Search Results

Search found 43847 results on 1754 pages for 'command line arguments'.

Page 658/1754 | < Previous Page | 654 655 656 657 658 659 660 661 662 663 664 665  | Next Page >

  • .htaccess rewrite subdomains

    - by Cyclone
    Here is my current code: RewriteCond %{HTTP_HOST} !^example\.com [NC] #RewriteCond %{REQUEST_URI}!^something RewriteCond %{HTTP_HOST} ^([^.]+)\.example\.com RewriteRule (.*) something/%1/$1 [QSA,L] My goal is to rewrite http://*.example.com/whatever to http://example.com/something/*/whatever, assuming * is the same for both and whatever is the same for both. However, I believe this is causing an infinite loop somehow, so I added that commented out line (RewriteBase is / btw), but if I uncomment then the entire site is a 500 response code. Without that line, only the subdomains error. What am I doing wrong, and how can I fix this? I have already configured the server so anything gets redirected to my public_html folder. EDIT: For clarification, I am trying to do an internal redirect, not external. EDIT: There is not a flag for internal redirect it seems. Is there any place I can see the actual error message for the broken rewriterule? If I knew what was wrong I would be able to stand a better chance of fixing it.

    Read the article

  • How to invoke a method with a generic return type using reflection

    - by Andre Luus
    Hi there! I'm trying to invoke a method with reflection that has a generic return type, like this: public class SomeClass<T> { public List<T> GetStuff(); } I get an instance of SomeClass with a call to a Repository's GetClass<T> generic method. MethodInfo lGetSomeClassMethodInfo = typeof(IRepository) .GetMethod("GetClass") .MakeGenericMethod(typeof(SomeClass<>); object lSomeClassInstance = lGetSomeClassMethodInfo.Invoke( lRepositoryInstance, null); After that, I this is where I try to invoke the GetStuff method: typeof(SomeClass<>).GetMethod("GetStuff").Invoke(lSomeClassInstance, null) I get an exception about the fact that the method has generic arguments. However, I can't use MakeGenericMethod to resolve the return type. Also, if instead of typeof(SomeClass<>) I use lSomeClassInstance.GetType() (which should have resolved types) GetMethod("GetStuff") returns null! UPDATE I have found the solution and will post the answer shortly.

    Read the article

  • Python - werid behavior

    - by orokusaki
    I've done what I shouldn't have done and written 4 modules (6 hours or so) without running any tests along the way. I have a method inside of /mydir/__init__.py called get_hash(), and a class inside of /mydir/utils.py called SpamClass. /mydir/utils.py imports get_hash() from /mydir/__init__. /mydir/__init__.py imports SpamClass from /mydir/utils.py. Both the class and the method work fine on their own but for some reason if I try to import /mydir/, I get an import error saying "Cannot import name get_hash" from /mydir/__init__.py. The only stack trace is the line saying that __init__.py imported SpamClass. The next line is where the error occurs in in SpamClass when trying to import get_hash. Why is this?

    Read the article

  • MUD (game) design concept question about timed events.

    - by mudder
    I'm trying my hand at building a MUD (multiplayer interactive-fiction game) I'm in the design/conceptualizing phase and I've run into a problem that I can't come up with a solution for. I'm hoping some more experienced programmers will have some advice. Here's the problem as best I can explain it. When the player decides to perform an action he sends a command to the server. the server then processes the command, determines whether or not the action can be performed, and either does it or responds with a reason as to why it could not be done. One reason that an action might fail is that the player is busy doing something else. For instance, if a player is mid-fight and has just swung a massive broadsword, it might take 3 seconds before he can repeat this action. If the player attempts to swing again to soon, the game will respond indicating that he must wait x seconds before doing that. Now, this I can probably design without much trouble. The problem I'm having is how I can replicate this behavior from AI creatures. All of the events that are being performed by the server ON ITS OWN, aka not as an immediate reaction to something a player has done, will have to be time sensitive. Some evil monster has cast a spell on you but must wait 30 seconds before doing it again... I think I'll probably be adding all these events to some kind of event queue, but how can I make that event queue time sensitive?

