Search Results

Search found 39082 results on 1564 pages for 'magic function'.

Page 659/1564 | < Previous Page | 655 656 657 658 659 660 661 662 663 664 665 666  | Next Page >

  • Clear Select options when selecting one field while using multiple forms on same page

    - by Nizam
    Hi all, I have a situation where the second select list option is generated from the first select list selected option. Like when we select Country corresponding states are generated in next select list. In my case I am having multiple forms on single page which are same. Can anyone let me know how to implement it on multiple forms. I tried the following code but it didn't work $(".country").change(function(){ $.get("sample.php?val=" + $(this).val(), function(data){ $(this).parent().next().children('.state').children('option').remove(); $(this).parent().next().children('.state').append(data); }); Waiting for your support thanks in advance

    Read the article

  • Drag and drop an image from desktop to a web text editor (implementation in javascript)

    - by fatmatto
    I tried to write reasonably short title but i failed i guess.. Hi everybody here's what i'm trying to do: I want to implement a web text editor able to recognize when the user drag a image file over it's editing surface and it automa(gically) starts the upload and insert the image near the cursor position. In other words i don't want the user to do the usual "insert-image-browse-ok". Atm i am not very good at javascript ... i know JQuery but i have not a clear idea about how to implement this... i don't know if there's an event handler able to help me in this situation... if not then there should be i think or web apps would miss some kind of interactivity. I've heard miracles about HTML5 could it help me? I've seen such things in Google Wave but that surface doesn't seem to be a form field... google lab's black magic i guess.... Thank you in advance.

    Read the article

  • jQuery: modify hidden form field value before submit

    - by Jason Miesionczek
    I have the following code in a partial view (using Spark): <span id="selectCount">0</span> video(s) selected. <for each="var video in Model"> <div style="padding: 3px; margin:2px" class="video_choice" id="${video.YouTubeID}"> <span id="video_name">${video.Name}</span><br/> <for each="var thumb in video.Thumbnails"> <img src="${thumb}" /> </for> </div> </for> # using(Html.BeginForm("YouTubeVideos","Profile", FormMethod.Post, new { id = "youTubeForm" })) # { <input type="hidden" id="video_names" name="video_names" /> <input type="submit" value="add selected"/> # } <ScriptBlock> $(".video_choice").click(function() { $(this).toggleClass('selected'); var count = $(".selected").length; $("#selectCount").html(count); }); var options = { target: '#videos', beforeSubmit: function(arr, form, opts) { var names = []; $(".selected").each(function() { names[names.length] = $(this).attr('id'); }); var namestring = names.join(","); $("#video_names").attr('value',namestring); //alert(namestring); //arr["video_names"] = namestring; //alert($.param(arr)); //alert($("#video_names").attr('value')); return true; } }; $("#youTubeForm").ajaxForm(options); </ScriptBlock> Essentially i display a series of divs that contain information pulled from the YouTube API. I use jQuery to allow the the user to select which videos they would like to add to their profile. When i submit the form i would like to populate the hidden field with a comma separated list of video ids. Everything works except that when i try to set the value of the field, in the controller on post, the field comes back empty. I am using the jQuery ajax form plugin. What am i doing wrong that is not allowing the value i set in the field to be sent to the server?

    Read the article

  • [R] multiple functions in one R script

    - by Philipp
    Hi, I guess it's a stupid question, but I don't get it :-( I wrote an R script, which creates heatmaps out of xls files. I am calling this R script with a Perl system call and pass over all the arguments. This all works fine. Now I wanted to make the R script less confusing by writing different functions in the R script, for example: args <- commandArgs(TRUE) parsexls <- function(filepath) { data <- read.xls(...) assign("data", data, globalenv()) } reorder <- function(var) { data <- data[order...] assign("data", data, globalenv()) } When I want to call the functions with parsexls(args[1]) reorder(args[2]) nothing happens. But when I place the parsexls(args[1]) in the script between the two functions shown above, the file is parsed correctly! The reorder(args[2]) seems never to be read. Any ideas what I am doing wrong? Phil

    Read the article

  • Encoding gives "'ascii' codec can't encode character … ordinal not in range(128)"

