Search Results

Search found 15099 results on 604 pages for 'stop loading'.

Page 66/604 | < Previous Page | 62 63 64 65 66 67 68 69 70 71 72 73  | Next Page >

  • SetTimeout() and ClearTimeout() to stop freezing of IE8 and dialog aobut scripts overruning

    - by igl00
    I have some 3rd party software where i can open nsites and run javascript. Because some sites make me stack overflow i ussed the trick wih Registry to modify Styles WRAD to FFFFFF. Still some sites may do stack overflow due to DOM. I thought on start of running each site i would do javascript: setTimeout("window.status='one';",10000); then on then end i would like to clear it - my question is how to if this doesnt have any actual id? Will the usual clearTimeout() without anything inside do it fine?

    Read the article

  • loading xml into SQL Server 2008 using sqlbulkload component

    - by mohamed
    "Error: Schema: relationship expected on 'headerRecord'." I get the above error while load xml file to SQL Server 2008 using SQLXMLBulkLoad4 Component , the xml file contains Call Detail records, I have generated schema file from xml file using both , Dataset and XSD.exe tool, but the error remains same., if there is another way to imports xml file with multiple tables that have relationship in each file into SQL Server 2008? . Here the xml file: <CallEventDataFile> <headerRecord> <productionDateTime>0912021247482B0300</productionDateTime> <recordingEntity>00</recordingEntity> <extensions/> </headerRecord> <callEventRecords> <mtSMSRecord> <recordType>7</recordType> <serviceCentre>91521230</serviceCentre> <servedIMSI>36570000031728F2</servedIMSI> <servedIMEI>53886000707896F0</servedIMEI> <servedMSISDN>915212454503F2</servedMSISDN> <msClassmark>3319A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C6E</cellIdentifier> </location> <deliveryTime>0912021535412B0300</deliveryTime> <systemType> <gERAN/> </systemType> <basicService> <teleservice>21</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <calledParty/> </chargedParty> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C6E</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <origination>8191F2</origination> <callReference>1605EB2FE1</callReference> </mtSMSRecord> <moSMSRecord> <recordType>6</recordType> <servedIMSI>36570000238707F9</servedIMSI> <servedIMEI>53928320195925F0</servedIMEI> <servedMSISDN>915212159430F2</servedMSISDN> <msClassmark>3319A2</msClassmark> <serviceCentre>91521230</serviceCentre> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>001B</locationAreaCode> <cellIdentifier>6983</cellIdentifier> </location> <messageReference>01</messageReference> <originationTime>0912021535412B0300</originationTime> <destinationNumber>8111F1</destinationNumber> <systemType> <gERAN/> </systemType> <basicService> <teleservice>22</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <callingParty/> </chargedParty> <orgRNCorBSCId>8F1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705001B6983</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <callReference>1701BED4FF</callReference> </moSMSRecord> <ssActionRecord> <recordType>10</recordType> <servedIMSI>36570000636448F8</servedIMSI> <servedIMEI>53246030714961F0</servedIMEI> <servedMSISDN>915212056928F8</servedMSISDN> <msClassmark>3018A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>000C</locationAreaCode> <cellIdentifier>05A5</cellIdentifier> </location> <supplService>FF</supplService> <ssAction> <ussdInvocation/> </ssAction> <ssActionTime>0912021535412B0300</ssActionTime> <ssParameters> <unstructuredData>AA5C2E3702</unstructuredData> </ssParameters> <callReference>1701BED500</callReference> <systemType> <gERAN/> </systemType> <ussdCodingScheme>0F</ussdCodingScheme> <ussdString> <UssdString>AA5C2E3702</UssdString> </ussdString> <ussdRequestCounter>1</ussdRequestCounter> <additionalChgInfo> <chargeIndicator>1</chargeIndicator> </additionalChgInfo> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705000C05A5</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> </ssActionRecord> <moCallRecord> <recordType>0</recordType> <servedIMSI>36570000807501F5</servedIMSI> <servedIMEI>53246030713955F0</servedIMEI> <servedMSISDN>915212157901F0</servedMSISDN> <callingNumber>A151911700</callingNumber> <calledNumber>8151677589</calledNumber> <roamingNumber>A111113850</roamingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2F</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <msClassmark>3319A1</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED501</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <gsm-SCFAddress>915212110130</gsm-SCFAddress> <serviceKey>1</serviceKey> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <numberOfDPEncountered>3</numberOfDPEncountered> <levelOfCAMELService>01</levelOfCAMELService> <freeFormatData>800130</freeFormatData> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <callingParty/> </chargedParty> <mscOutgoingCircuit>1051</mscOutgoingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <calledIMSI>36570000635618F8</calledIMSI> <globalAreaID>36F70500060C2F</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </moCallRecord> <mtCallRecord> <recordType>1</recordType> <servedIMSI>36570000635618F8</servedIMSI> <servedIMEI>53464010474309F0</servedIMEI> <servedMSISDN>915212755697F8</servedMSISDN> <callingNumber>A151911700</callingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2D</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <supplServicesUsed> <SuppServiceUsedid> <ssCode>11</ssCode> <ssTime>0912021535382B0300</ssTime> </SuppServiceUsedid> </supplServicesUsed> <msClassmark>331981</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED502</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <calledParty/> </chargedParty> <roamingNumber>A111113850</roamingNumber> <mscIncomingCircuit>9119</mscIncomingