Search Results

Search found 44058 results on 1763 pages for 'function module'.

Page 658/1763 | < Previous Page | 654 655 656 657 658 659 660 661 662 663 664 665  | Next Page >

  • drupal hook_menu_alter9) for adding tabs

    - by EricP
    I want to add some tabs in the "node/%/edit" page from my module called "cssswitch". When I click "Rebuild Menus", the two new tabs are displayed, but they are displayed for ALL nodes when editing them, not just for the node "cssswitch". I want these new tabs to be displayed only when editing node of type "cssswitch". The other problem is when I clear all cache, the tabs completely dissapear from all edit pages. Below is the code I wrote. function cssswitch_menu_alter(&$items) { $node = menu_get_object(); //print_r($node); //echo $node->type; //exit(); if ($node->type == 'cssswitch') { $items['node/%/edit/schedulenew'] = array( 'title' => 'Schedule1', 'access callback'=>'user_access', 'access arguments'=>array('view cssswitch'), 'page callback' => 'cssswitch_schedule', 'page arguments' => array(1), 'type' => MENU_LOCAL_TASK, 'weight'=>4, ); $items['node/%/edit/schedulenew2'] = array( 'title' => 'Schedule2', 'access callback'=>'user_access', 'access arguments'=>array('view cssswitch'), 'page callback' => 'cssswitch_test2', 'page arguments' => array(1), 'type' => MENU_LOCAL_TASK, 'weight'=>3, ); } } function cssswitch_test(){ return 'test'; } function cssswitch_test2(){ return 'test2'; } Thanks for any help.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Use string to store statement (or part of a statement), and then add it to the code

    - by Dean
    I use multidimensional arrays to store product attributes (well Virtuemart does, to be precise). When I tried to echo the sub-arrays value, if the sub-array did not exist PHP threw: Fatal error: Cannot use string offset as an array To get around this, I attempted to create a function to check on every array level if it is an actual array, and if it is empty (when trying on the whole thing at once such as: is_array($array['level1']['level2']['level3']), I got the same error if level1 or level2 are not actual arrays). This is the function ($array contains the array to check, $array_levels is an array containing the names of the sub-arrays, in the order they should apper): function check_md_array($array,$array_levels){ if(is_array($array)){ $dimension = null; //This will store the dimensions string foreach($array_levels as $level){ $dimension .= "['" . $level . "']"; //Add the current dimension to the dimensions string if(!is_array($array/* THE CONTENT OF $dimension SHOULD BE INSERTED HERE*/)){ return false; } } return true; } } How can I take the string contained in $dimensions, and insert it into the code, to be part of the statement?

    Read the article

  • c# template member functions

    - by user3730583
    How can I define a template member function in C# For instance I will fill any collection which supports an Add(...) member function, please check out the sample code below public class CInternalCollection { public static void ExternalCollectionTryOne<T<int>>(ref T<int> ext_col, int para_selection = 0) { foreach (int int_value in m_int_col) { if (int_value > para_selection) ext_col.Add(int_value); } } public static void ExternalCollectionTryTwo<T>(ref T ext_col, int para_selection = 0) { foreach (int int_value in m_int_col) { if (int_value > para_selection) ext_col.Add(int_value); } } static int[] m_int_col = { 0, -1, -3, 5, 7, -8 }; } The ExternalCollectionTryOne<...(...) would be the preferred kind, because the int type can be explicit defined, but results in an error: Type parameter declaration must be an identifier not a type The type or namespace name 'T' could not be found (are you missing a using directive or an assembly reference?) The ExternalCollectionTryTwo<...(...) results in an error: 'T' does not contain a definition for 'Add' and no extension method 'Add' accepting a first argument of type 'T' could be found (are you missing a using directive or an assembly reference?)... I hope the problem is clear – any suggestions? ----------------------------- edit -------------------------- The answers with the interface ICollection<.. without a template member works fine and thanks all for this hint, but I still cannot define successfully a member template(generic) function So a more simpler example ... how can I define this public class CAddCollectionValues { public static void AddInt<T>(ref T number, int selection) { T new_T = new T(); //this line is just an easy demonstration to get a compile error with type T foreach (int i_value in m_int_col) { if (i_value > selection) number += i_value; //again the type T cannot be used } } static int[] m_int_col = { 0, -1, -3, 5, 7, -8 }; }

    Read the article

  • CSS class not working as expected [closed]