    Read the article

  • Bash or python for changing spacing in files

    - by Werner
    Hi, I have a set of 10000 files. In all of them, the second line, looks like: AAA 3.429 3.84 so there is just one space (requirement) between AAA and the two other columns. The rest of lines on each file are completely different and correspond to 10 columns of numbers. Randomly, in around 20% of the files, and due to some errors, one gets BBB 3.429 3.84 so now there are two spaces between the first and second column. This is a big error so I need to fix it, changing from 2 to 1 space in the files where the error takes place. The first approach I thought of was to write a bash script that for each file reads the 3 values of the second line and then prints them with just one space, doing it for all the files. I wonder what do oyu think about this approach and if you could suggest something better, bashm python or someother approach. Thanks

    Read the article

  • Access violation using LocalAlloc()

    - by PaulH
    I have a Visual Studio 2008 Windows Mobile 6 C++ application that is using an API that requires the use of LocalAlloc(). To make my life easier, I created an implementation of a standard allocator that uses LocalAlloc() internally: /// Standard library allocator implementation using LocalAlloc and LocalReAlloc /// to create a dynamically-sized array. /// Memory allocated by this allocator is never deallocated. That is up to the /// user. template< class T, int max_allocations > class LocalAllocator { public: typedef T value_type; typedef size_t size_type; typedef ptrdiff_t difference_type; typedef T* pointer; typedef const T* const_pointer; typedef T& reference; typedef const T& const_reference; pointer address( reference r ) const { return &r; }; const_pointer address( const_reference r ) const { return &r; }; LocalAllocator() throw() : c_( NULL ) { }; /// Attempt to allocate a block of storage with enough space for n elements /// of type T. n>=1 && n<=max_allocations. /// If memory cannot be allocated, a std::bad_alloc() exception is thrown. pointer allocate( size_type n, const void* /*hint*/ = 0 ) { if( NULL == c_ ) { c_ = LocalAlloc( LPTR, sizeof( T ) * n ); } else { HLOCAL c = LocalReAlloc( c_, sizeof( T ) * n, LHND ); if( NULL == c ) LocalFree( c_ ); c_ = c; } if( NULL == c_ ) throw std::bad_alloc(); return reinterpret_cast< T* >( c_ ); }; /// Normally, this would release a block of previously allocated storage. /// Since that's not what we want, this function does nothing. void deallocate( pointer /*p*/, size_type /*n*/ ) { // no deallocation is performed. that is up to the user. }; /// maximum number of elements that can be allocated size_type max_size() const throw() { return max_allocations; }; private: /// current allocation point HLOCAL c_; }; // class LocalAllocator My application is using that allocator implementation in a std::vector< #define MAX_DIRECTORY_LISTING 512 std::vector< WIN32_FIND_DATA, LocalAllocator< WIN32_FIND_DATA, MAX_DIRECTORY_LISTING > > file_list; WIN32_FIND_DATA find_data = { 0 }; HANDLE find_file = ::FindFirstFile( folder.c_str(), &find_data ); if( NULL != find_file ) { do { // access violation here on the 257th item. file_list.push_back( find_data ); } while ( ::FindNextFile( find_file, &find_data ) ); ::FindClose( find_file ); } // data submitted to the API that requires LocalAlloc()'d array of WIN32_FIND_DATA structures SubmitData( &file_list.front() ); On the 257th item added to the vector<, the application crashes with an access violation: Data Abort: Thread=8e1b0400 Proc=8031c1b0 'rapiclnt' AKY=00008001 PC=03f9e3c8(coredll.dll+0x000543c8) RA=03f9ff04(coredll.dll+0x00055f04) BVA=21ae0020 FSR=00000007 First-chance exception at 0x03f9e3c8 in rapiclnt.exe: 0xC0000005: Access violation reading location 0x01ae0020. LocalAllocator::allocate is called with an n=512 and LocalReAlloc() succeeds. The actual Access Violation exception occurs within the std::vector< code after the LocalAllocator::allocate call: 0x03f9e3c8 0x03f9ff04 > MyLib.dll!stlp_std::priv::__copy_trivial(const void* __first = 0x01ae0020, const void* __last = 0x01b03020, void* __result = 0x01b10020) Line: 224, Byte Offsets: 0x3c C++ MyLib.dll!stlp_std::vector<_WIN32_FIND_DATAW,LocalAllocator<_WIN32_FIND_DATAW,512> >::_M_insert_overflow(_WIN32_FIND_DATAW* __pos = 0x01b03020, _WIN32_FIND_DATAW& __x = {...}, stlp_std::__true_type& __formal = {...}, unsigned int __fill_len = 1, bool __atend = true) Line: 112, Byte Offsets: 0x5c C++ MyLib.dll!stlp_std::vector<_WIN32_FIND_DATAW,LocalAllocator<_WIN32_FIND_DATAW,512> >::push_back(_WIN32_FIND_DATAW& __x = {...}) Line: 388, Byte Offsets: 0xa0 C++ MyLib.dll!Foo(unsigned long int cbInput = 16, unsigned char* pInput = 0x01a45620, unsigned long int* pcbOutput = 0x1dabfbbc, unsigned char** ppOutput = 0x1dabfbc0, IRAPIStream* __formal = 0x00000000) Line: 66, Byte Offsets: 0x1e4 C++ If anybody can point out what I may be doing wrong, I would appreciate it. Thanks, PaulH