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C2D</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </mtCallRecord> <incGatewayRecord> <recordType>3</recordType> <callingNumber>A17005991565</callingNumber> <calledNumber>A1853643F7</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZTEBSC3</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535302B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>12</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2203AFBF84</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <roamingNumber>A111111980</roamingNumber> <mscIncomingCircuit>934</mscIncomingCircuit> <orgMSCId>921A</orgMSCId> <mscIncomingRouteAttribute> <isup/> </mscIncomingRouteAttribute> <networkCallReference>22432B5132</networkCallReference> </incGatewayRecord> <outGatewayRecord> <recordType>4</recordType> <callingNumber>A151012431</callingNumber> <calledNumber>817026936873</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535192B0300</answerTime> <releaseTime>0912021535432B0300</releaseTime> <callDuration>24</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2303B19880</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <mscOutgoingCircuit>398</mscOutgoingCircuit> <orgMSCId>921A</orgMSCId> <mscOutgoingRouteAttribute> <isup/> </mscOutgoingRouteAttribute> <networkCallReference>238BE55132</networkCallReference> </outGatewayRecord> </callEventRecords> <trailerRecord> <productionDateTime>0912021247512B0300</productionDateTime> <recordingEntity>00</recordingEntity> <firstCallDateTime>000000000000000000</firstCallDateTime> <lastCallDateTime>000000000000000000</lastCallDateTime> <noOfRecords>521</noOfRecords> <extensions/> </trailerRecord> <extensions/> </CallEventDataFile> Schema File generated by Dataset: <?xml version="1.0" standalone="yes"?> <xs:schema id="NewDataSet" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="location"> <xs:complexType> <xs:sequence> <xs:element name="locationAreaCode" type="xs:string" minOccurs="0" /> <xs:element name="cellIdentifier" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="systemType"> <xs:complexType> <xs:sequence> <xs:element name="gERAN" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="basicService"> <xs:complexType> <xs:sequence> <xs:element name="teleservice" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="additionalChgInfo"> <xs:complexType> <xs:sequence> <xs:element name="chargeIndicator" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="chargedParty"> <xs:complexType> <xs:sequence> <xs:element name="calledParty" type="xs:string" minOccurs="0" /> <xs:element name="callingParty" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscIncomingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscOutgoingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanRequested"> <xs:complexType> <xs:sequence> <xs:element name="dualFullRatePreferred" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanUsed"> <xs:complexType> <xs:sequence> <xs:element name="halfRate" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="diagnostics"> <xs:complexType> <xs:sequence> <xs:element name="gsm0408Cause" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="CallEventDataFile"> <xs:complexType> <xs:sequence> <xs:element name="extensions" type="xs:string" minOccurs="0" /> <xs:element name="headerRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="productionDateTime" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="extensions" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="callEventRecords" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="mtSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="deliveryTime" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="origination" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="messageReference" type="xs:string" minOccurs="0" /> <xs:element name="originationTime" type="xs:string" minOccurs="0" /> <xs:element name="destinationNumber" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssActionRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="supplService" type="xs:string" minOccurs="0" /> <xs:element name="ssActionTime" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="ussdCodingScheme" type="xs:string" minOccurs="0" /> <xs:element name="ussdRequestCounter" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ssAction" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ussdInvocation" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssParameters" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="unstructuredData" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ussdString" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="UssdString" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="calledNumber" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="gsm-SCFAddress" type="xs:string" minOccurs="0" /> <xs:element name="serviceKey" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="numberOfDPEncountered" type="xs:string" minOccurs="0" /> <xs:element name="levelOfCAMELService" type="xs:string" minOccurs="0" /> <xs:element name="freeFormatData" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="mscOutgoingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="calledIMSI" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanRequested" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanUsed" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="diagnostics" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mtCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="mscIncomingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="supplServicesUsed" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="SuppServiceUsedid" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ssCode" type="xs:string" minOccurs="0" /> <xs:element name="ssTime" type="xs:string" minOccurs="0" /> </xs:sequence>