    - by user140314
    I am working through the Django RSS reader project here. The RSS feed will read something like "OKLAHOMA CITY (AP) — James Harden let". The RSS feed's encoding reads encoding="UTF-8" so I believe I am passing utf-8 to markdown in the code snippet below. The em dash is where it chokes. I get the Django error of "'ascii' codec can't encode character u'\u2014' in position 109: ordinal not in range(128)" which is an UnicodeEncodeError. In the variables being passed I see "OKLAHOMA CITY (AP) \u2014 James Harden". The code line that is not working is: content = content.encode(parsed_feed.encoding, "xmlcharrefreplace") I am using markdown 2.0, django 1.1, and python 2.4. What is the magic sequence of encoding and decoding that I need to do to make this work? Thanks.

    Read the article

  • AbsoluteTime with numeric argument behaves strangely.

    - by dreeves
    This is strange: DateList@AbsoluteTime[596523] returns {2078, 7, 2, 2, 42, 9.7849} But DateList@AbsoluteTime[596524] returns {1942, 5, 26, 20, 28, 39.5596} The question: What's going on? Note that AbsoluteTime with a numeric argument is undocumented. (I think I now know what it's doing but figured this is useful to have as a StackOverflow question for future reference; and I'm curious if there's some reason for that magic 596523 number.) PS: I encountered this when writing these utility functions for converting to and from unix time in Mathematica: (* Using Unix time (an integer) instead of Mathematica's AbsoluteTime... *) tm[x___] := AbsoluteTime[x] (* tm is an alias for AbsoluteTime. *) uepoch = tm[{1970}, TimeZone->0]; (* unixtm works analogously to tm. *) unixtm[x___] := Round[tm[x]-uepoch] (* tm & unixtm convert between unix & *) unixtm[x_?NumericQ] := Round[x-uepoch] (* mma epoch time when given numeric *) tm[t_?NumericQ] := t+uepoch (* args. Ie, they're inverses. *)

    Read the article

  • C# Event Handlers automatically created by WinForms Designer

    - by RHaguiuda
    Just moved from VB.NET to C#. In VB to connect and Event Handler to a Sub we use the Handles clause. From what it seems, this do not exist in C#. After creating a simple application with a button I realize that Window Forms Designer automatically created an EventHandler to my button1_Click function (after I double clicked it), in Form1.Designer.cs with this code: this.button1.Click += new System.EventHandler(this.button1_Click); But, in VB, the WinForms Designer create the Handles clause in my class, in the function header. So, C# create the default EventHandler in designer file, while VB creates in main class with control resides. Is this correct? Am I missing something here?

    Read the article

  • How do I process a jQuery SVG group event in a single handler?

    - by rmflow
    I'm trying to draw a button using jQuery SVG, the button is a filled rect and the text is placed on top of the rect. Rect and text are grouped and I want to control the mouseover/mouseout events. The problem is: mouseover/mouseout events are triggered separately for every element of the group. Is it possible to make a single event handler for entire group? Here is an example: gClear = svg.group(); btClear = svg.rect(gClear, 10, 10, 100, h-20, 5 ,5, attrs); txtClear = svg.text(gClear, 35, 30, "Clear", {fontFamily: "Verdana", fontWeight: "bold", fontSize: "16px"}); $(gClear, svg.root()).bind("mouseover", function() { $(btClear).animate({svgFill: '#adf'}, 100); }).bind("mouseout", function() { $(btClear).animate({svgFill: '#fff'}, 100); }) When I move the mouse inside the rect the events mouseover/mouseout are triggered. Can I make "text" events transparent or can I have a single event handler for the group?

    Read the article

  • XCode, error: '_object' undeclared. Need some help solving this problem

    - by user309030
    I've got this code in my viewController.m file - (void)viewDidLoad { [super viewDidLoad]; GameLogic *_game = [[GameLogic alloc] init]; [_game initGame]; ....... } GameLogic is another class which I created. in the same viewController.m file, I have got another function - (void)test { if([_game returnElecFence]) { NSLog(@"YES"); } else { NSLog(@"NO"); } } Problem is, whenever the test function is called, I get an error saying '_game' undeclared. I tried putting the GameLogic init code in the .h file and on top of the @implementation to make it global but every method I tried resulted in a worse error. TIA to anyone who can suggest some ideas to clear this error up

