to the original project using svn:externals. Since then, we've been having issues when we try to commit files with Subclipse. The error we're getting is: svn: Commit failed (details follow): svn: PROPFIND of '/svn': 405 Method Not Allowed (https://svn.ourserver.com) Googling for a while didn't really help, our config seems to be correct. It should also be noted that we've been running this server for a while no without these problems and apart from splitting the project into two repositories, no changes have been made to the server (ie, config files are the same). It should also be noted that these errors only appear when we try to check in multiple files at once. If we check in one file at a time there are no errors. Also, it only appears in Subclipse as far as we know right now, Versions.app (OS X) seems to work fine so that is our current workaround. So, the questions is how do I analyze the error to find the cause and subsequently fix it? I'm by no means a svn guru and right now I'm clueless. EDIT: It seems we can check in multiple files in the same package, but not files from multiple packages. Also, when I "split" the project into two repositories, I imported the original repository with a new name. I did not do a dump and then import that dump. Could that be the source of our issues, and if so, how would I solve that? EDIT: After some jerking around it seems as though it is indeed related to when checking in files in different repositories. If I try to do a single commit in both Repo A and Repo B (referenced by svn:externals) at the same time, I get the error. Versions.app handles this correctly, but I guess it might just be doing two commits, not a single one. Subclipse fails miserably. For now, we simply do multiple commits, one for Repo A and one for Repo B, that works just fine. If anyone smarter than me could fill in the details why this is happening, whether or not this kind of setup is stupid etc, please go right ahead.

    Read the article

  • Extracting contents of ConnectionStrings in web.config in Silverlight Business application.

    - by webKite
    I am trying to read dataSource ad Catalog from connectionString in web.config in Silverlight business project. Unfortunately when I used "SqlConnectionStringBuilder", I could not read connectionstring the has "connectionString="metadata=res:///MainDatabase.Main.csdl|res:///MainDatabase.Main.ssdl|......."" where as it work for "connectionString="Data Source=My-PC\SQL_2008;Initial Catalog =...."". I could get them using "Split" however, I don't like that solution. Is there any way to get my requirements? Thanks

    Read the article

  • Proper two-level iPad UITableView

    - by Knodel
    I have an iPad app with split view. In the root view I need to make a two-level UITableView, so the UIWebView in the DetailView shows corresponding content. What I need is to make a two-level UITableView without editing, moving etc, so it can send the name of the selected row in the second level of the table to the DetailViewController. What is the best way to do it? Thanks in advance!

    Read the article

  • Javascript wont change value in TextBox

    - by mattgcon
    Here is my javascript function AppendValues(e) { var lghtcnt = 0; var vars = e.id.split(';'); var highcnt = false; var lghtid = ""; var maxltcnt = 100; for (var x = 0; x < vars.length; x++) { var tokens = vars[x].split('|'); var pram = tokens if (tokens[0] == "ID"){ lghtid = tokens[1]; } if (tokens[0] == "LTC"){ var itemcnt = 0; var currentcnt = 0; currentcnt = parseInt(tokens[1].toString()); var txtid = document.getElementById(vars[0] + ';' + vars[1] + ';' + vars[2] + ';' + vars[3] + ';' + vars[4]); if (e.checked) { totallightcnt += currentcnt; if (totallightcnt > maxltcnt) { document.getElementById(vars[0] + ';' + vars[1] + ';' + vars[2] + ';' + vars[3] + ';' + vars[4]).value = 0; alert('This puts you over the limit of 100 total lights, please make adjustments.'); break; } document.getElementById(vars[0] + ';' + vars[1] + ';' + vars[2] + ';' + vars[3] + ';' + vars[4]).value = currentcnt.toString(); } else { totallightcnt -= currentcnt; document.getElementById(vars[0] + ';' + vars[1] + ';' + vars[2] + ';' + vars[3] + ';' + vars[4]).value = 0; break; } } if (highcnt) { break; } } } Here is the issue, when I check the value it DOES say theupdated value but it does not display to the user on the webpage. What could be the issue?

