Search Results

Search found 39082 results on 1564 pages for 'magic function'.

Page 659/1564 | < Previous Page | 655 656 657 658 659 660 661 662 663 664 665 666  | Next Page >

  • why does backbone not send the delete?

    - by Nippysaurus
    I have a very basic backbone (sample) application which just creates and destroys model items. When the model is created the object is persisted with a POST to the web server, but when the model is destroyed there is no DELETE sent to the server? Any idea why this might be? very basic model: window.User = Backbone.Model.extend({ urlRoot: 'users' }); my test code just to create and delete the model: var model = null; $(".add").click(function(){ if (model == null) { model = new window.User; model.set({name: 'meeee'}); model.save(); } }); $(".remove").click(function(){ if (model != null) { model.destroy(); } }); The JSON response when creating the model seems good too:

    Read the article

  • XCode, error: '_object' undeclared. Need some help solving this problem

    - by user309030
    I've got this code in my viewController.m file - (void)viewDidLoad { [super viewDidLoad]; GameLogic *_game = [[GameLogic alloc] init]; [_game initGame]; ....... } GameLogic is another class which I created. in the same viewController.m file, I have got another function - (void)test { if([_game returnElecFence]) { NSLog(@"YES"); } else { NSLog(@"NO"); } } Problem is, whenever the test function is called, I get an error saying '_game' undeclared. I tried putting the GameLogic init code in the .h file and on top of the @implementation to make it global but every method I tried resulted in a worse error. TIA to anyone who can suggest some ideas to clear this error up

    Read the article

  • Getting value from key pair value into appended property using jQuery

    - by Neil
    How do I get the value from a key pair value into the rel property of an anchor tag? When I split the code to put the value in the correct place it doesn't work, the end of the a tag would appear on screen instead value wouldn't be applied. When I look at the resulting code in console in Firebug the rel and href swapped order so the rel is first. The 'key' should be and is in the correct location but the 'value' needs to be applied to the rel attribute. What am I doing wrong? $(function() { var obj = {"firstThing":"4","secondThing":"6","aThirdThing":"2","anotherThing":"3","followedByAnother":"4"}; $.each(obj, function(key,value) { $('#newmine').append("<li class='tagBlocks'>","<a href='#' rel=''>",value," ",key); }); });

    Read the article

  • Fullscreen image with jquery on window resize?

    - by lauthiamkok
    I am trying to make fullscreen images with jquery when the window resize function is triggered. But I get this kind of result - where you can see a gap at the bottom of the image which I don't know how to fix it. the basic html, <!-- container --> <div id="container" class="container"> <div class="holder-supersize" id="supersize"> <ul class="background-supersize"> <li><a href="#"><img src="styles/images/IMG_0250.jpg" alt="" width="1000" height="667" /></a></li> <li><a href="#"><img src="styles/images/IMG_0255.jpg" alt="" width="667" height="1000" /></a></li> <li class="active"><a href="#"><img src="styles/images/IMG_0323.jpg" alt="" width="1158" height="772" /></a></li> </ul> </div> </div> <!-- container --> jquery for updating image size on window resize, $(document).ready(function(){ $(window).resize(function(){ $(".holder-supersize").each(function() { //Define image ratio & minimum dimensions var minwidth = .5*(640); var minheight = .5*(480); var ratio = 480/640; //Gather browser and current image size var imagewidth = $(this).width(); var imageheight = $(this).height(); var browserwidth = $(window).width(); var browserheight = $(window).height(); //Check for minimum dimensions if ((browserheight < minheight) && (browserwidth < minwidth)){ $(this).height(minheight); $(this).width(minwidth); } else { //When browser is taller if (browserheight > browserwidth){ imageheight = browserheight; $(this).height(browserheight); imagewidth = browserheight/ratio; $(this).width(imagewidth); if (browserwidth > imagewidth){ imagewidth = browserwidth; $(this).width(browserwidth); imageheight = browserwidth * ratio; $(this).height(imageheight); } } //When browser is wider if (browserwidth >= browserheight){ imagewidth = browserwidth; $(this).width(browserwidth); imageheight = browserwidth * ratio; $(this).height(imageheight); if (browserheight > imageheight){ imageheight = browserheight; $(this).height(browserheight); imagewidth = browserheight/ratio; $(this).width(imagewidth); } } } return false; }); }); }); CSS for supersize image /* Supersize -------------------------------------------*/ .holder-supersize { width:100%; height:100%; position:absolute; left:0; top:0; z-index:0; } .background-supersize { width:100%; height:100%; overflow:hidden; position:relative; } .background-supersize li { width:100%; height:100%; overflow:hidden; position:absolute; left:0; top:0; text-align:center; } .background-supersize li img { /* for image with height < width */ /**/ width:100%; height:auto; /* for image with height > width */ /* width:auto; height:100%; */ } .background-supersize li , .background-supersize a, .background-supersize img{ display:none; } .background-supersize .active, .background-supersize .active a, .background-supersize .active img{ display:inline; } This is the link at jsfiddle and this is the link to see the actual product. Any ideas what I have done wrong and how can I fix it?