    Read the article

  • PHP Flatten Array with multiple leaf nodes

    - by tafaju
    What is the best way to flatten an array with multiple leaf nodes so that each full path to leaf is a distinct return? array("Object"=>array("Properties"=>array(1, 2))); to yield Object.Properties.1 Object.Properties.2 I'm able to flatten to Object.Properties.1 but 2 does not get processed with recursive function: function flattenArray($prefix, $array) { $result = array(); foreach ($array as $key => $value) { if (is_array($value)) $result = array_merge($result, flattenArray($prefix . $key . '.', $value)); else $result[$prefix . $key] = $value; } return $result; } I presume top down will not work when anticipating multiple leaf nodes, so either need some type of bottom up processing or a way to copy array for each leaf and process (althought that seems completely inefficient)

    Read the article

  • What is the proper way to declare a specialization of a template for another template type?

    - by Head Geek
    The usual definition for a specialization of a template function is something like this: class Foo { [...] }; namespace std { template<> void swap(Foo& left, Foo& right) { [...] } } // namespace std But how do you properly define the specialization when the type it's specialized on is itself a template? Here's what I've got: template <size_t Bits> class fixed { [...] }; namespace std { template<size_t Bits> void swap(fixed<Bits>& left, fixed<Bits>& right) { [...] } } // namespace std Is this the right way to declare swap? It's supposed to be a specialization of the template function std::swap, but I can't tell whether the compiler is seeing it as such, or whether it thinks that it's an overload of it or something.

    Read the article

  • some confusions to singleton pattern in PHP

    - by SpawnCxy
    Hi all, In my team I've been told to write resource class like this style: class MemcacheService { private static $instance = null; private function __construct() { } public static function getInstance($fortest = false) { if (self::$instance == null) { self::$instance = new Memcached(); if ($fortest) { self::$instance->addServer(MEMTEST_HOST, MEMTEST_PORT); } else { self::$instance->addServer(MEM_HOST, MEM_PORT); } } return self::$instance; } } But I think in PHP resource handles will be released and initialized again every time after a request over. That means MemcacheService::getInstance() is totally equal new Memcached() which cannot be called singleton pattern at all. Please correct me if I'm wrong. Regards

    Read the article

  • Intellisense in Visual Studio 2010

    - by Erik
    For some reason the Intellisense in vb.net stopped working when I use an Aggregate Lambda expression inside a With statement. With Me.SalesPackage .WebLinks = Sales.Where(Function(f) f.Current.BookerWeb > 0).Count .WebAmount = Aggregate o In Sales.Where(Function(f) f.Current.WebBooker > 0) Into Sum(o.Current.WebPrice) End With If I insert a new line between .WebLinks and .WebAmount and start typing, it works. But it won't work if I do it after the Aggregate statement... Any ideas?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • VB 2010 Express - Debugger is not breaking on errors, Sub producing error simply terminates

    - by hamlin11
    I'm using VB 2010 Express. When an error occurs in the form load function, the form load function simply terminates. Then, when I click on one of my buttons, the button click sub also terminates if it has an error. I can wrap the code that produces the errors in try/catch blocks, but I'd very much rather the debugger to throw an immediate break point (like usual) or at least exit the program. It's making it very difficult to program, not knowing whether or not previous Subs executed fully. Any thoughts on what might be going on? Thanks

    Read the article

  • How to get the first non-null value in Java?

    - by froadie
    Is there a Java equivalent of SQL's COALESCE function? That is, is there any way to return the first non-null value of several variables? e.g. Double a = null; Double b = 4.4; Double c = null; I want to somehow have a statement that will return the first non-null value of a, b, and c - in this case, it would return b, or 4.4. (Something like the sql method - return COALESCE(a,b,c)). I know that I can do it explicitly with something like: return a != null ? a : (b != null ? b : c) But I wondered if there was any built-in, accepted function to accomplish this.

    Read the article

  • Slider with keypress control bugs when keys pressed to quickly.

