Search Results

Search found 38817 results on 1553 pages for 'inline function'.

Page 657/1553 | < Previous Page | 653 654 655 656 657 658 659 660 661 662 663 664  | Next Page >

  • what is the return value of BeautifulSoup.find ?

    - by prosseek
    I run to get some value as score. score = soup.find('div', attrs={'class' : 'summarycount'}) I run 'print score' to get as follows. <div class=\"summarycount\">524</div> I need to extract the number part. I used re module but failed. m = re.search("[^\d]+(\d+)", score) TypeError: expected string or buffer function search in re.py at line 142 return _compile(pattern, flags).search(string) What's the return type of the find function? How to get the number from the score variable? Is there any easy way to let BeautifulSoup to return the value(in this case 524) itself?

    Read the article

  • Filling a screen width

    - by lorna
    I'm really struggling to tidy up a web site I am building for someone. I've spent hours on trying to figure this out! I have limited knowledge so the code would be helpful. They want the section at the top (originally two images, now I'm trying background images and css) to fill the width of the browser- no matter what size it is. Does anyone know how to do this? Similarly, is there a setting to get text to fill 100% width of the box, no matter what? I would seriously appreciate even someone helping me move on a step! they want everything to sit tight and inline, in some browsers/screens it does but on mine it spreads out with lots of white space. www.thegees.co.uk is the site.

    Read the article

  • Code in Global.asax prevents webpage from loading

    - by pete the pagan-gerbil
    I've made a static class to hold a number of configuration values (and also swap these values out in unit tests). If I initialise it in the Global.asax, the code runs correctly but the page doesn't load at all, and trying to navigate to a specific page fails. I can't initialise the values in a constructor or inline on the field declarations, because I need to be able to swap the values out in unit tests before the web.config is interrogated. Basically, putting the one line "ConfigClass.SetValues()" in the Global.asax prevents the app from loading correctly (although, as I say, it runs the code fine) and removing it again makes the app load properly - but without the class values initialised. As an aside, I'm sure I had this working correctly and being initialised in the Global.asax yesterday. I'm positive I didn't take any action to change or break it... Does anyone have advice on how I might track down what's going on here? Was I mistaken that it worked before (always possible) and that I need to go back and redesign something?

    Read the article

  • How does an interpreter switch scope?

    - by Dox
    I'm asking this because I'm relatively new to interpreter development and I wanted to know some basic concepts before reinventing the wheel. I thought of the values of all variables stored in an array which makes the current scope, upon entering a function the array is swapped and the original array put on some sort of stack. When leaving the function the top element of the "scope stack" is popped of and used again. Is this basically right? Isn't swapping arrays (which means moving around a lot of data) not very slow and therefore not used by modern interpreters?

    Read the article

  • Slider with keypress control bugs when keys pressed to quickly.

    - by Jaybuz
    Hello, I've made a slider that uses the left and right arrow keys to move the slide but when pressed to quickly it will bug a little and I was wondering if it's possible to limit the amount of presses in say a second. You can see it here: {link} $('#slider-nav div').click(function() { $('#slider-nav div').removeClass('selected').addClass(''); $('#slider-nav div:eq('+($.jcarousel.intval($(this).text())-1)+')').addClass('selected'); }) // Allow left and right keys to control slider $(document.documentElement).keypress(function(e) { var code = (e.keyCode ? e.keyCode : e.which); var direction = null; // handle cursor keys if (code == 37) { // left key direction = 'prev'; } else if (code == 39) { // right key direction = 'next'; } if (direction != null) { $('#slider-nav div.selected')[direction]().click(); } });

    Read the article

  • jQuery click event still firing on filtered element

    - by Phil.Wheeler
    I'm trying to filter button events based on whether they have a CSS class assigned to them or not. Assume I have a button like this: <button id="save-button" class="ui-state-default ui-corner-all">Save</button> I want to get jQuery to select all buttons that currently do not have a class of "ui-state-disabled". The selector I'm using looks like this: $('#save-button:not(.ui-state-disabled)').click(function() { ... }); When the button is clicked, I'll call a different function, do some stuff and then add the class 'ui-state-disabled' to the button. However the button still continues to accept click events. I'm guessing this is because of two possible causes: The event binder looks only at the initial state when binding the click event and doesn't recognise that a new class has been added later on My filter ['... :not(.ui-state-disabled)] is not correct Any observations?