    - by user1050619
    My HTML codes not implement the CSS styling..The border in the CSS file is not being implemented. I tried both in Firefox & IE. Please provide your inputs. Please find the code below: HTML <html> <head> <link href="file://c:/jquery/chapter-1/begin/styles/my_style.css" rel="stylesheet"> </head> <body> <div id="header" class="no_hover"><h1>Header</h1></div> <button type="button" id="btn1">Click to Add</button> <button type="button" id="btn2">Click to Remove</button> <script src="file://c:/jquery/chapter-1/begin/scripts/jquery.js" type="text/javascript"></script> <script src="file://c:/jquery/chapter-1/begin/scripts/test4.js" type="text/javascript"></script> </body> </html> jS FILE $(document).ready(function() { $("#btn1").click( function(){ $("#header").addClass("hover"); $("#header").removeClass("no_hover"); }); $("#btn2").click( function(){ $("#header").removeClass("hover"); $("#header").addClass("no_hover"); }); }); CSS FILE .hover{ border: solid #f00 3px; } .no_hover{ border: solid #000 3px; }

    Read the article

  • How to use clearInterval() and then make changes to the DOM?

    - by George D.
    I have this code and the problem I have is that I want to stop the loop and then replace the text 'Done!' that comes from the sms-loader.php script with the "textnew" string. Problem is that the loop occurs one more time so the text in the div.checkstatus field is again replaced by the calling php script. The strange thing is that I see the log message and again I get a new (and final) request, although the ordering is the opposite (first stop then replace text()) in my script. I need to understand why this is happening. $(document).ready(function() { var interval = ""; $('.checkstatus').each(function(){ var msgid = $(this).data('msg') $this = $(this), hid = $this.data('history'), textnew = '<a href="sms-dstatus.php?id='+msgid+'&sid=' +hid+ '&amp;keepThis=true&amp;TB_iframe=true&amp;height=430&amp;width=770" title="Delivery Status" class="thickbox"><img src="../template/icons/supermini/chart_curve.png" alt="status" width="16" height="16" /></a>'; interval = setInterval(function() { $this.load('../pages/sms-loader.php?id='+msgid); // stop the loop if($this.text()=='Done!'){ // stop it clearInterval(interval); console.log(textnew); this.html(textnew); /// this line is the problem } }, 5000); // 5 secs }); });

    Read the article

  • Determining selected state of jQuery Buttons

    - by lloydphillips
    I've got two radio buttons in a .net page which are being transformed to jQuery buttons a la http://jqueryui.com/demos/button/#radio When the page is loaded I have button 2 as checked. When clicking the buttons I'm firing the postback event. Problem is you can click on that button that is selected by default on the initial load i.e. Button 2, the postback is fired but the event handler isn't called in the .net code behind because the radio button is already classed as selected (and in normal circumstances wouldn't allow the postback to fire). To get around this I've added the e.PreventDefault() method BUT this is causing issues when Button 1 is clicked because before the click handler is called the button is set to selected. Therefore, in every case in the following code e.PreventDefault() is called: $(document).ready(function(){ $("[id*='rbPayable']").click(function(e){ if ($("[id*='rbPayable']").attr("checked")) e.preventDefault(); else setTimeout('__doPostBack(\'this.id\',\'\')', 0) }) $("[id*='rbReceivable']").click(function(e){ if ($("[id*='rbReceivable']").attr("checked")) e.preventDefault(); else setTimeout('__doPostBack(\'this.id\',\'\')', 0) }) }); What is the best way for me to load the page and effectively be able to do the following: 'If rbReceivable is checked then don't do anything otherwise do a postback.'

    Read the article

  • Translate Prototype code into Jquery version

    - by user1055495
    I everybody, I'm working on a SaaS application and I need to use Jquery instead of Prototype due to some extra plugins integration. My code that was wotking a charm with Prototype is not running anymore with Jquery and I'm not used to write in this framework... Is there someone to help me in "translating" this one: Thanks a lot for your help. var rates = new Array(); <% for tva_rate in @tva_rates -%> rates.push(new Array(<%= tva_rate.id %>, '<%=h tva_rate.taux %>', '<%=h tva_rate.compte_id %>' )); <% end -%> function tvaSelected() { tva_id = $('journal_tva_id').getValue(); show = 1; if (tva_id > 0){ rates.each(function(rate) { if (rate[0] == tva_id) { $('journal_taux').setValue(rate[1]); $('journal_compte_tva').setValue(rate[2]); show = 2; } }); } if (show == 1) { $('tva_taux_field').hide(); } else { $('tva_taux_field').show(); } } document.observe('dom:loaded', function() { tvaSelected(); $('journal_tva_id').observe('change', tvaSelected); });

    Read the article

  • google maps api keys to be set webserver-wide, (as env var? inside apache?)