    Read the article

  • Having issue with OpenGL 1.0 for HP slate 7

    - by Roy Coder
    I have issue with HP slate when i am trying to draw Line in OpenGL Draw method. But working in other devices. In Hp Slate Green line not drawn properly as like in another device. My Code is: gl.glPushMatrix(); gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); gl.glVertexPointer(2, GL10.GL_FLOAT, 0, vertexFloatBuffer); gl.glColorMask(true, true, true, true); gl.glDepthMask(true); gl.glLineWidth(8.0f); setColor(gl); gl.glDrawArrays(GL10.GL_LINES, 0, fPoints.length / 2); gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glPopMatrix(); Suggest me at which place i am wrong or missing something? UpdateImage

    Read the article

  • Can you change/redirect a django form's function by passing in your own function?

    - by Derek
    I'm dealing with django-paypal and want to change the button src images. So I went the the conf.py file in the source and edited the src destination. However, I really want to leave the source alone, and I noticed that the class PayPalPaymentsForm(forms.Form): has def get_image(self): return { (True, self.SUBSCRIBE): SUBSCRIPTION_SANDBOX_IMAGE, (True, self.BUY): SANDBOX_IMAGE, (True, self.DONATE): DONATION_SANDBOX_IMAGE, (False, self.SUBSCRIBE): SUBSCRIPTION_IMAGE, (False, self.BUY): IMAGE, (False, self.DONATE): DONATION_IMAGE, }[TEST, self.button_type] which handles all the image src destinations. Since changing this def in the source is worse than changing conf, I was wondering if there was a way to pass in customized defs you make like passing in initial arguments in forms? This way no source code is changed, and I can customize the get_image def as much as I need. passing in def something like this? def get_image(self): .... .... paypal = { 'amount': 10, 'item_name': 'test1', 'item_number': 'test1_slug', # PayPal wants a unique invoice ID 'invoice': str(uuid.uuid4()), } form = PayPalPaymentsForm(initial=paypal, get_image) Thanks!

    Read the article

  • Cloning a selector + all its children in jQuery?