    Read the article

  • [PHP] preg_replace: replacing using %

    - by Juan
    Hi all, I'm using the function preg_replace but I cannot figure out how to make it work, the function just doesn't seem to work for me. What I'm trying to do is to convert a string into a link if any word contains the % (percentage) character. For instance if I have the string "go to %mysite", I'd like to convert the mysite word into a link. I tried the following... $data = "go to %mysite"; $result = preg_replace('/(^|[\s\.\,\:\;]+)%([A-Za-z0-9]{1,64})/e', '\\1%<a href=#>\\2</a>', $data); ...but it doesn't work. Any help on this would be much appreciated. Thanks Juan

    Read the article

  • How modify ascii table in C?

    - by drigoSkalWalker
    like this: My ASCII Chart 0 1 2 3 4 5 6 7 8 9 A B C D E F 0 NUL SOH STX ETX EOT ENQ ACK BEL BS HT LF VT FF CR SO SI 1 DLE DC1 DC2 DC3 DC4 NAK SYN ETB CAN EM SUB ESC FS GS RS US 2 SP ! " # $ % & ' ( ) * + , - . / 3 0 1 2 3 4 5 6 7 8 9 : ; ? 4 @ A B C D E F G H I J K L M N O 5 P Q R S T U V W X Y Z [ \ ] ^ _ 6 ` a b c d e f g h i j k l m n o 7 p q r s t u v w x y z { | } ~ DEL I want to call a function, alter the ascii sequence in this function and when it return, the ascii sequence back to the original. thanks in advance!

    Read the article

  • Server Error Message: No File Access

    - by iMayne
    Hello. Im having an issues but dont know where to solve it. My template works great in xampp but not on the host server. I get this message: Warning: file_get_contents() [function.file-get-contents]: URL file-access is disables in the server configuration in homepage/......./twitter.php. The error is on line 64. <?php /* For use in the "Parse Twitter Feeds" code below */ define("SECOND", 1); define("MINUTE", 60 * SECOND); define("HOUR", 60 * MINUTE); define("DAY", 24 * HOUR); define("MONTH", 30 * DAY); function relativeTime($time) { $delta = time() - $time; if ($delta < 2 * MINUTE) { return "1 min ago"; } if ($delta < 45 * MINUTE) { return floor($delta / MINUTE) . " min ago"; } if ($delta < 90 * MINUTE) { return "1 hour ago"; } if ($delta < 24 * HOUR) { return floor($delta / HOUR) . " hours ago"; } if ($delta < 48 * HOUR) { return "yesterday"; } if ($delta < 30 * DAY) { return floor($delta / DAY) . " days ago"; } if ($delta < 12 * MONTH) { $months = floor($delta / DAY / 30); return $months <= 1 ? "1 month ago" : $months . " months ago"; } else { $years = floor($delta / DAY / 365); return $years <= 1 ? "1 year ago" : $years . " years ago"; } } /* Parse Twitter Feeds */ function parse_cache_feed($usernames, $limit, $type) { $username_for_feed = str_replace(" ", "+OR+from%3A", $usernames); $feed = "http://twitter.com/statuses/user_timeline.atom?screen_name=" . $username_for_feed . "&count=" . $limit; $usernames_for_file = str_replace(" ", "-", $usernames); $cache_file = dirname(__FILE__).'/cache/' . $usernames_for_file . '-twitter-cache-' . $type; if (file_exists($cache_file)) { $last = filemtime($cache_file); } $now = time(); $interval = 600; // ten minutes // check the cache file if ( !$last || (( $now - $last ) > $interval) ) { // cache file doesn't exist, or is old, so refresh it $cache_rss = file_get_contents($feed); (this is line 64) Any help on how to give this access on my host server?