    - by ~knb
    I have a web site with many virtual hosts and each registered with several domain names (ending in .org, .de), site1.mysite.de, site2.mysite.org Then I have different templating systems based on several programming languages (perl and php) in use on the web server. The Google Maps Api requires a unique Google Maps api key for each vhost. I want to have something like a web-server wide variable $goomapkey that I can call from inside my code. In PHP code, Now I have a kludgy case-analysis solution like $domain = substr($_SERVER['SERVER_NAME'], -3); if (".de" == $domain){ //if ("xxxxxx" eq substr($ENV{SERVER_NAME}, 0, 5)){ // $gookey = "ABQIAAA..."; //} else { //site1.de $gookey = "ABQIAAAA1Js..."; //} } elseif ("dev" == substr($_SERVER['SERVER_NAME'], 0, 3)){ //dev.mysite.org $gookey = "ABQIAAAA1JsSb..."; } else { //www.mysite.org $gookey = "ABQIAAAA1JsS..."; //TODO: Add more keys for each virtual host, for my.machinename.de, IP-address based URL, ... } ... inside my php-based CMS. A non-ideal solution, because it is, php-only, and I still have to set it at several html templates inside the CMS, and there are too many cases. I want the google maps api key to be set by the apache web server who examines the request *early in the request loop before any php page template code is constructed and evaluated. is an environment variable a good solution? which technology should be used to set the $goomapkey variable? I'd prefer mod_perl2 Apache request handler, but the documentation is confusing (many API changes in the past ). Which Apache module could I use? Is there a built-in Apache module that does the same thing?

    Read the article

  • mysql_affected_rows() returns 0 for UPDATE statement even when an update actually happens

    - by Alex Moore
    I am trying to get the number of rows affected in a simple mysql update query. However, when I run this code below, PHP's mysql_affected_rows() always equals 0. No matter if foo=1 already (in which case the function should correctly return 0, since no rows were changed), or if foo currently equals some other integer (in which case the function should return 1). $updateQuery = "UPDATE myTable SET foo=1 WHERE bar=2"; mysql_query($updateQuery); if (mysql_affected_rows() > 0) { echo "affected!"; } else { echo "not affected"; // always prints not affected } The UPDATE statement itself works. The INT gets changed in my database. I have also double-checked that the database connection isn't being closed beforehand or anything funky. Keep in mind, mysql_affected_rows doesn't necessarily require you to pass a connection link identifier, though I've tried that too. Details on the function: mysql_affected_rows Any ideas? SOLUTION The part I didn't mention turned out to be the cause of my woes here. This PHP file was being called ten times consecutively in an AJAX call, though I was only looking at the value returned on the last call, ie. a big fat 0. My apologies!

    Read the article

  • qTip pop ups come in from top left of screen (on first load)

    - by franko75
    Hi, not sure if i'm set things up incorrectly - I don't seem to see anyone else with this problem, but my qTip popups (all ajax loaded content) are loading quite erratically, in that they are often animating in from off screen before appearing in the correct position. Is there a simple solution to this which I may have missed? Thanks again for your help. HTML markup: <span class="formInfo"> <a href="http://localhost/httpdocs/index.php/help/kc_dob" class="jTip" name="" id="dob_help">?</a> </span> qTip initialisation.. //set up for qtip function initQtip() { $('a.jTip').each(function() { $(this).qtip( { content: { // Set the text to an image HTML string with the correct src URL to the loading image you want to use text: '<img src="/media/images/wait.gif" alt="Loading..." />', url: $(this).attr('href') // Use the rel attribute of each element for the url to load }, position: { adjust: { screen: true // Keep the tooltip on-screen at all times } }, show: { when: 'click', solo: true // Only show one tooltip at a time }, hide: 'unfocus', style: { tip: true, // Apply a speech bubble tip to the tooltip at the designated tooltip corner border: { width: 10, radius: 10 }, width: { min: 200, max: 500 }, name: 'light' // Use the default light style } }); //prevent default event on click }).bind('click', function(event){ event.preventDefault(); return false; }); }

    Read the article

  • Iteration over a linq to sql query is very slow.