    Read the article

  • Encoding gives "'ascii' codec can't encode character … ordinal not in range(128)"

    - by user140314
    I am working through the Django RSS reader project here. The RSS feed will read something like "OKLAHOMA CITY (AP) — James Harden let". The RSS feed's encoding reads encoding="UTF-8" so I believe I am passing utf-8 to markdown in the code snippet below. The em dash is where it chokes. I get the Django error of "'ascii' codec can't encode character u'\u2014' in position 109: ordinal not in range(128)" which is an UnicodeEncodeError. In the variables being passed I see "OKLAHOMA CITY (AP) \u2014 James Harden". The code line that is not working is: content = content.encode(parsed_feed.encoding, "xmlcharrefreplace") I am using markdown 2.0, django 1.1, and python 2.4. What is the magic sequence of encoding and decoding that I need to do to make this work? Thanks.

    Read the article

  • Inverse relationship of two variables

    - by Jam
    this one is maybe pretty stupid.. Or I am just exhausted or something, but I just cant seem to solve it.. Problem : two variables X and Y, value of Y is dependent on value of X. X can have values ranging from some value to some value (lets say from 0 to 250) and y can have different values (lets say from 0.1 to 1.0 or something..) - but it is inverse relatonship (what I mean is: if value of X is e.g. 250, then value of Y would be 0.1 and when X decreases up to 0, value of Y raises up to 1.0.. So how should I do it? lets say I have function: -- double computeValue (double X) { /computation/ return Y; } Also, is there some easy way to somehow make the scaling of the function not so linear? - For example when X raises, Y decreases slower at first but then more rapidly in the end.. (rly dont know how to say it but I hope you guys got it) Thanks in advance for this stupid question :/

    Read the article

  • How can I group an array of rectangles into "Islands" of connected regions?

    - by Eric
    The problem I have an array of java.awt.Rectangles. For those who are not familiar with this class, the important piece of information is that they provide an .intersects(Rectangle b) function. I would like to write a function that takes this array of Rectangles, and breaks it up into groups of connected rectangles. Lets say for example, that these are my rectangles (constructor takes the arguments x, y, width,height): Rectangle[] rects = new Rectangle[] { new Rectangle(0, 0, 4, 2), //A new Rectangle(1, 1, 2, 4), //B new Rectangle(0, 4, 8, 2), //C new Rectangle(6, 0, 2, 2) //D } A quick drawing shows that A intersects B and B intersects C. D intersects nothing. A tediously drawn piece of ascii art does the job too: +-------+ +---+ ¦A+---+ ¦ ¦ D ¦ +-+---+-+ +---+ ¦ B ¦ +-+---+---------+ ¦ +---+ C ¦ +---------------+ Therefore, the output of my function should be: new Rectangle[][]{ new Rectangle[] {A,B,C}, new Rectangle[] {D} } The failed code This was my attempt at solving the problem: public List<Rectangle> getIntersections(ArrayList<Rectangle> list, Rectangle r) { List<Rectangle> intersections = new ArrayList<Rectangle>(); for(Rectangle rect : list) { if(r.intersects(rect)) { list.remove(rect); intersections.add(rect); intersections.addAll(getIntersections(list, rect)); } } return intersections; } public List<List<Rectangle>> mergeIntersectingRects(Rectangle... rectArray) { List<Rectangle> allRects = new ArrayList<Rectangle>(rectArray); List<List<Rectangle>> groups = new ArrayList<ArrayList<Rectangle>>(); for(Rectangle rect : allRects) { allRects.remove(rect); ArrayList<Rectangle> group = getIntersections(allRects, rect); group.add(rect); groups.add(group); } return groups; } Unfortunately, there seems to be an infinite recursion loop going on here. My uneducated guess would be that java does not like me doing this: for(Rectangle rect : allRects) { allRects.remove(rect); //... } Can anyone shed some light on the issue?