    Read the article

  • PHP combobox can't save the selected value on Edit Page

    - by bEtTy Barnes
    hello I've got problem with my combobox. It's not saving the selected value in Edit page. Here what I'm working with: private function inputCAR(){ $html = ""; $selectedId = $this->CAR; //$html .= '<option value="Roadmap Accelerator - Core">Roadmap Accelerator - Core</option>'; //$html .= '<option value="Roadmap Accelerator - Optional Core">Roadmap Accelerator - Optional Core</option>'; //$html .= '<option value="Regulatory">Regulatory</option>'; //$html .= '<option value="Mission Critical">Mission Critical</option>'; //$html .= '<option value="Various CARs/Types">Various CARs/types</option>'; $selection = array( "Roadmap Accelerator - Core", "Roadmap Accelerator - Optional Core", "Regulatory", "Mission Critical", "Various CARs/types" ); $html .= '<label for="car">CAR Type</label>'; $html .= HTML::selectStart("car"); foreach($selection as $value){ $text = $value; $html .= HTML::option($value, $text, $selectedId == $value ? true : false); } $html .= HTML::selectEnd(); return $html; } My option function: public static function option($value, $text, $isSelected=false) { $html = '<option value="' . $value . '"'; if($isSelected) { $html .= ' selected="selected"'; } $html .= '>'; $html .= $text; $html .= '</option>'; return $html; } When I first created a record. The selected value from my combobox got saved into the DB then the page refreshed to display. When I went to edit page, to select another value, and clicked save button. On the display page, it's not saving. For example. on Create page I selected Regulatory. then I changed my mind and changed it to Mission Critical on Edit page. On display page it is not changed. I don't know what's wrong or what I'm missing here. Any help is welcome and truly appreciated. Thanks.

    Read the article

  • flash cs4 file reference. Event.COMPLETE not called on a MAC,

    - by jobbie jones
    Hi, I am working with a fileReference, however I'm having issues running on Safari on a MAC... EDIT The below example also doesnt work on Safari on a MAC... http://www.permadi.com/blog/2010/06/flash-as3-using-filereference-to-load-files-example-for-flash-cs4-and-above/ # The workflow on a PC runs as such: 1) Create file reference 2) attach addEventListener's for Event.SELECT and Event.COMPLETE 3) call the browse() method On a PC, Event.SELECT is fired when a file has been selected. Event.COMPLETE is fired when the file data is available to flash. If I select an 500meg file, it takes a few seconds before Event.COMPLETE is fired. If I attempt to access the file data properties (such as reading the data stream) before Event.COMPLETE is fired, I receive null reference errors... So far so good. However, on a MAC (speficially Safari, not tested other browsers), the Event.COMPLETE is not fired. I have checked the Adobe docs, which say Event.COMPLETE is fired when the upload is completed. So why does it get fired on windows when the fileReference has parsed the file, but the upload method has not yet been called... Can anyone help? Here's snippets of the code I am working on: public function browseFile(target:Object):void { var imagesFilter:FileFilter = new FileFilter("Allowed files", "*.jpg;*.bmp;*.flv;"); fileReference.browse([imagesFilter]); fileReference.addEventListener(Event.SELECT, fileSelect); fileReference.addEventListener(Event.COMPLETE, fileSelectComplete); } private function fileSelect(event:Event):void { // update label - IMPORTANT for large files as there's a delay while flash parses file, before control is handed back to this script... setStatusLabel("...loading file"); var fileReference:FileReference = event.target as FileReference; fileReference.addEventListener(Event.COMPLETE, fileSelectComplete); // load the file into the fileReference object fileReference.load(); } // Called when upload file has been processed by flash (a few secs for large files, or fileRef.data is null...) private function fileSelectComplete(event:Event):void { var fileReference:FileReference=event.target as FileReference; trace("ready to do things - but not fired on Safari on a MAC "); }

    Read the article

  • Fullscreen image with jquery on window resize?