    - by devzero
    I have a view, AdvertView in my database, this view is a simple join between some tables (advert, customer, properties). Then I have a simple linq query to fetch all adverts for a customer: public IEnumerable<AdvertView> GetAdvertForCustomerID(int customerID) { var advertList = from advert in _dbContext.AdvertViews where advert.Customer_ID.Equals(customerID) select advert; return advertList; } I then wish to map this to modelItems for my MVC application: public List<AdvertModelItem> GetAdvertsByCustomer(int customerId) { List<AdvertModelItem> lstAdverts = new List<AdvertModelItem>(); List<AdvertView> adViews = _dataHandler.GetAdvertForCustomerID(customerId).ToList(); foreach(AdvertView adView in adViews) { lstAdverts.Add(_advertMapper.MapToModelClass(adView)); } return lstAdverts; } I was expecting to have some performance issues with the SQL, but the problem seems to be with the .ToList() function. I'm using ANTS performance profiler and it reports that the total runtime of the function is 1.400ms, and 850 of those is with the ToList(). So my question is, why does the tolist function take such a long time here?

    Read the article

  • Why would an image (the Mandelbrot) be skewed and wrap around?

    - by Sean D
    So I just wrote a little snippet to generate the Mandelbrot fractal and imagine my surprise when it came out all ugly and skewed (as you can see at the bottom). I'd appreciate a point in the direction of why this would even happen. It's a learning experience and I'm not looking for anyone to do it for me, but I'm kinda at a dead end debugging it. The offending generation code is: module Mandelbrot where import Complex import Image main = writeFile "mb.ppm" $ imageMB 1000 mandelbrotPixel x y = mb (x:+y) (0:+0) 0 mb c x iter | magnitude x > 2 = iter | iter >= 255 = 255 | otherwise = mb c (c+q^2) (iter+1) where q = x --Mandelbrot --q = (abs.realPart $ x) :+ (abs.imagPart $ x) --Burning Ship argandPlane x0 x1 y0 y1 width height = [(x,y)| y<-[y1,(y1-dy)..y0], --traverse from x<-[x0,(x0+dx)..x1]] --top-left to bottom-right where dx = (x1 - x0)/width dy = (y1 - y0)/height drawPicture :: (a->b->c)->(c->Colour)->[(a,b)]->Image drawPicture function colourFunction plane = map (colourFunction.uncurry function) plane imageMB s = createPPM s s $ drawPicture mandelbrotPixel (\x->[x,x,x]) $ argandPlane (-1.8) (-1.7) (0.02) 0.055 s' s' where s' = fromIntegral s And the image code (which I'm fairly confident in) is: module Image where type Colour = [Int] type Image = [Colour] createPPM :: Int -> Int -> Image -> String createPPM w h i = concat ["P3 ", show w, " ", show h, " 255\n", unlines.map (unwords.map show) $ i]

    Read the article

  • optimize output value using a class and public member

    - by wiso
    Suppose you have a function, and you call it a lot of times, every time the function return a big object. I've optimized the problem using a functor that return void, and store the returning value in a public member: #include <vector> const int N = 100; std::vector<double> fun(const std::vector<double> & v, const int n) { std::vector<double> output = v; output[n] *= output[n]; return output; } class F { public: F() : output(N) {}; std::vector<double> output; void operator()(const std::vector<double> & v, const int n) { output = v; output[n] *= n; } }; int main() { std::vector<double> start(N,10.); std::vector<double> end(N); double a; // first solution for (unsigned long int i = 0; i != 10000000; ++i) a = fun(start, 2)[3]; // second solution F f; for (unsigned long int i = 0; i != 10000000; ++i) { f(start, 2); a = f.output[3]; } } Yes, I can use inline or optimize in an other way this problem, but here I want to stress on this problem: with the functor I declare and construct the output variable output only one time, using the function I do that every time it is called. The second solution is two time faster than the first with g++ -O1 or g++ -O2. What do you think about it, is it an ugly optimization?