    - by HipHop-opatamus
    I'm having trouble getting the following JQuery script to function properly - its functionality is as follows: 1) Hide the content below each headline 2) Upon clicking a headline, substitute the "#first-post" with the headline + the hidden content below the headline. I can only seem to get the script to clone the headline itself to #first-post, not the headline + the content beneath it. Any idea why? <HTML> <HEAD> <script src="http://code.jquery.com/jquery-latest.js"></script> </HEAD> <script> $(document).ready( function(){ $('.title').siblings().hide(); $('.title').click( function() { $('#first-post').replaceWith($(this).closest(".comment").clone().attr('id','first-post')); $('html, body').animate({scrollTop:0}, 'fast'); return false; }); }); </script> <BODY> <div id="first-post"> <div class="content"><p>This is a test discussion topic</p> </div> </div> <div class="comment"> <h2 class="title"><a href="#1">1st Post</a></h2> <div class="content"> <p>this is 1st reply to the original post</p> </div> <div class="test">1st post second line</div> </div> <div class="comment"> <h2 class="title"><a href="#2">2nd Post</a></h2> <div class="content"> <p>this is 2nd reply to the original post</p> </div> <div class="test">2nd post second line</div> </div> </div> <div class="comment"> <h2 class="title"><a href="#3">3rd Post</a></h2> <div class="content"> <p>this is 3rd reply to the original post</p> </div> <div class="test">3rd post second line</div> </div> </div> </BODY> </HTML>

    Read the article

  • SQL error C# - Parameter already defined

    - by jakesankey
    Hey there. I have a c# application that parses txt files and imports the data from them into a sql db. I was using sqlite and am now working on porting it to sql server. It was working fine with sqlite but now with sql i am getting an error when it is processing the files. It added the first row of data to the db and then says "parameter @PartNumber has already been declared. Variable names must be unique within a batch or stored procedure". Here is my whole code and SQL table layout ... the error comes at the last insertCommand.ExecuteNonQuery() instance at the end of the code... SQL TABLE: CREATE TABLE Import ( RowId int PRIMARY KEY IDENTITY, PartNumber text, CMMNumber text, Date text, FeatType text, FeatName text, Value text, Actual text, Nominal text, Dev text, TolMin text, TolPlus text, OutOfTol text, FileName text ); CODE: using System; using System.Data; using System.Data.SQLite; using System.IO; using System.Text.RegularExpressions; using System.Threading; using System.Collections.Generic; using System.Linq; using System.Data.SqlClient; namespace JohnDeereCMMDataParser { internal class Program { public static List<string> GetImportedFileList() { List<string> ImportedFiles = new List<string>(); using (SqlConnection connect = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { connect.Open(); using (SqlCommand fmd = connect.CreateCommand()) { fmd.CommandText = @"IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT DISTINCT FileName FROM Import; END"; fmd.CommandType = CommandType.Text; SqlDataReader r = fmd.ExecuteReader(); while (r.Read()) { ImportedFiles.Add(Convert.ToString(r["FileName"])); } } } return ImportedFiles; } private static void Main(string[] args) { Console.Title = "John Deere CMM Data Parser"; Console.WriteLine("Preparing CMM Data Parser... done"); Console.WriteLine("Scanning for new CMM data... done"); Console.ForegroundColor = ConsoleColor.Gray; using (SqlConnection con = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { con.Open(); using (SqlCommand insertCommand = con.CreateCommand()) { SqlCommand cmdd = con.CreateCommand(); string[] files = Directory.GetFiles(@"C:\Documents and Settings\js91162\Desktop\", "R303717*.txt*", SearchOption.AllDirectories); List<string> ImportedFiles = GetImportedFileList(); foreach (string file in files.Except(ImportedFiles)) { string FileNameExt1 = Path.GetFileName(file); cmdd.CommandText = @" IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT COUNT(*) FROM Import WHERE FileName = @FileExt; END"; cmdd.Parameters.Add(new SqlParameter("@FileExt", FileNameExt1)); int count = Convert.ToInt32(cmdd.ExecuteScalar()); con.Close(); con.Open(); if (count == 0) { Console.WriteLine("Parsing CMM data for SQL database... Please wait."); insertCommand.CommandText = @" INSERT INTO Import (FeatType, FeatName, Value, Actual, Nominal, Dev, TolMin, TolPlus, OutOfTol, PartNumber, CMMNumber, Date, FileName) VALUES (@FeatType, @FeatName, @Value, @Actual, @Nominal, @Dev, @TolMin, @TolPlus, @OutOfTol, @PartNumber, @CMMNumber, @Date, @FileName);"; insertCommand.Parameters.Add(new SqlParameter("@FeatType", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@FeatName", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Value", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Actual", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Nominal", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Dev", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolMin", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolPlus", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@OutOfTol", DbType.Decimal)); string FileNameExt = Path.GetFullPath(file); string RNumber = Path.GetFileNameWithoutExtension(file); string RNumberE = RNumber.Split('_')[0]; string RNumberD = RNumber.Split('_')[1]; string RNumberDate = RNumber.Split('_')[2]; DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy"); string[] lines = File.ReadAllLines(file); bool parse = false; foreach (string tmpLine in lines) { string line = tmpLine.Trim(); if (!parse && line.StartsWith("Feat. Type,")) { parse = true; continue; } if (!parse || string.IsNullOrEmpty(line)) { continue; } Console.WriteLine(tmpLine); foreach (SqlParameter parameter in insertCommand.Parameters) { parameter.Value = null; } string[] values = line.Split(new[] { ',' }); for (int i = 0; i < values.Length - 1; i++) { SqlParameter param = insertCommand.Parameters[i]; if (param.DbType == DbType.Decimal) { decimal value; param.Value = decimal.TryParse(values[i], out value) ? value : 0; } else { param.Value = values[i]; } } insertCommand.Parameters.Add(new SqlParameter("@PartNumber", RNumberE)); insertCommand.Parameters.Add(new SqlParameter("@CMMNumber", RNumberD)); insertCommand.Parameters.Add(new SqlParameter("@Date", cmmDate)); insertCommand.Parameters.Add(new SqlParameter("@FileName", FileNameExt)); // insertCommand.ExecuteNonQuery(); } } } Console.WriteLine("CMM data successfully imported to SQL database..."); } con.Close(); } } } }