    - by Jaybuz
    Hello, I've made a slider that uses the left and right arrow keys to move the slide but when pressed to quickly it will bug a little and I was wondering if it's possible to limit the amount of presses in say a second. You can see it here: {link} $('#slider-nav div').click(function() { $('#slider-nav div').removeClass('selected').addClass(''); $('#slider-nav div:eq('+($.jcarousel.intval($(this).text())-1)+')').addClass('selected'); }) // Allow left and right keys to control slider $(document.documentElement).keypress(function(e) { var code = (e.keyCode ? e.keyCode : e.which); var direction = null; // handle cursor keys if (code == 37) { // left key direction = 'prev'; } else if (code == 39) { // right key direction = 'next'; } if (direction != null) { $('#slider-nav div.selected')[direction]().click(); } });

    Read the article

  • Using new Image().src for click tracking

    - by razass
    I am attempting to figure out why this click tracker isn't working. The code was written by another developer so I am not entirely sure if this ever did work. function trackSponsor(o, p) { (new Image()).src = PATH_BASE + 'click/' + p + '/' + o + "?_cache=" + (+(new Date())); return false; } From what I can gather is that when this function is called it 'creates a new image' to fire a php script asynchronously. According to Firebug, the request is made however it is 'aborted' ~30ms in. The odd thing is that it will 'sometimes' work as in 1 in every 10+ regardless of the browser. I would much rather fix this so that it works instead of re-writing it as an ajax request. Any help is appreciated. Thanks in advance.

    Read the article

  • Using jQuery to store basic text string in mySQL base?

    - by Kenny Bones
    Could someone point me in the right direction here? Basically, I've got this jQuery code snippet: $('.bggallery_images').click(function () { var newBG = "url('" + $(this).attr('src'); var fullpath = $(this).attr('src'); var filename = fullpath.replace('img/Bakgrunner/', ''); $('#wrapper').css('background-image', newBG); // Lagre til SQL $.ajax({ url: "save_to_db.php", // The url to your function to handle saving to the db data: filename, dataType: 'Text', type: 'POST', // Could also use GET if you prefer success: function (data) { // Just for testing purposes. alert('Background changed to: ' + data); } }); }); This is being run when I click a certain button. So it's actually within a click handler. If I understand this correctly, this snippet takes the source if the image I just clicked and strips it so I end up with only the filename. If I do an alert(filename), I get the filename only. So this is working ok. But then, it does an ajax call to a php file called "save_to_db.php" and sends data: filename. This is correct right? Then, it does a callback which does an alert + data. Does this seem correct so far? Cause my php file looks like this: <?php require("dbconnect2.php"); $uploadstring = $_POST['filename']; $sessionid = $_SESSION['id']; echo ($sessionid); mysql_query("UPDATE brukere SET brukerBakgrunn = '$uploadstring' WHERE brukerID=" .$_SESSION['id']); mysql_close(); ?> When I click the image, the jQuery snippet fires and I get the results of this php file as output for the alert box. I think that the variables somehow are empty. Because notice the echo($sessionid); which is a variable I've created just to test what the session ID is. And it returns nothing. What could be the issue here? Edit: I just tried to echo out the $uploadstring variable as well and it also returns nothing. It's like the jQuery snippet doesn't even pass the variable on to the php file?