    - by lauthiamkok
    I am trying to make fullscreen images with jquery when the window resize function is triggered. But I get this kind of result - where you can see a gap at the bottom of the image which I don't know how to fix it. the basic html, <!-- container --> <div id="container" class="container"> <div class="holder-supersize" id="supersize"> <ul class="background-supersize"> <li><a href="#"><img src="styles/images/IMG_0250.jpg" alt="" width="1000" height="667" /></a></li> <li><a href="#"><img src="styles/images/IMG_0255.jpg" alt="" width="667" height="1000" /></a></li> <li class="active"><a href="#"><img src="styles/images/IMG_0323.jpg" alt="" width="1158" height="772" /></a></li> </ul> </div> </div> <!-- container --> jquery for updating image size on window resize, $(document).ready(function(){ $(window).resize(function(){ $(".holder-supersize").each(function() { //Define image ratio & minimum dimensions var minwidth = .5*(640); var minheight = .5*(480); var ratio = 480/640; //Gather browser and current image size var imagewidth = $(this).width(); var imageheight = $(this).height(); var browserwidth = $(window).width(); var browserheight = $(window).height(); //Check for minimum dimensions if ((browserheight < minheight) && (browserwidth < minwidth)){ $(this).height(minheight); $(this).width(minwidth); } else { //When browser is taller if (browserheight > browserwidth){ imageheight = browserheight; $(this).height(browserheight); imagewidth = browserheight/ratio; $(this).width(imagewidth); if (browserwidth > imagewidth){ imagewidth = browserwidth; $(this).width(browserwidth); imageheight = browserwidth * ratio; $(this).height(imageheight); } } //When browser is wider if (browserwidth >= browserheight){ imagewidth = browserwidth; $(this).width(browserwidth); imageheight = browserwidth * ratio; $(this).height(imageheight); if (browserheight > imageheight){ imageheight = browserheight; $(this).height(browserheight); imagewidth = browserheight/ratio; $(this).width(imagewidth); } } } return false; }); }); }); CSS for supersize image /* Supersize -------------------------------------------*/ .holder-supersize { width:100%; height:100%; position:absolute; left:0; top:0; z-index:0; } .background-supersize { width:100%; height:100%; overflow:hidden; position:relative; } .background-supersize li { width:100%; height:100%; overflow:hidden; position:absolute; left:0; top:0; text-align:center; } .background-supersize li img { /* for image with height < width */ /**/ width:100%; height:auto; /* for image with height > width */ /* width:auto; height:100%; */ } .background-supersize li , .background-supersize a, .background-supersize img{ display:none; } .background-supersize .active, .background-supersize .active a, .background-supersize .active img{ display:inline; } This is the link at jsfiddle and this is the link to see the actual product. Any ideas what I have done wrong and how can I fix it?

    Read the article

  • Mocking imported modules in Python

    - by Evgenyt
    I'm trying to implement unit tests for function that uses imported external objects. For example helpers.py is: import os import pylons def some_func(arg): ... var1 = os.path.exist(...) var2 = os.path.getmtime(...) var3 = pylons.request.environ['HTTP_HOST'] ... So when I'm creating unit test for it I do some mocking (minimock in my case) and replacing references to pylons.request and os.path: import helpers def test_some_func(): helpers.pylons.request = minimock.Mock("pylons.request") helpers.pylons.request.environ = { 'HTTP_HOST': "localhost" } helpers.os.path = minimock.Mock(....) ... some_func(...) # assert ... This does not look good for me. Is there any other better way or strategy to substitute imported function/objects in Python?

    Read the article

  • Inverse relationship of two variables

    - by Jam
    this one is maybe pretty stupid.. Or I am just exhausted or something, but I just cant seem to solve it.. Problem : two variables X and Y, value of Y is dependent on value of X. X can have values ranging from some value to some value (lets say from 0 to 250) and y can have different values (lets say from 0.1 to 1.0 or something..) - but it is inverse relatonship (what I mean is: if value of X is e.g. 250, then value of Y would be 0.1 and when X decreases up to 0, value of Y raises up to 1.0.. So how should I do it? lets say I have function: -- double computeValue (double X) { /computation/ return Y; } Also, is there some easy way to somehow make the scaling of the function not so linear? - For example when X raises, Y decreases slower at first but then more rapidly in the end.. (rly dont know how to say it but I hope you guys got it) Thanks in advance for this stupid question :/

    Read the article

  • Sifr Font last word get cut in IE8

    - by Asif Kilwani
    Sifr 3 font cut last word in IE8. Click here for snapshot Following is the js code <script type="text/javascript"> var cochin = { src: '<?=jsPath?>sifr/fonts/eurostile.swf' ,ratios: [7, 1.32, 11, 1.31, 13, 1.24, 14, 1.25, 19, 1.23, 27, 1.2, 34, 1.19, 42, 1.18, 47, 1.17, 48, 1.18, 69, 1.17, 74, 1.16, 75, 1.17, 1.16] }; sIFR.activate(cochin); sIFR.replace(cochin, { selector: 'h1' ,css: [ '.sIFR-root { font-weight: bold; font-size:31px; color:#848484; text-transform:uppercase; display:inline;}' ] ,wmode: 'transparent' }); sIFR.fitExactly = true; sIFR.forceWidth = true; </script>

    Read the article

  • approximating log10[x^k0 + k1]