    Read the article

  • jaxb unmarshal problem

    - by Hoax
    private JAXBContext jaxbContext; private Marshaller marshaller; private Unmarshaller unmarshaller; private PoiList db; public XMLHandler() { try { JAXBContext.newInstance("x.y.shared"); } catch (JAXBException e) { e.printStackTrace(); } } public PoiList readXML() { try { unmarshaller = jaxbContext.createUnmarshaller(); unmarshaller.setEventHandler(new XMLValidEventHandler()); db = (PoiList) unmarshaller.unmarshal(new File("src/source.xml")); } catch (JAXBException e) { e.printStackTrace(); } return db; } gets me this Exception in thread "main" java.lang.NullPointerException at com.sem.server.XMLHandler.readXML(XMLHandler.java:32) at sem.server.testDataAPI.main(testDataAPI.java:13) Line 32 in this case is the jaxbContext.createUnmarshaller() Line. packages are x.y.client x.y.server (includes the XMLHandler) x.y.shared (includes jaxb generated classes) not really sure what the problem is. any help is appreciated!

    Read the article

  • designing data structures for an address book in C program??

    - by osabri
    i want that the number of address book item is not known in advance, i am thinking to use linked list is it the right choice?? "the user can enter new person data, or print the data for a given name, the asking data need not be a name but also an address on a telephone number, the program prints the whole information about a person, print the content of the book in alphabetical order. Store some data in a file; retrieve it and safe it after modification Program should write a file to the disk and retrieve the file from it. Program should be called with arguments. i will use malloc but i don't know when and how? somebody did similar task or have an idea can help me plz

    Read the article

  • [R] multiple functions in one R script

    - by Philipp
    Hi, I guess it's a stupid question, but I don't get it :-( I wrote an R script, which creates heatmaps out of xls files. I am calling this R script with a Perl system call and pass over all the arguments. This all works fine. Now I wanted to make the R script less confusing by writing different functions in the R script, for example: args <- commandArgs(TRUE) parsexls <- function(filepath) { data <- read.xls(...) assign("data", data, globalenv()) } reorder <- function(var) { data <- data[order...] assign("data", data, globalenv()) } When I want to call the functions with parsexls(args[1]) reorder(args[2]) nothing happens. But when I place the parsexls(args[1]) in the script between the two functions shown above, the file is parsed correctly! The reorder(args[2]) seems never to be read. Any ideas what I am doing wrong? Phil

    Read the article

  • Can I override a theme function with a .tpl file?