    Read the article

  • GLKit Memory Leak copywithZone

    - by TommyT39
    Running the instruments utility against the game I'm writing shows a bunch of memory leaks related to copy with Zone when I cycle through an array and draw some simple cube objects. Im not sure the best way to track this down as I'm new to OpenGL programming. My program is using ARC and is set to build for IOS 5. I am initializing GLKit to use OPenGl 2.0 and using the BafeEffect so I don't have to write my own shaders etc.. This shouldn't be rocket science. Im guessing that I must be not releasing something within the draw function. Below is the code to my draw function. Could you guys take a look and see if anything stands out as the problem? One other thing to note is that I'm using 15 different textures, the cubes can be 1 of 15 different ones. I have a property set on the cube class for the texture and I set it as I create the cube in there array. But I do load all 15 when my programs view did load starts.They are small .jps files that are less than 75k each and each cube uses the same texture all the way around so shouldn't be too big of an issue. Here is the code to my draw function: - (void)draw { GLKMatrix4 xRotationMatrix = GLKMatrix4MakeXRotation(rotation.x); GLKMatrix4 yRotationMatrix = GLKMatrix4MakeYRotation(rotation.y); GLKMatrix4 zRotationMatrix = GLKMatrix4MakeZRotation(rotation.z); GLKMatrix4 scaleMatrix = GLKMatrix4MakeScale(scale.x, scale.y, scale.z); GLKMatrix4 translateMatrix = GLKMatrix4MakeTranslation(position.x, position.y, position.z); GLKMatrix4 modelMatrix = GLKMatrix4Multiply(translateMatrix,GLKMatrix4Multiply(scaleMatrix,GLKMatrix4Multiply(zRotationMatrix, GLKMatrix4Multiply(yRotationMatrix, xRotationMatrix)))); GLKMatrix4 viewMatrix = GLKMatrix4MakeLookAt(0, 0, 1, 0, 0, -5, 0, 1, 0); effect.transform.modelviewMatrix = GLKMatrix4Multiply(viewMatrix, modelMatrix); effect.transform.projectionMatrix = GLKMatrix4MakePerspective(0.125*M_TAU, 1.0, 2, 0); effect.texture2d0.name = wallTexture.name; [effect prepareToDraw]; glEnable(GL_DEPTH_TEST); glEnable(GL_CULL_FACE); glEnableVertexAttribArray(GLKVertexAttribPosition); glVertexAttribPointer(GLKVertexAttribPosition, 3, GL_FLOAT, GL_FALSE, 0, triangleVertices); glEnableVertexAttribArray(GLKVertexAttribTexCoord0); glVertexAttribPointer(GLKVertexAttribTexCoord0, 2, GL_FLOAT, GL_FALSE, 0, textureCoordinates); glDrawArrays(GL_TRIANGLES, 0, 18); glDisableVertexAttribArray(GLKVertexAttribPosition); glDisableVertexAttribArray(GLKVertexAttribTexCoord0); }

    Read the article

  • Optimizing python code performance when importing zipped csv to a mongo collection

