Search Results

Search found 19949 results on 798 pages for 'print css'.

Page 658/798 | < Previous Page | 654 655 656 657 658 659 660 661 662 663 664 665  | Next Page >

• How to Get the Method/Function Call Trace for a Specific Run?

  - by JackWM

  Given a Java or JavaScript program, after its execution, print out a sequence of calls. The calls are in invocation order. E.g. main() { A(); } A() { B(); C(); } Then the call trace should be: main -> A() -> B() -> C() Is there any tool that can profile and output this kind of information? It seems this is common a need for debugging or performance tuning. I noticed that some profilers can do this, but I prefer a simpler/easy-to-use one. Thanks!

  Read the article

• Mail php function does'nt send the email

  - by Mamadou

  Hello everybody, I have the following code wich work on some server and does not work in an other: $Name = "myname"; //senders name $email_sender = "[email protected]"; //senders e-mail adress $recipient = $email; //recipient $mail_body = "The text for the mail..."; //mail body $subject = "Subject for reviever"; //subject $header = "From: ". $Name . " <" . $email_sender . ">\r\n"; $status = mail($recipient, $subject, $mail_body, $header); print('ENVOI '. $status); the $status variable is true but i dont see any email.

  Read the article

• Regex for template tag with attributes

  - by Funkmyer

  Hi, I haven't found my answer after reading through all of these posts, so I'm hoping one of you heavy hitter regex folks can help me out. I'm trying to isolate the tag name and any attributes from the following string format: {TAG:TYPE attr1="foo" attr2="bar" attr3="zing" attr4="zang" attr5="zoom" ...} NOTE: in the above example, TAG will always be the same and TYPE will be one of several preset strings (e.g. share,print,display etc...). TAG and TYPE are uppercased only for the example but will not be case sensitive for real.

  Read the article

• PHP callback function not being called

  - by Industrial

  Hi everyone, I've got the following code: function _callback_memcache_failure($host, $port) { print "memcache '$host:$port' failed"; } $this->memcache = new Memcache; $this->memcache->addServer('192.168.1.35', '11211', 0, 50, 10, TRUE, _callback_memcache_failure('192.168.1.35','11211')); The server is online and running (verified!), but the Failure callback function is being called at each connection. Why is that? Reference: PHP documentation: Memcache::addServer - failure_callback Allows the user to specify a callback function to run upon encountering an error. The callback is run before failover is attempted. The function takes two parameters, the hostname and port of the failed server .

  Read the article

• Project Euler: problem 8

  - by Marijus

  n = # some ridiculously large number, omitted N = [int(i) for i in str(n)] maxProduct = 0 for i in range(0,len(N)-4): newProduct = 1 is_cons = 0 for j in range(i,i+4): if N[j] == N[j+1] - 1: is_cons += 1 if is_cons == 5: for j in range(i,i+5): newProduct *= N[j] if newProduct > maxProduct: maxProduct = newProduct print maxProduct I've been working on this problem for hours now and I can't get this to work. I've tried doing this algorithm on paper and it works just fine.. Could you give me hints what's wrong ?

  Read the article

• Python metaclass to run a class method automatically on derived class

  - by Barry Steyn

  I want to automatically run a class method defined in a base class on any derived class during the creation of the class. For instance: class Base(object): @classmethod def runme(): print "I am being run" def __metclass__(cls,parents,attributes): clsObj = type(cls,parents,attributes) clsObj.runme() return clsObj class Derived(Base): pass: What happens here is that when Base is created, ''runme()'' will fire. But nothing happens when Derived is created. The question is: How can I make ''runme()'' also fire when creating Derived. This is what I have thought so far: If I explicitly set Derived's metclass to Base's, it will work. But I don't want that to happen. I basically want Derived to use the Base's metaclass without me having to explicitly set it so.

  Read the article

• How can I insert a line at the beginning of a file with Perl's Tie::File?