    Read the article

  • warning: (Internal error: pc 0x804a6b0 in read in psymtab, but not in symtab.) g++

    - by Sriram
    Hi, I am trying to debug a program using ddd. When I try to enter any function, or within main() itself, I get the following warning: warning: (Internal error: pc 0x804a6b0 in read in psymtab, but not in symtab.) This warning flashes whenever I try to move to another instruction using 'n' or enter or leave a function. I have tried to look this up in other forums, but with no conclusive answer. The code I am trying to debug runs into several files and I am not sure if I can post the entire code here. I am using g++ version: g++ (GCC) 4.4.1 20090725 (Red Hat 4.4.1-2) Any help on this is most welcome. Thanks, Sriram.

    Read the article

  • Mocking imported modules in Python

    - by Evgenyt
    I'm trying to implement unit tests for function that uses imported external objects. For example helpers.py is: import os import pylons def some_func(arg): ... var1 = os.path.exist(...) var2 = os.path.getmtime(...) var3 = pylons.request.environ['HTTP_HOST'] ... So when I'm creating unit test for it I do some mocking (minimock in my case) and replacing references to pylons.request and os.path: import helpers def test_some_func(): helpers.pylons.request = minimock.Mock("pylons.request") helpers.pylons.request.environ = { 'HTTP_HOST': "localhost" } helpers.os.path = minimock.Mock(....) ... some_func(...) # assert ... This does not look good for me. Is there any other better way or strategy to substitute imported function/objects in Python?

    Read the article

  • How do I process a jQuery SVG group event in a single handler?

    - by rmflow
    I'm trying to draw a button using jQuery SVG, the button is a filled rect and the text is placed on top of the rect. Rect and text are grouped and I want to control the mouseover/mouseout events. The problem is: mouseover/mouseout events are triggered separately for every element of the group. Is it possible to make a single event handler for entire group? Here is an example: gClear = svg.group(); btClear = svg.rect(gClear, 10, 10, 100, h-20, 5 ,5, attrs); txtClear = svg.text(gClear, 35, 30, "Clear", {fontFamily: "Verdana", fontWeight: "bold", fontSize: "16px"}); $(gClear, svg.root()).bind("mouseover", function() { $(btClear).animate({svgFill: '#adf'}, 100); }).bind("mouseout", function() { $(btClear).animate({svgFill: '#fff'}, 100); }) When I move the mouse inside the rect the events mouseover/mouseout are triggered. Can I make "text" events transparent or can I have a single event handler for the group?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • XQuery fn:replace not behaving as expected

    - by CoolGravatar
    I have an Excel worksheet in XML format which contains <Cell ss:StyleID="s127"><Data ss:Type="String">A01-Replace</Data></Cell> I want to replace @A01-Replace with a different string. I'm using the XQuery's replace function like so: let $excel := doc("excel.xml") let $test := "another string" return replace($excel, "(A[0-9]+-Replace)", $test) Before calling replace, the variable $excel is valid XML upon output. However, when I output $excel after I call the replace function, all of the XML tags have been stripped, and $excel is a string with the content of the cells as its values. I would like to keep the XML tags there. Any ideas?