    - by mark
    I need to import a zipped csv into a mongo collection, but there is a catch - every record contains a timestamp in Pacific Time, which must be converted to the local time corresponding to the (longitude,latitude) pair found in the same record. The code looks like so: def read_csv_zip(path, timezones): with ZipFile(path) as z, z.open(z.namelist()[0]) as input: csv_rows = csv.reader(input) header = csv_rows.next() check,converters = get_aux_stuff(header) for csv_row in csv_rows: if check(csv_row): row = { converter[0]:converter[1](value) for converter, value in zip(converters, csv_row) if allow_field(converter) } ts = row['ts'] lng, lat = row['loc'] found_tz_entry = timezones.find_one(SON({'loc': {'$within': {'$box': [[lng-tz_lookup_radius, lat-tz_lookup_radius],[lng+tz_lookup_radius, lat+tz_lookup_radius]]}}})) if found_tz_entry: tz_name = found_tz_entry['tz'] local_ts = ts.astimezone(timezone(tz_name)).replace(tzinfo=None) row['tz'] = tz_name else: local_ts = (ts.astimezone(utc) + timedelta(hours = int(lng/15))).replace(tzinfo = None) row['local_ts'] = local_ts yield row def insert_documents(collection, source, batch_size): while True: items = list(itertools.islice(source, batch_size)) if len(items) == 0: break; try: collection.insert(items) except: for item in items: try: collection.insert(item) except Exception as exc: print("Failed to insert record {0} - {1}".format(item['_id'], exc)) def main(zip_path): with Connection() as connection: data = connection.mydb.data timezones = connection.timezones.data insert_documents(data, read_csv_zip(zip_path, timezones), 1000) The code proceeds as follows: Every record read from the csv is checked and converted to a dictionary, where some fields may be skipped, some titles be renamed (from those appearing in the csv header), some values may be converted (to datetime, to integers, to floats. etc ...) For each record read from the csv, a lookup is made into the timezones collection to map the record location to the respective time zone. If the mapping is successful - that timezone is used to convert the record timestamp (pacific time) to the respective local timestamp. If no mapping is found - a rough approximation is calculated. The timezones collection is appropriately indexed, of course - calling explain() confirms it. The process is slow. Naturally, having to query the timezones collection for every record kills the performance. I am looking for advises on how to improve it. Thanks. EDIT The timezones collection contains 8176040 records, each containing four values: > db.data.findOne() { "_id" : 3038814, "loc" : [ 1.48333, 42.5 ], "tz" : "Europe/Andorra" } EDIT2 OK, I have compiled a release build of http://toblerity.github.com/rtree/ and configured the rtree package. Then I have created an rtree dat/idx pair of files corresponding to my timezones collection. So, instead of calling collection.find_one I call index.intersection. Surprisingly, not only there is no improvement, but it works even more slowly now! May be rtree could be fine tuned to load the entire dat/idx pair into RAM (704M), but I do not know how to do it. Until then, it is not an alternative. In general, I think the solution should involve parallelization of the task. EDIT3 Profile output when using collection.find_one: >>> p.sort_stats('cumulative').print_stats(10) Tue Apr 10 14:28:39 2012 ImportDataIntoMongo.profile 64549590 function calls (64549180 primitive calls) in 1231.257 seconds Ordered by: cumulative time List reduced from 730 to 10 due to restriction <10> ncalls tottime percall cumtime percall filename:lineno(function) 1 0.012 0.012 1231.257 1231.257 ImportDataIntoMongo.py:1(<module>) 1 0.001 0.001 1230.959 1230.959 ImportDataIntoMongo.py:187(main) 1 853.558 853.558 853.558 853.558 {raw_input} 1 0.598 0.598 370.510 370.510 ImportDataIntoMongo.py:165(insert_documents) 343407 9.965 0.000 359.034 0.001 ImportDataIntoMongo.py:137(read_csv_zip) 343408 2.927 0.000 287.035 0.001 c:\python27\lib\site-packages\pymongo\collection.py:489(find_one) 343408 1.842 0.000 274.803 0.001 c:\python27\lib\site-packages\pymongo\cursor.py:699(next) 343408 2.542 0.000 271.212 0.001 c:\python27\lib\site-packages\pymongo\cursor.py:644(_refresh) 343408 4.512 0.000 253.673 0.001 c:\python27\lib\site-packages\pymongo\cursor.py:605(__send_message) 343408 0.971 0.000 242.078 0.001 c:\python27\lib\site-packages\pymongo\connection.py:871(_send_message_with_response) Profile output when using index.intersection: >>> p.sort_stats('cumulative').print_stats(10) Wed Apr 11 16:21:31 2012 ImportDataIntoMongo.profile 41542960 function calls (41542536 primitive calls) in 2889.164 seconds Ordered by: cumulative time List reduced from 778 to 10 due to restriction <10> ncalls tottime percall cumtime percall filename:lineno(function) 1 0.028 0.028 2889.164 2889.164 ImportDataIntoMongo.py:1(<module>) 1 0.017 0.017 2888.679 2888.679 ImportDataIntoMongo.py:202(main) 1 2365.526 2365.526 2365.526 2365.526 {raw_input} 1 0.766 0.766 502.817 502.817 ImportDataIntoMongo.py:180(insert_documents) 343407 9.147 0.000 491.433 0.001 ImportDataIntoMongo.py:152(read_csv_zip) 343406 0.571 0.000 391.394 0.001 c:\python27\lib\site-packages\rtree-0.7.0-py2.7.egg\rtree\index.py:384(intersection) 343406 379.957 0.001 390.824 0.001 c:\python27\lib\site-packages\rtree-0.7.0-py2.7.egg\rtree\index.py:435(_intersection_obj) 686513 22.616 0.000 38.705 0.000 c:\python27\lib\site-packages\rtree-0.7.0-py2.7.egg\rtree\index.py:451(_get_objects) 343406 6.134 0.000 33.326 0.000 ImportDataIntoMongo.py:162(<dictcomp>) 346 0.396 0.001 30.665 0.089 c:\python27\lib\site-packages\pymongo\collection.py:240(insert) EDIT4 I have parallelized the code, but the results are still not very encouraging. I am convinced it could be done better. See my own answer to this question for details.