  - by thebourneid

  I'm trying to insert/add a line 'COMMENT DUMMY' at the beginnig of a file as a first row if /PATTERN/ not found. I know how to do this with OPEN CLOSE function. Probably after reading the file it should look something like this: open F, ">", $fn or die "could not open file: $!"; ; print F "COMMENT DUMMY\n", @array; close F; But I have a need to implement this with the use of the Tie::File function and don't know how. use strict; use warnings; use Tie::File; my $fn = 'test.txt'; tie my @lines, 'Tie::File', $fn or die "could not tie file: $!"; untie @lines;

  Read the article

• Creating interruptible process in python

  - by Glycerine

  I'm creating a python script of which parses a large (but simple) CSV. It'll take some time to process. I would like the ability to interrupt the parsing of the CSV so I can continue at a later stage. Currently I have this - of which lives in a larger class: (unfinished) Edit: I have some changed code. But the system will parse over 3 million rows. def parseData(self) reader = csv.reader(open(self.file)) for id, title, disc in reader: print "%-5s %-50s %s" % (id, title, disc) l = LegacyData() l.old_id = int(id) l.name = title l.disc_number = disc l.parsed = False l.save() This is the old code. def parseData(self): #first line start fields = self.data.next() for row in self.data: items = zip(fields, row) item = {} for (name, value) in items: item[name] = value.strip() self.save(item) Thanks guys.

  Read the article

• javascript really strange behaviour

  - by teehoo

  I have the following code if (msg.position == 0) //removed for brevity else if (msg.position == txtArea.value.length) //removed for brevity } else { //ERROR: should not reach here. errorDivTag.innerHTML += msg.position + " " + txtArea.value.length; } I'm having some really weird situations where I'm getting the error in the last code block, but the printed positions show that msg.position is in fact equal to the txtArea.value.length. This only happens 1% of the time, almost as if I have some kind of race-condition in my code where the two are NOT equal during the second if statement, but equal when I print in the error message. Any ideas?

  Read the article

• How to use jquery .animate() to mock 'text-align:right'

  - by mrwienerdog

  I am building a very simple jquery menu. On hover, I have a menu on the right easing to the left margin of my menu container. This is easy, as the text is left aligned within said container. However, I also have a menu on the left, and because the links (left justified) are of differing length, the best I can do is adjust the padding to ease the text a uniform amount between links. Therefor, long link text goes to the right edge of the container, buy short text only makes it about half way. In reading about this, I have learned that you can not modify the text align property as it is non numeric. Is there any other way to do this? I of course tried to go with: $('#selector').css('text-align':'right') but that made the text jump to the right instead of ease. Is there any way to ensure all links ease to the rightmost margin of the container?

  Read the article

• simple php script

  - by Nerdysyntax

  New to php and taking a class for it. Bought php6 and mysql 6 bible to get started. Of course the hello world script is the first you get and it doesn't show. It just reads part of my script and I'm not sure the problem. Link to test - http://harden6615.com/ I am using a hosted server I bought for class, but I have also check it using MAMP. I figured my script is wrong, but I have copied and pasted and still no Hello World. Any suggestions? What I copied: <?php print("Hello, World<BR />\n"); phpinfo(); ?>

  Read the article

• /form making table go odd

  - by noryb009

  I have a table (3x3) that counts "< /form" as space in IE. The code for 1 td looks like: <style type="text/css"> table { border-width: 0px; border-collapse: collapse; padding: 0px; } td, th { padding: 0px; } </style> <table><tr><td><form name="form" action="index.php" method="post"><input type="hidden" name="from" value="a" /><input type="image" src="pic1.gif" alt="1" name="submit" value="submit" /></form></td> There is no spaces anywhere outside the tags. Inside the td, there is a form, with a hidden field and a picture. Firefox shows only the picture, but IE has spaces between the rows. I did a little debugging, and found it was from the /form. Does anyone know a fix to this?