    - by Yale Zhang
    Greetings. I'm trying to approximate the function Log10[x^k0 + k1], where .21 < k0 < 21, 0 < k1 < ~2000, and x is integer < 2^14. k0 & k1 are constant. For practical purposes, you can assume k0 = 2.12, k1 = 2660. The desired accuracy is 5*10^-4 relative error. This function is virtually identical to Log[x], except near 0, where it differs a lot. I already have came up with a SIMD implementation that is ~1.15x faster than a simple lookup table, but would like to improve it if possible, which I think is very hard due to lack of efficient instructions. My SIMD implementation uses 16bit fixed point arithmetic to evaluate a 3rd degree polynomial (I use least squares fit). The polynomial uses different coefficients for different input ranges. There are 8 ranges, and range i spans (64)2^i to (64)2^(i + 1). The rational behind this is the derivatives of Log[x] drop rapidly with x, meaning a polynomial will fit it more accurately since polynomials are an exact fit for functions that have a derivative of 0 beyond a certain order. SIMD table lookups are done very efficiently with a single _mm_shuffle_epi8(). I use SSE's float to int conversion to get the exponent and significand used for the fixed point approximation. I also software pipelined the loop to get ~1.25x speedup, so further code optimizations are probably unlikely. What I'm asking is if there's a more efficient approximation at a higher level? For example: Can this function be decomposed into functions with a limited domain like log2((2^x) * significand) = x + log2(significand) hence eliminating the need to deal with different ranges (table lookups). The main problem I think is adding the k1 term kills all those nice log properties that we know and love, making it not possible. Or is it? Iterative method? don't think so because the Newton method for log[x] is already a complicated expression Exploiting locality of neighboring pixels? - if the range of the 8 inputs fall in the same approximation range, then I can look up a single coefficient, instead of looking up separate coefficients for each element. Thus, I can use this as a fast common case, and use a slower, general code path when it isn't. But for my data, the range needs to be ~2000 before this property hold 70% of the time, which doesn't seem to make this method competitive. Please, give me some opinion, especially if you're an applied mathematician, even if you say it can't be done. Thanks.

    Read the article

  • highlight query string in more than one field using solr search feature

    - by Romi
    i am using solr indexes for showing my search results. to show serch results i am parsing json data received from solr. i am able to highlight a query string in search result but only in a single field. for this i set hl=true and hl.fl="field1". i did it as $.getJSON("http://192.168.1.9:8983/solr/db/select/?wt=json&&start=0&rows=100&q="+lowerCaseQuery+"&hl=true&hl.fl=description,name&hl.usePhraseHighlighter=true&sort=price asc&json.wrf=?", function(result){ var n=result.response.numFound var highlight = new Array(n); $.each(result.highlighting, function(i, hitem){ var match = hitem.text[0].match(/<em>(.*?)<\/em>/); highlight[i]=match[1]; }); $.each(newresult.response.docs, function(i,item){ var word=highlight[item["UID_PK"]]; var result = item.text[0].replace(new RegExp(word,'g'), '<em>' + word + '</em>'); }); for this json object is as : { "responseHeader": { "status": 0, "QTime": 32 }, "response": { "numFound": 21, "start": 0, "docs": [ { "description": "The matte finish waves on this wedding band contrast with the high polish borders. This sharp and elegant design was finely crafted in Japan.", "UID_PK": "8252", }, { "description": "This elegant ring has an Akoya cultured pearl with a band of bezel-set round diamonds making it perfect for her to wear to work or the night out.", "UID_PK": "8142", }, ] }, "highlighting": { "8252": { "description": [ " and <em>elegant</em> design was finely crafted in Japan." ] }, "8142": { "description": [ "This <em>elegant</em> ring has an Akoya cultured pearl with a band of bezel-set round diamonds making" ] }, } } Now if i want to highlight query string in two fields i did as hl=true hl.fl=descrption, name my json is as: { "responseHeader":{ "status":0, "QTime":16 }, "response":{ "numFound":1904, "start":0, "docs":[ { "description":"", "UID_PK":"7780", "name":[ "Diamond bracelet with Milgrain Bezel1" ] }, { "description":"This pendant is sure to win hearts. Round diamonds form a simple and graceful line.", "UID_PK":"8121", "name":[ "Heartline Diamond Pendant" ] }, "highlighting":{ "7780":{ "name":[ "<em>Diamond</em> bracelet with Milgrain Bezel1" ] }, "8121":{ "description":[ "This pendant is sure to win hearts. Round <em>diamonds</em> form a simple and graceful line." ], "name":[ "Heartline <em>Diamond</em> Pendant" ] } } } Now how should i parse it to get the result. suggest me some general technique, so if i want to highlight query in more fields then i could do so. Thanks