    Read the article

  • Objective-C memory leak in loading remote content

    - by Ican Zilb
    I try to load a plist file from my server. I can think of 2 ways to do that, but for both Instruments says there's huge memory leak : NSData* plistData = [NSData dataWithContentsOfURL:url]; and NSDictionary* updateDigest = [NSDictionary dictionaryWithContentsOfURL: [NSURL URLWithString:updateURL] ]; The backtrace of the memory leak leads to __CFURLCache in CFNetwork and I am wondering if something can be done to fix the leak? Any other way to load a remote plist xml, without the memory leakage ? Thanks

    Read the article

  • SSRS: Report loading external images, image not found, can I hide the image control

    - by Nauman
    My SSRS report loads logo images for each customer from a customer number specific folder on the report server. I write an expression, to form my URL to the image based on th customer number. ..."http://localhost/images/" + iCustomerNumber.ToString() + "/logo.gif" I am able to get this working, but the problem I face is, when a particular customer doesn't has an image, then my report shows a red X mark in place of the logo. In this case, I expect to hide the image control itself. Any thoughts???? The other dirty solution will be to ensure that each customer specific folder has the designated image! even if there is no logo for a customer, I'll place a blank.gif or a spacer.gif of probably a square pixel in dimension!.

    Read the article

  • Menu item for each module, with module content loading dynamically with Prism or MEF

    - by user573145
    I am developing an application currently using Prism and MEF. I would ideally like to generate a toolbar or menu with an item for each module, and when an item is clicked, only the views declared within that module load into a tab control. For example: Menu Region: ModuleA(Selected) | ModuleB Tab Region: ModuleAViewA | ModuleAViewB | ModuleAViewC Changes to Menu Region: Employees | Inventory(selected) Tab Region: Items | In Fi

    Read the article

  • Pushing to bare Git repository (remote) causes it to stop being bare

    - by NSD
    I have a local repository called TestRepo. I clone it with the --bare option, zip this clone up, and throw it on my server. Unzip it, and it's still bare. I then clone the bare remote repository locally over ssh with something like git clone ssh://[email protected]/~/TestRepo.git TestRepoCloned The local TestRepoCloned is not bare and has a remote called "origin." It appears to be tracking correctly from the looks of its config file [core] repositoryformatversion = 0 filemode = true bare = false logallrefupdates = true ignorecase = true [remote "origin"] fetch = +refs/heads/*:refs/remotes/origin/* url = ssh://[email protected]/~/TestRepo.git [branch "master"] remote = origin merge = refs/heads/master I edit an existing file. I commit the change to the current branch (master) via git commit -a -m "Edited a file." The commit succeeds and all is well. I decide to push this change to the remote repository via SSH with a git push The remote repository is now no longer bare, but has a complete working directory, and I get continuous error messages on all further attempts to push to it. Everything I've read seems to suggest that what I'm doing is correct, but it simply is not working. How am I supposed to push changes to a bare remote repo and actually keep it bare?

    Read the article

  • WPF Dragging causes renderer to stop

    - by Cameron MacFarland
    I'm having a problem with my WPF app, where any sort of drag operation stops the UI from updating. The issue seems periodic, as in, the item drags, stops, drags again, stops, etc. in 2 second intervals. It's affecting all controls, including scroll bars. If checked this question as well as this one, and it doesn't seem to be caused by window transparencies. I'm running Win7 x64 with .NET 3.5sp1. Does anyone know what might be causing this, or a way of figuring out what might be causing this?

    Read the article

  • loading data from file into 2d array

    - by Chris
    I am just starting with perl and would like some help with arrays please. I am reading lines from a data file and splitting the line into fields: open (INFILE, $infile); do { my $linedata = <INFILE>; my @data= split ',',$linedata; .... } until eof; I then want to store the individual field values (in @data) in and array so that the array looks like the input data file ie, the first "row" of the array contains the first line of data from INFILE etc. Each line of data from the infile contains 4 values, x,y,z and w and once the data are all in the array, I have to pass the array into another program which reads the x,y,z,w and displays the w value on a screen at the point determined by the x,y,z value. I can not pas the data to the other program on a row-by-row basis as the program expects the data to in a 2d matrtix format. Any help greatly appreciated. Chris

    Read the article

  • JMS have javax.jms.InvalidDestinationException when client stop working

    - by Tran
    I use JMS for sending requests from a client to a server. My client sends a request to the server. While the server is working with my request, my client stops (network problem) before the server finishes. When the server is finished, it'll return to the client, but the server can't see the client which sent the request to server, at which point, the server will return an exception in log file. The exception is : javax.jms.InvalidDestinationException: Cannot publish to a deleted Destination: temp-queue://ID:PC0092-49463-1344231871819-0:0:9 [^] My question is: what do I need to do in this case? Can I catch or disable this exception? And how can I do it? (Sorry, If my english is not good.)