    Read the article

  • GLKit Memory Leak copywithZone

    - by TommyT39
    Running the instruments utility against the game I'm writing shows a bunch of memory leaks related to copy with Zone when I cycle through an array and draw some simple cube objects. Im not sure the best way to track this down as I'm new to OpenGL programming. My program is using ARC and is set to build for IOS 5. I am initializing GLKit to use OPenGl 2.0 and using the BafeEffect so I don't have to write my own shaders etc.. This shouldn't be rocket science. Im guessing that I must be not releasing something within the draw function. Below is the code to my draw function. Could you guys take a look and see if anything stands out as the problem? One other thing to note is that I'm using 15 different textures, the cubes can be 1 of 15 different ones. I have a property set on the cube class for the texture and I set it as I create the cube in there array. But I do load all 15 when my programs view did load starts.They are small .jps files that are less than 75k each and each cube uses the same texture all the way around so shouldn't be too big of an issue. Here is the code to my draw function: - (void)draw { GLKMatrix4 xRotationMatrix = GLKMatrix4MakeXRotation(rotation.x); GLKMatrix4 yRotationMatrix = GLKMatrix4MakeYRotation(rotation.y); GLKMatrix4 zRotationMatrix = GLKMatrix4MakeZRotation(rotation.z); GLKMatrix4 scaleMatrix = GLKMatrix4MakeScale(scale.x, scale.y, scale.z); GLKMatrix4 translateMatrix = GLKMatrix4MakeTranslation(position.x, position.y, position.z); GLKMatrix4 modelMatrix = GLKMatrix4Multiply(translateMatrix,GLKMatrix4Multiply(scaleMatrix,GLKMatrix4Multiply(zRotationMatrix, GLKMatrix4Multiply(yRotationMatrix, xRotationMatrix)))); GLKMatrix4 viewMatrix = GLKMatrix4MakeLookAt(0, 0, 1, 0, 0, -5, 0, 1, 0); effect.transform.modelviewMatrix = GLKMatrix4Multiply(viewMatrix, modelMatrix); effect.transform.projectionMatrix = GLKMatrix4MakePerspective(0.125*M_TAU, 1.0, 2, 0); effect.texture2d0.name = wallTexture.name; [effect prepareToDraw]; glEnable(GL_DEPTH_TEST); glEnable(GL_CULL_FACE); glEnableVertexAttribArray(GLKVertexAttribPosition); glVertexAttribPointer(GLKVertexAttribPosition, 3, GL_FLOAT, GL_FALSE, 0, triangleVertices); glEnableVertexAttribArray(GLKVertexAttribTexCoord0); glVertexAttribPointer(GLKVertexAttribTexCoord0, 2, GL_FLOAT, GL_FALSE, 0, textureCoordinates); glDrawArrays(GL_TRIANGLES, 0, 18); glDisableVertexAttribArray(GLKVertexAttribPosition); glDisableVertexAttribArray(GLKVertexAttribTexCoord0); }

    Read the article

  • highlight query string in more than one field using solr search feature

    - by Romi
    i am using solr indexes for showing my search results. to show serch results i am parsing json data received from solr. i am able to highlight a query string in search result but only in a single field. for this i set hl=true and hl.fl="field1". i did it as $.getJSON("http://192.168.1.9:8983/solr/db/select/?wt=json&&start=0&rows=100&q="+lowerCaseQuery+"&hl=true&hl.fl=description,name&hl.usePhraseHighlighter=true&sort=price asc&json.wrf=?", function(result){ var n=result.response.numFound var highlight = new Array(n); $.each(result.highlighting, function(i, hitem){ var match = hitem.text[0].match(/<em>(.*?)<\/em>/); highlight[i]=match[1]; }); $.each(newresult.response.docs, function(i,item){ var word=highlight[item["UID_PK"]]; var result = item.text[0].replace(new RegExp(word,'g'), '<em>' + word + '</em>'); }); for this json object is as : { "responseHeader": { "status": 0, "QTime": 32 }, "response": { "numFound": 21, "start": 0, "docs": [ { "description": "The matte finish waves on this wedding band contrast with the high polish borders. This sharp and elegant design was finely crafted in Japan.", "UID_PK": "8252", }, { "description": "This elegant ring has an Akoya cultured pearl with a band of bezel-set round diamonds making it perfect for her to wear to work or the night out.", "UID_PK": "8142", }, ] }, "highlighting": { "8252": { "description": [ " and <em>elegant</em> design was finely crafted in Japan." ] }, "8142": { "description": [ "This <em>elegant</em> ring has an Akoya cultured pearl with a band of bezel-set round diamonds making" ] }, } } Now if i want to highlight query string in two fields i did as hl=true hl.fl=descrption, name my json is as: { "responseHeader":{ "status":0, "QTime":16 }, "response":{ "numFound":1904, "start":0, "docs":[ { "description":"", "UID_PK":"7780", "name":[ "Diamond bracelet with Milgrain Bezel1" ] }, { "description":"This pendant is sure to win hearts. Round diamonds form a simple and graceful line.", "UID_PK":"8121", "name":[ "Heartline Diamond Pendant" ] }, "highlighting":{ "7780":{ "name":[ "<em>Diamond</em> bracelet with Milgrain Bezel1" ] }, "8121":{ "description":[ "This pendant is sure to win hearts. Round <em>diamonds</em> form a simple and graceful line." ], "name":[ "Heartline <em>Diamond</em> Pendant" ] } } } Now how should i parse it to get the result. suggest me some general technique, so if i want to highlight query in more fields then i could do so. Thanks