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Logical python question - handeling directories and files in them

    - by Konstantin
    Hello! I'm using this function to extract files from .zip archive and store it on the server: def unzip_file_into_dir(file, dir): import sys, zipfile, os, os.path os.makedirs(dir, 0777) zfobj = zipfile.ZipFile(file) for name in zfobj.namelist(): if name.endswith('/'): os.mkdir(os.path.join(dir, name)) else: outfile = open(os.path.join(dir, name), 'wb') outfile.write(zfobj.read(name)) outfile.close() And the usage: unzip_file_into_dir('/var/zips/somearchive.zip', '/var/www/extracted_zip') somearchive.zip have this structure: somearchive.zip 1.jpeg 2.jpeg another.jpeg or, somethimes, this one: somearchive.zip somedir/ 1.jpeg 2.jpeg another.jpeg Question is: how do I modify my function, so that my extracted_zip catalog would always contain just images, not images in another subdirectory, even if images are stored in somedir inside an archive.

    Read the article

  • If we don't like it for the presentation layer, then why do we tolerate it for the behavior layer?

    - by greim
    Suppose CSS as we know it had never been invented, and the closest we could get was to do this: <script> // this is the page's stylesheet $(document).ready(function(){ $('.error').css({'color':'red'}); $('a[href]').css({'textDecoration':'none'}); ... }); </script> If this was how we were forced to write code, would we put up with it? Or would every developer on Earth scream at browser vendors until they standardized upon CSS, or at least some kind of declarative style language? Maybe CSS isn't perfect, but hopefully it's obvious how it's better than the find things, do stuff method shown above. So my question is this. We've seen and tasted of the glory of declarative binding with CSS, so why, when it comes to the behavioral/interactive layer, does the entire JavaScript community seem complacent about continuing to use the kludgy procedural method described above? Why for example is this considered by many to be the best possible way to do things: <script> $(document).ready(function(){ $('.widget').append("<a class='button' href='#'>...</div>"); $('a[href]').click(function(){...}); ... }); </script> Why isn't there a massive push to get XBL2.0 or .htc files or some kind of declarative behavior syntax implemented in a standard way across browsers? Is this recognized as a need by other web development professionals? Is there anything on the horizon for HTML5? (Caveats, disclaimers, etc: I realize that it's not a perfect world and that we're playing the hand we've been dealt. My point isn't to criticize the current way of doing things so much as to criticize the complacency that exists about the current way of doing things. Secondly, event delegation, especially at the root level, is a step closer to having a declarative behavior layer. It solves a subset of the problem, but it can't create UI elements, so the overall problem remains.)

    Read the article

  • Validate zip and display error with onBlur event

    - by phil
    Check if zip is 5 digit number, if not then display 'zip is invalid'. I want to use onBlur event to trigger the display. But it's not working. <script> $(function(){ function valid_zip() { var pat=/^[0-9]{5}$/; if ( !pat.test( $('#zip').val() ) ) {$('#zip').after('<p>zip is invalid</p>');} } }) </script> zip (US only) <input type="text" name='zip' id='zip' maxlength="5" onBlur="valid_zip()">

    Read the article

  • Passing an array for setting variable

    - by mathk
    Hi, I often see this idiom when reading php code: public function __construct($config) { if (array_key_exists('options', $config)) { ... } if (array_key_exists('driver_options', $config)) { ... } } Here I am concern with the way the parameter is used. If I were in lisp I would do: (defun ct (&key options driver_options) (do-something-with-option-and-driver_option)) But since I am in PHP I would rather have a constructor that take a list of parameter and let them be null if there a not require. So what do you guys think about having an array as parameter in other to do some initialization-or-whatever? In other to answer you have to take in account the point of view of the user of the function and the designer of the API. Also have you ever heard this has a code-smell? thanks

    Read the article

  • WordPress + Facebook comments addition (php knowledge needed)

    - by user1356223
    I succeded to fetch Facebok comments number via this function: <?php function fb_comment_count() { global $post; $url = get_permalink($post->ID); $filecontent = file_get_contents('https://graph.facebook.com/?ids=' . $url); $json = json_decode($filecontent); $count = $json->$url->comments; if ($count == 0 || !isset($count)) { $count = 0; } echo $count; } ;?> And I call it with: <?php fb_comment_count();?> Now how do I add it to this code: <?php comments_number(__('No Comments'), __('1 Comment'), __('% Comments'), '', __('Comments Closed') ); ?> so that WordPress shows number of WP and FB comments together in one number. Thank you very much to everyone!