    Read the article

  • working validation hint, working word counter but not working together

    - by Sriyani Rathnayaka
    I added a word counter to a my form's textarea... it is something like this... <div> <label>About you:</label> <textarea id="qualification" class="textarea hint_needed" rows="4" cols="30" ></textarea> <span class="hint">explain about you</span> <script type="text/javascript"> $("textarea").textareaCounter(); </script> </div> My problem is when I add textaracounter() like this my validation hint is not working.. when I remover the counter function validation hint is working... this is the jquery for hint message.. $(".hint").css({ "display":"none" }); $("input.hint_needed, select.hint_needed, textarea.hint_needed, radio.hint_needed").on("mouseenter", function() { $(this).next(".hint").css({ "display":"inline" }); }).on("mouseleave", function() { $(this).next(".hint").css({ "display":"none" }); }); this is for the word counter.. (function($){ $.fn.textareaCounter = function(options) { // setting the defaults // $("textarea").textareaCounter({ limit: 100 }); var defaults = { limit: 150 }; var options = $.extend(defaults, options); // and the plugin begins return this.each(function() { var obj, text, wordcount, limited; obj = $("#experience"); obj.after('<span style="font-weight: bold; color:#6a6a6a; clear: both; margin: 3px 0 0 150px; float: left; overflow: hidden;" id="counter-text">Max. '+options.limit+' words</span>'); obj.keyup(function() { text = obj.val(); if(text === "") { wordcount = 0; } else { wordcount = $.trim(text).split(" ").length; } if(wordcount > options.limit) { $("#counter-text").html('<span style="color: #DD0000;">0 words left</span>'); limited = $.trim(text).split(" ", options.limit); limited = limited.join(" "); $(this).val(limited); } else { $("#counter-text").html((options.limit - wordcount)+' words left'); } }); }); }; })(jQuery); can anybody tell me what is the problem there? Thank you..

    Read the article

  • How should I parse this simple text file in Java?

    - by Winston
    I have a text file that looks like this: grn129 agri- ac-214 ahss hud114 ahss lov1150 ahss lov1160 ahss lov1170 ahss lov1210 ahss What is the best way to parse this file using Java if I want to create a HashMap with the first column as the key and the second column as the value. Should I use the Scanner class? Try to read in the whole file as a string and split it? What is the best way?

    Read the article

  • Access Creates new file every time I Compact & Repair

    - by NickSentowski
    It didn't always do this, but ever since I split my database and made the front-end an ACCDE file, any time I try to compact and repair either file, a new file called "Database 1" is generated and my original file size doesn't change. Is this normal? My ACCDB is roughly 20MB, and my ACCDE is just over 1M after being used the first time. Before opening, the ACCDE was only 600k (I have lots of forms and queries, and regularly store PDF attachments.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Adding google.maps.latlng within a loop

    - by Mick Morrison
    I am new to Java Script. I am using it, in combination with Java Server Faces. I want to add some points to define a Polilyne using GoogleMaps Apiv3. My problem is that I can't add a FOR statement to the javascript, because it dumps. If I comment this FOR loop, it also dumps. The dump I am getting is: "javax.servlet.ServletException: null source". Has anyone any suggestion to solve this? Thanks in advance, Emanuel <script type="text/javascript"> function initialize() { var longit = "${dateRange.longitude}" ; var lat = "${dateRange.latitude}" ; var latlng = new google.maps.LatLng(lat, longit); var myOptions = { zoom: 15, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP }; var map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); var points = []; var cadena1 = "${dateRange.latArray}" ; var cadena2 = "${dateRange.longArray}" ; var latArray = cadena1.split('?'); var longArray = cadena2.split('?'); /* The code Below is the one that fails */ for (var i=0; i < latArray.length; i++) { points.push(new google.maps.LatLng(latArray[i], longArray[i])); } /* Finish of the error code */ // The Polilyne is created var mapPath = new google.maps.Polyline ({ path: points, strokeColor: "#FF0000", strokeOpacity: 1.0, strokeWeight: 4 }); mapPath.setMap(map); } </script> </head> <body onload="initialize()"> <h:graphicImage url="http://localhost:8080/gps_tracking/faces/resources/images/logo.jpg"> </h:graphicImage> <h1 align="center">Sol-Tech</h1><br /> <hr></hr> <div id="map_canvas" style="width:100%; height:100%"></div> </body>

    Read the article

< Previous Page | 61 62 63 64 65 66 67 68 69 70 71 72  | Next Page >