    - by Nick Lowman
    Hi everyone, How would I go around overriding a theme function with a .tpl file? I know how to override a .tpl file with a theme function but not the other way round. I can't seem to find anywhere that tells me so, so maybe it's not possible or not good practise. For example if there was a theme function defined in a module called super_results and registered with the theme registry, like the example below, how would I go around overriding it with super_results.tpl.php. 'super_results' => array( 'arguments' => array('title' => NULL, 'results' => NULL, 'votes' => NULL), ), function modulename_super_results($title, $results,$votes){ output HTML }

    Read the article

  • How do you move the pointer up or down multiple lines with Emacs?

    - by Peter
    I can move my pointer up and down one line with my arrow key just fine in Emacs, so I'd like to redefine C-n and C-p to move up and down 5 lines at a time. I'm just beginning to learn how to use Emacs, and elisp is very alien to me. I tried using the GNU Emacs lisp reference, but I couldn't find how to bind a keystroke to multiple commands. Here's what I have so far (concentrating on the moving up definition): (global-set-key "\C-p" '(loop for i in '(1 2 3 4 5) do ('previous-line))) But, this brings up an error message when I hit C-p, "Wrong type argument." Any suggestions? Thanks!

    Read the article

  • Maintaining the query string in ASP.Net MVC

    - by Mantorok
    Hi all Just beginning my journey in ASP.Net MVC and I have a query about something before I dig myself in too deep. I have a table, which is paged, and I have 2 controls above the table: Dropdown that defines order of the results and apply button next to it Textbox that defines a filter and apply button next to it What I need to achieve is that if the user changes the order or adds a filter I fire of an AJAX call to my action like such: /Membership/Users?sort=value&filter=value&page=pagenumber. So my controller action is: // GET Membership/Users?sort=&filter=&page= public ActionResult Users(string sort, string filter, string page) So I have 3 questions: Is this the correct approach? What would be the best way to ensure that the query string is maintained, bearing in mind that the action will nearly always be called by Jquery/Ajax functions? If I wanted to link directly to this action passing the arguments would I need to hard-code the querystring? Thanks

    Read the article

  • Where/When does C# and the .NET Framework fail to be the right tool?

    - by Nate Bross
    In my non-programming life, I always attempt to use the approprite tool for the job, and I feel that I do the same in my programming life, but I find that I am choosing C# and .NET for almost everything. I'm finding it hard to come up with (realistic business) needs that cannot be met by .NET and C#. Obviously embedded systems might require something less bloated than the .NET Micro Framework, but I'm really looking for line of business type situations where .NET is not the best tool. I'm primarly a C# and .NET guy since its what I'm the most comfertable in, but I know a fair amount of C++, php, VB, powershell, batch files, and Java, as well as being versed in the web technologes (javascript, html/css). But I'm open minded about it my skill set and I'm looking for cases where C# and .NET are not the right tool for the job. The bottom line here, is that I feel that I'm choosing C# and .NET simply because I am very comfertable with it, so I'm looking for cases where you have chosen something other than .NET, even though you are primarly a .NET developer.

    Read the article

  • combination of open source licenses

    - by Nicola Montecchio
    Hi I'm about to release some software as open source. It uses Lucene (Apache license) and jopt simple (MIT license). Are there any constraints on the license that I am going to apply to my own software? In particular, it is an adaptation of Lucene for performing content-based search on audio (so, many classes are inherited and in one case copied with a little modification). It only uses jopt simple for handling command line arguments (i.e. no modification at all, just "import" and "new OptionParser..."). Thanks for your help Nicola Montecchio

    Read the article

  • ResGen.exe stucks when redirect output

    - by Darqer
    Hello I try to redirect standard output from ResGen.exe. I use following code ProcessStartInfo psi = new ProcessStartInfo( "resxGen.exe" ); psi.CreateNoWindow = true; psi.Arguments = sb.ToString(); psi.UseShellExecute = false; psi.RedirectStandardOutput = true; Process p = Process.Start( psi ); p.WaitForExit(); StreamReader sr = p.StandardOutput; string message = p.StandardOutput.ReadToEnd(); It stuck on p.WaitForExit. When I turn off output stream redirection and do not read StandardOutput it works correctly. What do I do wrong ?