  Read the article

• Seek a jQuery-based inplace HTML editor

  - by justSteve

  I just stepped over to http://plugins.jquery.com/search/node/editor - lots and lots of choices - and if to judge by the dates, many new offerings. I'm hoping someone can help me narrow down the field according to these priorities... Stability & Well-formed XHTML (might argue against some of the most recent unless they are revisions with a clear track-record) Inplace editing Good AJAX integration For internal / admin / CMS usage so it can be as bloated as it needs to be long as it's easy to implement the basics: bold ital indents lists No need for tables but dropdowns that show relevent CSS selectors would be nice. thnkx

  Read the article

• Remove Class on input cheched not working

  - by Manna

  I have set that if the Input checkbox is checked the opacity turn from 0.5 to 1. It'not working, it actually works if i do the opposite, but this is not my goal! My CSS code .opacitychange {opacity: 1;} #total {opacity: 0.5} and if($("#iva").is(':checked')) { $('#total').html('+' + vat); total += vat; $('#total').addClass("opacitychange"); } else $('#total').html('0.00').removeClass("opacitychange"); if($("#irpef").is(':checked')) { $('#total1').html('-' + irpf); total -= irpf; $('#total1').addClass("opacitychange"); } else $('#total1').html('0.00').removeClass("opacitychange"); $("#total2").html(total.toFixed(2)); }; What's wrong? Here the case

  Read the article

• How to know if the website being scraped has changed?

  - by Lost_in_code

  I'm using PHP to scrape a website and collect some data. It's all done without using regex. I'm using php's explode() method to find particular HTML tags instead. It is possible that if the structure of the website changes (CSS, HTML), then wrong data may be collected by the scraper. So the question is - how do I know if the HTML structure has changed? How to identify this before storing any data to my database to avoid wrong data being stored.

  Read the article

• finding the numbers in a given range?

  - by Jamis

  Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

  Read the article

• deleting unaccessed files using python

  - by damon

  My django app parses some files uploaded by the user.It is possible that the file uploaded by the user may remain in the server for a long time ,without it being parsed by the app.This can increase in size if a lot of users upload a lot of files. I need to delete those files not recently parsed by the app -say not accessed for last 24 hours.I tried like this import os import time dirname = MEDIA_ROOT+my_folder filenames = os.listdir(dirname) filenames = [os.path.join(dirname,filename) for filename in filenames] for filename in filenames: last_access = os.stat(filename).st_atime #secs since epoch rtime = time.asctime(time.localtime(last_access)) print filename+'----'+rtime This shows the last accessed times for each file..But I am not sure how I can test if the file access time was within the last 24 hours..Can somebody help me out?

  Read the article

• Python Class Variables Question

  - by zyq524

  I have some doubt about python's class variables. As my understanding, if I define a class variable, which is declared outside the init() function, this variable will create only once as a static variable in C++. This seems right for some python types, for instance, dict and list type, but for those base type, e.g. int,float, is not the same. For example: class A: dict1={} list1=list() int1=3 def add_stuff(self, k, v): self.dict1[k]=v self.list1.append(k) self.int1=k def print_stuff(self): print self.dict1,self.list1,self.int1 a1 = A() a1.add_stuff(1, 2) a1.print_stuff() a2=A() a2.print_stuff() The output is: {1: 2} [1] 1 {1: 2} [1] 3 I understand the results of dict1 and list1, but why does int1 behavior different?

  Read the article

• c++ Mixing printf, cout with wprintf, wcout

  - by Bo Jensen

  I know you should not mix printing with printf,cout and wprintf,wcout, but have a hard time finding a good answer why and if it is possible to get round it. The problem is I use a external library that prints with printf and my own uses wcout. If I do a simple example it works fine, but from my full application it simply does not print the printf statements. If this is really a limitation, then there would be many libraries out there which can not work together with wide printing applications. Any insight on this is more than welcome.