    Read the article

  • jQuery Plugin with $.getJSON Returning undefined?

    - by Oscar Godson
    Inside of a jQuery plugin I made I have: $.getJSON(base_url,{ agenda_id:defaults.id, action:defaults.action+defaults.type, output:defaults.output },function(json){ return json; }); And in a separate JS file (yes, it comes after the plugin): json = $('#agenda-live-preview').agenda({action:'get',type:'agenda',output:'json'}); alert(json[0].agenda_id); If i do the above $.getJSON and put an alert inside of the $.getJSON it works and returns "3", which is correct. If I do it like the json=$('#agenda-live-preview').agenda(...)... it returns undefined. My JSON is valid, and the json[0].agenda_id is correct also, I know it's in a callback, so how do I get the stuff inside of a callback in a function return?

    Read the article

  • Cloning a selector + all its children in jQuery?

    - by HipHop-opatamus
    I'm having trouble getting the following JQuery script to function properly - its functionality is as follows: 1) Hide the content below each headline 2) Upon clicking a headline, substitute the "#first-post" with the headline + the hidden content below the headline. I can only seem to get the script to clone the headline itself to #first-post, not the headline + the content beneath it. Any idea why? <HTML> <HEAD> <script src="http://code.jquery.com/jquery-latest.js"></script> </HEAD> <script> $(document).ready( function(){ $('.title').siblings().hide(); $('.title').click( function() { $('#first-post').replaceWith($(this).closest(".comment").clone().attr('id','first-post')); $('html, body').animate({scrollTop:0}, 'fast'); return false; }); }); </script> <BODY> <div id="first-post"> <div class="content"><p>This is a test discussion topic</p> </div> </div> <div class="comment"> <h2 class="title"><a href="#1">1st Post</a></h2> <div class="content"> <p>this is 1st reply to the original post</p> </div> <div class="test">1st post second line</div> </div> <div class="comment"> <h2 class="title"><a href="#2">2nd Post</a></h2> <div class="content"> <p>this is 2nd reply to the original post</p> </div> <div class="test">2nd post second line</div> </div> </div> <div class="comment"> <h2 class="title"><a href="#3">3rd Post</a></h2> <div class="content"> <p>this is 3rd reply to the original post</p> </div> <div class="test">3rd post second line</div> </div> </div> </BODY> </HTML>

    Read the article

  • Images saved with D3DXSaveSurfaceToFile will open in Paint, not Photoshop

    - by bsruth
    I'm using D3DXSaveSurfaceToFile to save windowed Direct3D 9 surfaces to PNG, BMP and JPG files. There are no errors returned from the D3DXSaveSurfaceToFile call and all files open fine in Windows Photo Viewer and Paint. But they will not open in a higher end image editing program such as Paint Shop Pro or Photoshop. The error messages from these programs basically say that the file is corrupted. If I open the files in Paint and then save them in the same file format with a different file name, then they'll open fine in the other programs. This leads me to believe that D3DXSaveSurfaceToFile is writing out non-standard versions of these file formats. Is there some way I can get this function to write out files that can be opened in programs like Photoshop without the intermediate step of resaving the files in Paint? Or is there another function I should be using that does a better job of saving a Direct3D surfaces to an image?