    Read the article

  • Python: User-Defined Exception That Proves The Rule

    - by bandana
    Python documentations states: Exceptions should typically be derived from the Exception class, either directly or indirectly. the word 'typically' leaves me in an ambiguous state. consider the code: class good(Exception): pass class bad(object): pass Heaven = good() Hell = bad() >>> raise Heaven Traceback (most recent call last): File "<pyshell#163>", line 1, in <module> raise Heaven good >>> raise Hell Traceback (most recent call last): File "<pyshell#171>", line 1, in <module> raise Hell TypeError: exceptions must be classes or instances, not bad so when reading the python docs, should i change 'typically' with ''? what if i have a class hierarchy that has nothing to do with the Exception class, and i want to 'raise' objects belonging to the hierarchy? i can always raise an exception with an argument: raise Exception, Hell This seems slightly awkward to me What's so special about the Exception class, that only its family members can be raised?

    Read the article

  • cutting a text file into multiple parts in emacs

    - by Gaurish Telang
    Hi I am using the GNU-Emacs-23 editor. I have this huge text file containing about 10,000 lines which I want to chop into multiple files. Using the mouse to select the required text to paste in another file is the really painful. Also this is prone to errors too. If I want to divide the text file according to the line numbers into say 4 file where first file:lines 1-2500 second file:lines 2500-5000 third file :lines 5000-7500 fourth file: lines: 7500-10000 how do I do this? At the very least, is there any efficient way to copy large regions of the file just by specifying line numbers

    Read the article

  • Saving a movie generated with Jython/JES on local disk

    - by Golgauth
    I made an autogenerated movie clip using JES (Jython Environment for Students). I can play it without any problem using playMovie(), but I can't figure out how to have it saved physically on disk. The full script is located here. ... movie = synthesizeFrameAndCreateMovie("D:\\FOLDER") print movie writeQuicktime(movie,"D:\\FOLDER\\movie.mov", 30) [LINE 35] #playMovie(movie) I get this error when calling the function writeQuicktime(): >>> ======= Loading Progam ======= Movie, frames: 60 The error was: Index: 0, Size: 0 I wasn't able to do what you wanted. The error java.lang.IndexOutOfBoundsException has occured Please check line 35 Note : I also tried the function writeAVI(), with the exact same result. This error sounds like a java bug in Jython/JES library. I am running JES under Windows 7 and have all the common Quicktime and AVI codex installed as well as the QTjava library in my jre... Any brilliant idea ? EDIT : Also tried the Linux version with same result for both QuickTime and AVI...

    Read the article

  • zeromq installtion on mac os snow leopard

    - by Ashish
    I have installed zeromq 2.1.11 on mac os x using the steps given on http://www.zeromq.org/area:download Then i installed pyzmq (python bindings ) But i get the following error : import zmq Traceback (most recent call last): File "<pyshell#1>", line 1, in <module> import zmq File "/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/zmq/__init__.py", line 35, in <module> from zmq.utils import initthreads # initialize threads ImportError: dlopen(/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/zmq/utils/initthreads.so, 2): no suitable image found. Did find: /Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/zmq/utils/initthreads.so: no matching architecture in universal wrapper

    Read the article

  • How do I use compiler intrinsic __fmul_?

    - by Eric Thoma
    I am writing a massively parallel GPU application. I have been optimizing it by hand. I received a 20% performance increase with _fdividef(x, y), and according to The Cuda C Programming Guide (section C.2.1), using similar functions for multiplication and adding is also beneficial. The function is stated as this: "_fmulrn,rz,ru,rd". __fdividef(x,y) was not stated with the arguments in brackets. I was wondering, what are those brackets? If I run the simple code: int t = __fmul_(5,4); I a compiler error about how _fmul is undefined. I have the CUDA runtime included, so I don't think it is a setup thing; rather it is something to do with those square brackets. How do I correctly use this function? Thank you.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 654 655 656 657 658 659 660 661 662 663 664 665  | Next Page >