    Read the article

  • XQuery fn:replace not behaving as expected

    - by CoolGravatar
    I have an Excel worksheet in XML format which contains <Cell ss:StyleID="s127"><Data ss:Type="String">A01-Replace</Data></Cell> I want to replace @A01-Replace with a different string. I'm using the XQuery's replace function like so: let $excel := doc("excel.xml") let $test := "another string" return replace($excel, "(A[0-9]+-Replace)", $test) Before calling replace, the variable $excel is valid XML upon output. However, when I output $excel after I call the replace function, all of the XML tags have been stripped, and $excel is a string with the content of the cells as its values. I would like to keep the XML tags there. Any ideas?

    Read the article

  • GLKit Memory Leak copywithZone

    - by TommyT39
    Running the instruments utility against the game I'm writing shows a bunch of memory leaks related to copy with Zone when I cycle through an array and draw some simple cube objects. Im not sure the best way to track this down as I'm new to OpenGL programming. My program is using ARC and is set to build for IOS 5. I am initializing GLKit to use OPenGl 2.0 and using the BafeEffect so I don't have to write my own shaders etc.. This shouldn't be rocket science. Im guessing that I must be not releasing something within the draw function. Below is the code to my draw function. Could you guys take a look and see if anything stands out as the problem? One other thing to note is that I'm using 15 different textures, the cubes can be 1 of 15 different ones. I have a property set on the cube class for the texture and I set it as I create the cube in there array. But I do load all 15 when my programs view did load starts.They are small .jps files that are less than 75k each and each cube uses the same texture all the way around so shouldn't be too big of an issue. Here is the code to my draw function: - (void)draw { GLKMatrix4 xRotationMatrix = GLKMatrix4MakeXRotation(rotation.x); GLKMatrix4 yRotationMatrix = GLKMatrix4MakeYRotation(rotation.y); GLKMatrix4 zRotationMatrix = GLKMatrix4MakeZRotation(rotation.z); GLKMatrix4 scaleMatrix = GLKMatrix4MakeScale(scale.x, scale.y, scale.z); GLKMatrix4 translateMatrix = GLKMatrix4MakeTranslation(position.x, position.y, position.z); GLKMatrix4 modelMatrix = GLKMatrix4Multiply(translateMatrix,GLKMatrix4Multiply(scaleMatrix,GLKMatrix4Multiply(zRotationMatrix, GLKMatrix4Multiply(yRotationMatrix, xRotationMatrix)))); GLKMatrix4 viewMatrix = GLKMatrix4MakeLookAt(0, 0, 1, 0, 0, -5, 0, 1, 0); effect.transform.modelviewMatrix = GLKMatrix4Multiply(viewMatrix, modelMatrix); effect.transform.projectionMatrix = GLKMatrix4MakePerspective(0.125*M_TAU, 1.0, 2, 0); effect.texture2d0.name = wallTexture.name; [effect prepareToDraw]; glEnable(GL_DEPTH_TEST); glEnable(GL_CULL_FACE); glEnableVertexAttribArray(GLKVertexAttribPosition); glVertexAttribPointer(GLKVertexAttribPosition, 3, GL_FLOAT, GL_FALSE, 0, triangleVertices); glEnableVertexAttribArray(GLKVertexAttribTexCoord0); glVertexAttribPointer(GLKVertexAttribTexCoord0, 2, GL_FLOAT, GL_FALSE, 0, textureCoordinates); glDrawArrays(GL_TRIANGLES, 0, 18); glDisableVertexAttribArray(GLKVertexAttribPosition); glDisableVertexAttribArray(GLKVertexAttribTexCoord0); }

    Read the article

< Previous Page | 653 654 655 656 657 658 659 660 661 662 663 664  | Next Page >