    Read the article

  • Generating random numbers in C

    - by moonstruckhorrors
    While searching for Tutorials on generating random numbers in C I found This Topic When I try to use the rand() function with parameters, I always get the random number generated 0. When I try to use the rand() function with parameters, I always get the value 41. And whenever I try to use arc4random() and random() functions, I get a LNK2019 error. Here's what I'm doing: #include <stdlib.h> int main() { int x; x = rand(6); printf("%d", x); } This code always generate 41. Where am I going wrong?? P.S. : I'm running Windows XP SP3 and using VS2010 Command Prompt as compiler. P.P.S. : Took me 15 minutes to learn how to format properly.

    Read the article

  • Javascript Canvas Element - Array Of Images

    - by Ben Shelock
    I'm just learning JS, trying to do things without jQuery, and I want to make something similar to this however I want to use an array of images instead of just the one. My image array is formed like this var image_array = new Array() image_array[0] = "image1.jpg" image_array[1] = "image2.jpg" And the canvas element is written like this. (Pretty much entirely taken from the Mozilla site) function draw() { var ctx = document.getElementById('canvas').getContext('2d'); var img = new Image(); img.src = 'sample.png'; img.onload = function(){ for (i=0;i<5;i++){ for (j=0;j<9;j++){ ctx.drawImage(img,j*126,i*126,126,126); } } } } It uses the image "sample.png" in that code but I want to change it to display an image from the array. Displaying a different one each time it loops. Apoligies if I've not explained this well.

    Read the article

  • Logical python question - handeling directories and files in them

    - by Konstantin
    Hello! I'm using this function to extract files from .zip archive and store it on the server: def unzip_file_into_dir(file, dir): import sys, zipfile, os, os.path os.makedirs(dir, 0777) zfobj = zipfile.ZipFile(file) for name in zfobj.namelist(): if name.endswith('/'): os.mkdir(os.path.join(dir, name)) else: outfile = open(os.path.join(dir, name), 'wb') outfile.write(zfobj.read(name)) outfile.close() And the usage: unzip_file_into_dir('/var/zips/somearchive.zip', '/var/www/extracted_zip') somearchive.zip have this structure: somearchive.zip 1.jpeg 2.jpeg another.jpeg or, somethimes, this one: somearchive.zip somedir/ 1.jpeg 2.jpeg another.jpeg Question is: how do I modify my function, so that my extracted_zip catalog would always contain just images, not images in another subdirectory, even if images are stored in somedir inside an archive.

    Read the article

  • Complicated conditional SQL query

    - by DevAno1
    I'm not even sure if it's possible but I need it for my Access database. So I have following db structure : Now I need to perform a query that takes category_id from my product and do the magic : - let's say product belongs to console (category_id is in table Console) - from console_types take type_id, where category_id == category_id - but if product belongs to console_game (category_id is in table console_game) - from console_game take game_cat_id, where category_id == category_id I'm not sure if mysql is capable of such thing. If not I'm really f&%ranked up. Maybe there is a way to split this into 2,3 separate queries ?

    Read the article

  • jQuery: form input values turns up undefined

    - by Seerumi
    Having problem with this bit of code qith jQuery. it should pick the values from current form and then submit them, but when I try to get them with jQuery they always turn up undefined. I know the SQL results are fine since they show correctly in HTML table, so it must be my inferior javascript skills. New with jQuery and I'm at loss :( PHP/HTML: echo "<table>\n" while ($row = odbc_fetch_array($query)) { echo "<form class='catForm'>\n"; echo "<input type=hidden class='catID' name='catID' value='".$row['running_id']."'/>\n"; echo "<tr>\n"; echo "<td>".$row['running_id']."</td>\n"; echo "<td>".$row['site_id']."</td>\n"; echo "<td>".$row['main_category']."</td>\n"; echo "<td>".$row['map_name']."</td>\n"; echo "<td><input type=textfield class='bCatID' value='".$row['mapping_id']."' size=6/></td>\n"; echo "<td><input type=submit class='saveCat' value='Save'/></td>\n"; echo "<td><input type=submit class='killCat' value='Delete' /></td>\n"; echo "</tr>\n"; echo "</form>\n"; } echo "</table>"; jQuery: $(".catForm").submit(function () { var id = $(this).find('.catID').val(); var bCatID = $(this).find('.bCatID').val(); var dataString = 'id='+id+'&bCatID='+bCatID; $.ajax({ type: "POST", url: 'adminUI/bin/updateSCategories.php', dataType : 'json', data: dataString, success: function(data) { if (data.error == true) $('.failure').html("Error, save failed.").show().fadeOut(2000); if (data.error == false) $('.success').html("Saved succesfully").show().fadeOut(2000); }, error: function(XMLHttpRequest, textStatus, errorThrown) { $('.failure').html("Error, save failed.").show().fadeOut(2000); } }); return false; }); RESULT: id: undefined bCatID: undefined