    Read the article

  • How to solve this problem with Python

    - by morpheous
    I am "porting" an application I wrote in C++ into Python. This is the current workflow: Application is started from the console Application parses CLI args Application reads an ini configuration file which specifies which plugins to load etc Application starts a timer Application iterates through each loaded plugin and orders them to start work. This spawns a new worker thread for the plugin The plugins carry out their work and when completed, they die When time interval (read from config file) is up, steps 5-7 is repeated iteratively Since I am new to Python (2 days and counting), the distinction between script, modules and packages are still a bit hazy to me, and I would like to seek advice from Pythonista as to how to implement the workflow described above, using Python as the programing language. In order to keep things simple, I have decided to leave out the time interval stuff out, and instead run the python script/scripts as a cron job instead. This is how I am thinking of approaching it: Encapsulate the whole application in a package which is executable (i.e. can be run from the command line with arguments. Write the plugins as modules (I think maybe its better to implement each module in a separate file?) I havent seen any examples of using threading in Python yet. Could someone provide a snippet of how I could spawn a thread to run a module. Also, I am not sure how to implement the concept of plugins in Python - any advice would be helpful - especially with a code snippet.

    Read the article

  • Java reflection appropriateness

    - by jsn
    This may be a fairly subjective question, but maybe not. My application contains a bunch of forms that are displayed to the user at different times. Each form is a class of its own. Typically the user clicks a button, which launches a new form. I have a convenience function that builds these buttons, you call it like this: buildButton( "button text", new SelectionAdapter() { @Override public void widgetSelected( SelectionEvent e ) { showForm( new TasksForm( args... ) ); } } ); I do this dozens of times, and it's really cumbersome having to make a SelectionAdapter every time. Really all I need for the button to know is what class to instantiate when it's clicked and what arguments to give the constructor, so I built a function that I call like this instead: buildButton( "button text", TasksForm.class, args... ); Where args is an arbitrary list of objects that you could use to instantiate TasksForm normally. It uses reflection to get a constructor from the class, match the argument list, and build an instance when it needs to. Most of the time I don't have to pass any arguments to the constructor at all. The downside is obviously that if I'm passing a bad set of arguments, it can't detect that at compilation time, so if it fails, a dialog is displayed at runtime. But it won't normally fail, and it'll be easy to debug if it does. I think this is much cleaner because I come from languages where the use of function and class literals is pretty common. But if you're a normal Java programmer, would seeing this freak you out, or would you appreciate not having to scan a zillion SelectionAdapters?

    Read the article

  • Why does my JQuery Image swap not work in firefox or chrome, but fine in IE?

    - by Cognize
    Hi, Relatively new to JQuery. I've got some code that does a banner swap with a fade in fade out transition. The images swap as expected in IE8, chrome, and firefox. However, the actual fade, the smooth transition between images only works in IE. Can anyone point me in the right direction for a fix? Javascript: function swapImages() { var $active = $('#transitionImagePlaceHolder .active'); var $next = ($('#transitionImagePlaceHolder .active').next().length > 0) ? $('#transitionImagePlaceHolder .active').next() : $('#transitionImagePlaceHolder img:first'); $active.fadeOut( 'slow', function () { $next.fadeIn('slow').addClass('active'); $active.removeClass('active'); }); } $(document).ready(function () { setInterval('swapImages()', 5000); }); CSS: #transitionImagePlaceHolder { } #transitionImagePlaceHolder { position:relative; left: 26px; } #transitionImagePlaceHolder img { display:none; position:absolute; top:4; left:10; } HTML: <div id="transitionImagePlaceHolder"> <img class="active" src="Images/TransitionImages/Trans_Img_1.jpg" /> <img src="Images/TransitionImages/Trans_Img_2.jpg" /> <img src="Images/TransitionImages/Trans_Img_3.jpg" /> </div>

    Read the article

  • Is there a more elegant solution than an if-statement with no else clause?