    Read the article

  • Chrome and Safari strange behaviour in Javascript

    - by mck89
    Hi, i've written this peace of code: var a=function(){ }; a.name="test"; a.prop="test2"; Now if i debug the code with the console: console.log(a.name); console.log(a.prop); In Firefox i get a.name="test" and a.prop="test2", while in Safari and Chrome i get a.prop="test2" but a.name="". It seems that there's no way to assign a "name" property on a function in Webkit browsers. Do you know why? But the most important thing is, do you know a workaround for that?

    Read the article

  • In Javascript, by what mechanism does setting an Image src property trigger an image load?

    - by brainjam
    One of the things you learn early on when manipulating a DOM using Javascript is the following pattern: var img = new Image(); // Create new Image object img.onload = function(){ // execute drawImage statements here } img.src = 'myImage.png'; // Set source path As far as I know, in general when you set an object property there are no side effects. So what is the mechanism for triggering an image load? Is it just magic? Or can I use a similar mechanism to implement a class Foo that supports a parallel pattern? var foo = new Foo(); // Create new object foo.barchanged = function(){ // execute something after side effect has completed } foo.bar = 'whatever'; // Assign something to 'bar' property I'm vaguely aware of Javascript getters and setters. Is this how Image.src triggers a load?

    Read the article

  • Inverse relationship of two variables

    - by Jam
    this one is maybe pretty stupid.. Or I am just exhausted or something, but I just cant seem to solve it.. Problem : two variables X and Y, value of Y is dependent on value of X. X can have values ranging from some value to some value (lets say from 0 to 250) and y can have different values (lets say from 0.1 to 1.0 or something..) - but it is inverse relatonship (what I mean is: if value of X is e.g. 250, then value of Y would be 0.1 and when X decreases up to 0, value of Y raises up to 1.0.. So how should I do it? lets say I have function: -- double computeValue (double X) { /computation/ return Y; } Also, is there some easy way to somehow make the scaling of the function not so linear? - For example when X raises, Y decreases slower at first but then more rapidly in the end.. (rly dont know how to say it but I hope you guys got it) Thanks in advance for this stupid question :/

    Read the article

  • Server Error Message: No File Access

    - by iMayne
    Hello. Im having an issues but dont know where to solve it. My template works great in xampp but not on the host server. I get this message: Warning: file_get_contents() [function.file-get-contents]: URL file-access is disables in the server configuration in homepage/......./twitter.php. The error is on line 64. <?php /* For use in the "Parse Twitter Feeds" code below */ define("SECOND", 1); define("MINUTE", 60 * SECOND); define("HOUR", 60 * MINUTE); define("DAY", 24 * HOUR); define("MONTH", 30 * DAY); function relativeTime($time) { $delta = time() - $time; if ($delta < 2 * MINUTE) { return "1 min ago"; } if ($delta < 45 * MINUTE) { return floor($delta / MINUTE) . " min ago"; } if ($delta < 90 * MINUTE) { return "1 hour ago"; } if ($delta < 24 * HOUR) { return floor($delta / HOUR) . " hours ago"; } if ($delta < 48 * HOUR) { return "yesterday"; } if ($delta < 30 * DAY) { return floor($delta / DAY) . " days ago"; } if ($delta < 12 * MONTH) { $months = floor($delta / DAY / 30); return $months <= 1 ? "1 month ago" : $months . " months ago"; } else { $years = floor($delta / DAY / 365); return $years <= 1 ? "1 year ago" : $years . " years ago"; } } /* Parse Twitter Feeds */ function parse_cache_feed($usernames, $limit, $type) { $username_for_feed = str_replace(" ", "+OR+from%3A", $usernames); $feed = "http://twitter.com/statuses/user_timeline.atom?screen_name=" . $username_for_feed . "&count=" . $limit; $usernames_for_file = str_replace(" ", "-", $usernames); $cache_file = dirname(__FILE__).'/cache/' . $usernames_for_file . '-twitter-cache-' . $type; if (file_exists($cache_file)) { $last = filemtime($cache_file); } $now = time(); $interval = 600; // ten minutes // check the cache file if ( !$last || (( $now - $last ) > $interval) ) { // cache file doesn't exist, or is old, so refresh it $cache_rss = file_get_contents($feed); (this is line 64) Any help on how to give this access on my host server?

    Read the article

< Previous Page | 655 656 657 658 659 660 661 662 663 664 665 666  | Next Page >