  Read the article

• Several modules in a package importing one common module

  - by morpheous

  I am writing a python package. I am using the concept of plugins - where each plugin is a specialization of a Worker class. Each plugin is written as a module (script?) and spawned in a separate process. Because of the base commonality between the plugins (e.g. all extend a base class 'Worker'), The plugin module generally looks like this: import commonfuncs def do_work(data): # do customised work for the plugin print 'child1 does work with %s' % data In C/C++, we have include guards, which prevent a header from being included more than once. Do I need something like that in Python, and if yes, how may I make sure that commonfuncs is not 'included' more than once?

  Read the article

• Problem while redirecting user after registration

  - by Eternal Learner

  I am creating a simple website . My situation is like this. After registering an user, I want to redirect the user after say 3 seconds to a main page(if the registration succeeds) . The code I have now is as below $query = "INSERT INTO Privileges VALUES('$user','$password1','$role')"; $result = mysql_query($query, $dbcon) or die('Registration Failed: ' . mysql_error()); print 'Thanks for Registering , You will be redirected shortly'; ob_start(); echo "Test"; header("Location: http://www.php.net"); ob_flush() I get the error message Warning: Cannot modify header information - headers already sent by (output started at/home/srinivasa/public_html/ThanksForRegistering.php:27) in /home/srinivasa /public_html/ThanksForRegistering.php on line 35. What do I need to do now ?

  Read the article

• Can't subtract in a for loop in C/Objective-C

  - by user1612935

  I'm going through the Big Nerd Ranch book on Objective-C, which takes you through some early C stuff. I've played with C before, and am pretty experienced in PHP. Anyhow, I'm doing the challenges and this one is not working the way I think it should. It's pretty simple - start at 99, loop through and subtract three until you get to zero, and every time you get a number that is divisible by 5 print "Found one." Pretty straightforward. However, subtracting by three in the for loop is not working #include <stdio.h> int main (int argc, const char * argv[]) { int i; for(i = 99; i > 0; i-3){ printf("%d\n", i); if(i % 5 == 0) { printf("Found one!\n"); } } return 0; } It creates and endless loop at 99, and I'm not sure why.

  Read the article

• What does it mean when a Perl method returns a "hashref"?

  - by Uri

  I'm trying to decrypt a Perl code which I'm not familiar with, somehow related to HashRef. I'm using Amazon::S3, but my question is a general Perl question. See the code below: use Amazon::S3; my $s3 = Amazon::S3->new( ... ); my $response = $s3->buckets; Documentation (here) sais, about s3-buckets: Returns undef on error, else HASHREF of results The following line is working for me, but I don't understand why: for $b in ( @ { $response->{buckets} } ) { print "bucket: " . $b->bucket . "\n"; } I'm Puzzled by each operator on the first line. What type exactly are $response, $respone->{bucket}. Looks like the expression within the for is an array, but I don't understand this syntax: @{ ... }?

  Read the article

• python dict.fromkeys() returns empty

  - by slooow

  I wrote the following function. It returns an empty dictionary when it should not. The code works on the command line without function. However I cannot see what is wrong with the function, so I have to appeal to your collective intelligence. def enter_users_into_dict(userlist): newusr = {} newusr.fromkeys(userlist, 0) return newusr ul = ['john', 'mabel'] nd = enter_users_into_dict(ul) print nd It returns an empty dict {} where I would expect {'john': 0, 'mabel': 0}. It is probably very simply but I don't see the solution.

  Read the article

• Any way to assign terminal output to variable with python?

  - by Gordon Fontenot

  I need to grab the duration of a video file via python as part of a larger script. I know I can use ffmpeg to grab the duration, but I need to be able to save that output as a variable back in python. I thought this would work, but it's giving me a value of 0: cmd = 'ffmpeg -i %s 2>&1 | grep "Duration" | cut -d \' \' -f 4 | sed s/,//' % ("Video.mov") duration = os.system(cmd) print duration Am I doing the output redirect wrong? Or is there simply no way to pipe the terminal output back into python?

  Read the article

< Previous Page | 654 655 656 657 658 659 660 661 662 663 664 665  | Next Page >