    - by Jay
    In the following code, if Control (the element that trigers Toggle's first OL) is not Visible it should be set Visible and all other Controls (Controls[i]) so be Hidden. .js function Toggle(Control){ var Controls=document.getElementsByTagName("ol",document.getElementById("Quote_App")); var Control=Control.getElementsByTagName("ol")[0]; if(Control.style.visibility!="visible"){ for(var i=0;i<Controls.length;i++){ if(Controls[i]!=Control){ Reveal("hide",20,0.3,Controls[i]); }else{ Reveal("show",20,0.3,Control); }; }; }else{ Reveal("hide",20,0.3,Control); }; }; Although the function [Toggle] works fine, it is actually setting Controls[i] to Hidden even if it is already. This is easily rectified by adding an If statement as in the code below, surely there is a more elegant solution, maybe a complex If condition? .js function Toggle(Control){ var Controls=document.getElementsByTagName("ol",document.getElementById("Quote_App")); var Control=Control.getElementsByTagName("ol")[0]; if(Control.style.visibility!="visible"){ for(var i=0;i<Controls.length;i++){ if(Controls[i]!=Control){ if(Controls[i].style.visibility=="visible"){ Reveal("hide",20,0.3,Controls[i]); }; }else{ Reveal("show",20,0.3,Control); }; }; }else{ Reveal("hide",20,0.3,Control); }; }; Your help is appreciated always.

    Read the article

  • Jquery Ajax + PHP

    - by Kris.Mitchell
    I am having problems with jQuery Ajax and PHP I have my php file set up to echo the data I am gathering from a mysql database. I have verified that the database is returning something and that the string at the end of the function actually contains data. What is happening though, is that it looks like the php echo is happening before the ajax call, causing the php data to be displayed at the top of the page, and not below in proper div. I think it might have something to do with timing of the ajax and the php call, but I am not sure. So, why is the data not getting caught by the .ajax and thrown into the div? Thanks for the help! jQuery $(document).ready(function() { $.ajax({ url: "../database_functions.php", type: "GET", data: "cat=jw&sub=pi&sort=no", cache: false, success: function (html) { alert("Success!"); $('#product-list').html(html); } }); }); PHP echo "Hello World";

    Read the article

  • controlling css with javascript works with mozilla but not with webkit based browsers

    - by GlassGhost
    Im having problems with applying css text variable in this javascript with webkit based browsers(Chrome & Safari) but it works in firefox 3.6 the function: function addGlobalStyle(sCss) { var head = document.getElementsByTagName('head')[0]; if( !head || head == null ) { return false; } var oStyle = document.createElement('style'); oStyle.type = 'text/css'; oStyle.rel = 'stylesheet'; oStyle.media = 'screen'; if ( is_gecko ) { // firefox WORKING !!! oStyle.href = 'FireFox.css'; oStyle.innerHTML = sCss; head.appendChild(oStyle); return true; } else {//nothing but firefox works oStyle.href = 'FireFox.css'; oStyle.innerHTML = sCss; head.appendChild(oStyle); return true; } } the use of the function: var NewSyleText = //The page styling "h1, h2, h3, h4, h5 {font-family: 'Verdana','Helvetica',sans-serif; font-style: normal; font-weight:normal;}" + "body, b {background: #fbfbfb; font-style: normal; font-family: 'Cochin','GaramondNo8','Garamond','Big Caslon','Georgia','Times',serif;font-size: 11pt;}" + "p { margin: 0pt; text-indent:2.5em; margin-top: 0.3em; }" + "a { text-decoration: none; color: Navy; background: none;}" + "a:visited { color: #500050;}" + "a:active { color: #faa700;}" + "a:hover { text-decoration: underline;}"; addGlobalStyle(NewSyleText);//inserts the page styling

    Read the article

  • Division of text follow the cursor via Javascript/Jquery

    - by webzide
    Dear experts, I wanted have a dynamic division of content follow you with the cursor in the web browser space. I am not a pro at JS so I spent 2 hours to finally debugged a very stupid way to accomplish this. $(document).ready(function () { function func(evt) { var evt = (evt) ? evt : event; var div = document.createElement('div'); div.style.position = "absolute"; div.style.left = evt.clientX + "px"; div.style.top = evt.clientY + "px"; $(div).attr("id", "current") div.innerHTML = "CURSOR FOLLOW TEXT"; $(this).append($(div)); $(this).unbind() $(this).bind('mousemove', function () { $('div').remove("#current"); }); $(this).bind('mousemove', func); } $("body").bind('mousemove', func) }); As you can see this is pretty much Brute force and it slows down the browser quite a bit. I often experience a lag on the browser as a drag my mouse from one place to another. Is there a way to accomplish this easier and faster and more intuitive. I know you can use the cursor image technique but thats something I'm looking to avoid. Thanks in advance.