    Read the article

  • python logparse search specific text

    - by krisdigitx
    hi, I am using this function in my code to return the strings i want from reading the log file, I want to grep the "exim" process and return the results, but running the code gives no error, but the output is limited to three lines, how can i just get the output only related to exim process.. #output: {'date': '13', 'process': 'syslogd', 'time': '06:27:33', 'month': 'May'} {'date': '13', 'process': 'exim[23168]:', 'time': '06:27:33', 'month': 'May'} {'May': ['syslogd']} #function: def generate_log_report(logfile): report_dict = {} for line in logfile: line_dict = dictify_logline(line) print line_dict try: month = line_dict['month'] date = line_dict['date'] time = line_dict['time'] #process = line_dict['process'] if "exim" in line_dict['process']: process = line_dict['process'] break else: process = line_dict['process'] except ValueError: continue report_dict.setdefault(month, []).append(process) return report_dict

    Read the article

  • In Javascript, by what mechanism does setting an Image src property trigger an image load?

    - by brainjam
    One of the things you learn early on when manipulating a DOM using Javascript is the following pattern: var img = new Image(); // Create new Image object img.onload = function(){ // execute drawImage statements here } img.src = 'myImage.png'; // Set source path As far as I know, in general when you set an object property there are no side effects. So what is the mechanism for triggering an image load? Is it just magic? Or can I use a similar mechanism to implement a class Foo that supports a parallel pattern? var foo = new Foo(); // Create new object foo.barchanged = function(){ // execute something after side effect has completed } foo.bar = 'whatever'; // Assign something to 'bar' property I'm vaguely aware of Javascript getters and setters. Is this how Image.src triggers a load?

    Read the article

  • jQuery: modify hidden form field value before submit

    - by Jason Miesionczek
    I have the following code in a partial view (using Spark): <span id="selectCount">0</span> video(s) selected. <for each="var video in Model"> <div style="padding: 3px; margin:2px" class="video_choice" id="${video.YouTubeID}"> <span id="video_name">${video.Name}</span><br/> <for each="var thumb in video.Thumbnails"> <img src="${thumb}" /> </for> </div> </for> # using(Html.BeginForm("YouTubeVideos","Profile", FormMethod.Post, new { id = "youTubeForm" })) # { <input type="hidden" id="video_names" name="video_names" /> <input type="submit" value="add selected"/> # } <ScriptBlock> $(".video_choice").click(function() { $(this).toggleClass('selected'); var count = $(".selected").length; $("#selectCount").html(count); }); var options = { target: '#videos', beforeSubmit: function(arr, form, opts) { var names = []; $(".selected").each(function() { names[names.length] = $(this).attr('id'); }); var namestring = names.join(","); $("#video_names").attr('value',namestring); //alert(namestring); //arr["video_names"] = namestring; //alert($.param(arr)); //alert($("#video_names").attr('value')); return true; } }; $("#youTubeForm").ajaxForm(options); </ScriptBlock> Essentially i display a series of divs that contain information pulled from the YouTube API. I use jQuery to allow the the user to select which videos they would like to add to their profile. When i submit the form i would like to populate the hidden field with a comma separated list of video ids. Everything works except that when i try to set the value of the field, in the controller on post, the field comes back empty. I am using the jQuery ajax form plugin. What am i doing wrong that is not allowing the value i set in the field to be sent to the server?

    Read the article

< Previous Page | 655 656 657 658 659 660 661 662 663 664 665 666  | Next Page >