    Read the article

  • Looking for Simplified Overview of EJB3

    - by sdoca
    Hi I'm looking for a simplified overview of EJB3 components. I seem to understand most of the pieces of the puzzle, but can't quite get them to fit together in my brain as a full picture. I've developed numerous web applications (wars) that have been deployed on Tomcat before, but not a full-fledged EE application (ear). I would like the overview to be as generic as possible. I'm not looking for a tutorial on how to set up EJB3 on Glassfish built in NetBeans or some other vendor specific tutorial that's more about the IDE than the technology. I keep reading about Java, ejb-jar, web and ear modules but am not clear on what these different modules contain and how to use them to put together my app. In my case, I want to write a simple database CRUD web application. The first step is simple; create entity classes that model the database tables my app will be using. I plan on using annotations. Should I create a jar that contains just these enity classes? Is this the ejb-jar module (sometimes referred to as the Java module)? Next, I'll need some business logic classes that make use of the entity classes. These are the session beans (stateless or stateful) correct? Should these be packaged in the same jar as the entity classes or a separate jar? Finally, I'll need some sort of web interface (I'll be creating a JSF portlet) application that makes use of the both the session and entity beans. Together with the above jar(s), this will be my war? Assuming the above to be correct, what is involved in creating an ear? Forgive me if this post is vague, but I'm having a hard time defining what it is I don't understand. Thanks for any help!

    Read the article

  • Dom Nodes manipulations, how remove tags which wrap my selection?

    - by sanceray3
    Hi, I try to explain you my "problem". I would like to know when I select a part of text, if this text is “wrapped” by html tags, and in function delete them. For example with this sentence : The car is <strong>green</strong>, and the boat is black If I select “green” and click on a button, I would like verify if green is wrapped by <strong>(for that it’s ok), and in function delete <strong> tags without delete containing “green”. I have tried to do it, but when I remove child and recreate one, my new node is empty and if I try to put directly text in document.createTextNode, my new node appears but the <strong> tags stay. // Bouton CLICK $('input[type=button].btn_transform').click(function(){ var selObj = window.getSelection(); var parent=selObj.anchorNode.parentNode; if (parent.nodeName=='STRONG'){ parent.removeChild(selObj.anchorNode); var theText = document.createTextNode(selObj); parent.appendChild(theText); } }); I’m not a DOM manipulation specialist. Could you help me to solve this? Thanks very much for your precious help.

    Read the article

  • Filtering a select list via input box & jquery

    - by zSysop
    Hi all, I was wondering if i could get some help with filtering a select list using an input box via jquery. Here's what my js looks like, but it doesnt seem to work. I'm guessing this is because options within a select list are not hide-able. <script type="text/javascript"> $(document).ready(function() { $("#inputFilter").change(function() { var filter = $(this).val(); $("#selectList option").each(function() { var match = $(this).text().search(new RegExp(filter, "i")); if (match > 0) { $(this).show(); // Does not work } else $(this).hide(); }); }); }); </script> and here's my html <input id="inputFilter" /> <select id="selectList"> <option value="1111" text="1111 - London" /> <option value="1112" text="1111 - Paris" /> </select>

    Read the article

  • Drupal - Search box not working - custom theme template

    - by vr3690
    Hello, I am using a customised version of search-theme-from.tpl When I use the search box, I do get transferred to the search page. But the search does not actually take place. The search box on the search results page does work though. This is my search-them-form.tpl.php file (demo : <input type="text" name="search_theme_form_keys" id="edit-search-theme-form-keys" value="Search" title="Enter the terms you wish to search for" class="logininput" height="24px" onblur="restoreSearch(this)" onfocus="clearInput(this)" /> <input type="submit" name="op" id="edit-submit" value="" class="form-submit" style="display: none;" /> <input type="hidden" name="form_token" id="edit-search-theme-form-form-token" value="<?php print drupal_get_token('search_theme_form'); ?>" /> <input type="hidden" name="form_id" id="edit-search-theme-form" value="search_theme_form" /> There is also a javascript file involved. I guess it's use is pretty clear from the code: function trim(str) { return str.replace(/^\s+|\s+$/g, ''); } function clearInput(e) { e.value=""; // clear default text when clicked e.className="longininput_onfocus"; //change class } function restoreSearch(e) { if (trim(e.value) == '') { { e.value="Search"; // reset default text onBlur e.className="logininput"; //reset class } } } What can be the problem and how can I fix it?

    Read the article

< Previous Page | 654 655 656 657 658 659 660 661 662 663 664 665  | Next Page >