    Read the article

  • How to stop Lean programming becoming Cowboy Coding?

    - by Matt Howells
    My team has been progressively adopting more and more lightweight methodologies, moving from Scrum to Lean/Kanban where there is less and less formal process. At some point we will be back to Cowboy Coding; indeed I fear we may already be on the border line. Where can the line be drawn between a very lightweight Lean and Agile process and anarchy? How will we know when we have crossed the line? And how can we prevent ourselves from crossing the line? The question might also be phrased as, 'what processes cannot be safely eliminated in Lean's drive to eliminate waste'?

    Read the article

  • Django template not loading properly

    - by fmsf
    Hey, When this one runs everything goes fine: (r"^newobject$", "views.myobjects.newobject"), All the CSS + JS files are properly fetched from: static/css/... static/js/... When this one runs: (r"^mybjects/(([a-z]|[A-Z]|[0-9])+)$","views.myobjects.loadobject"), All the css and JS files that are being fetched, are run trough the urlpatterns and are returning my defailt page: (r"", 'views.main.index'), This makes all my CSS and JS code to actualy be HTML. My guess is that i'm giving some noob mistake. Is there any common reason why this should happen? And how to fix it?

    Read the article

  • Apache not loading Xdebug, but does when started from the Command Line

    - by JamesD
    I know that this sounds odd, but believe me, it's what is happening. Here are my system settings: Windows7 Apache 2.2 PHP 5.2.12 Xdebug 2.0.5 I have XDebug configured in my PHP.ini file. When I run php -m, I do in fact see that Xdebug is loaded. Now, if I start Apache AS A SERVICE (or by the Apache Monitor), and run phpinfo(), it is NOT showing Xdebug as being loaded. However, (now here's the crazy part), if I go to my Apache bin directory, and simply run httpd.exe, and then go and look at phpinfo(), Xdebug now shows as being loaded! Also, comparing some phpinfo() when started via service or by command line, it looks like the php.ini file is the same for either case. Everything looks the same except for the Xdebug being loaded part. Please, if you have any ideas it would be greatly appreciated.

    Read the article

  • Java WebApp: Loading resource from .jar located in WEB-INF

    - by shaman.sir
    There are a lot of similar questions, but, probably, mine is a little bit different: What is the right way to load resource from inside of .jar file located in WEB-INF/lib folder (if I know the jar file name and the name of the class it resource belongs to), while Web Application is running? Should I use getServletContext().getResourceAsStream(?) for this purpose or the <name-of-known-class>.getResourseAsStream(?), and what path do I need to specify there? So, the structure is: /WEB-INF /classes /some/package/name ?.class #some Java code or Servlet that tries to read 'required-file.xml' /lib /<jar-with-known-name>.jar /another/package/with/known/name SomeKnownClass.class required-file.xml

    Read the article

  • Loading Accessory callout view for mkannotationview

    - by Zap
    I have a map annotation view that contains a rightcallout button which loads an accessory view which is a UIViewController class. I am using resuable annotations, but am wondering how I can pass updated information to my UIViewController class. Let's say I have 2 string values which map to 2 UILabels on my view. How can I update those values after the initial accessory view has already been loaded into memory as a resusable view? Any help would be appreciated.

    Read the article

  • Error loading my managedObjectModel

    - by niklassaers
    Hi guys, When I call [myAppDelegate managedObjectModel], in the retain line below, my application will crash (iPhone SDK v3.1.3): - (NSManagedObjectModel *)managedObjectModel { if (managedObjectModel != nil) { return managedObjectModel; } managedObjectModel = [[NSManagedObjectModel mergedModelFromBundles:nil] retain]; return managedObjectModel; } Here is my crash trace #0 0x905c44e6 in objc_exception_throw #1 0x01e78c3b in +[NSException raise:format:arguments:] #2 0x01e78b9a in +[NSException raise:format:] #3 0x000af99b in _NSArrayRaiseInsertNilException #4 0x0001c360 in -[NSCFArray insertObject:atIndex:] #5 0x0001c274 in -[NSCFArray addObject:] #6 0x01c16a7e in +[NSManagedObjectModel mergedModelFromBundles:] #7 0x00002432 in -[myAppDelegate managedObjectModel] at myAppDelegate.m:102 What is going on here? This is template code that I haven't seen fail before. Cheers Nik

    Read the article

  • loading child swf as3

    - by RichW
    Hi, I've been given an fla to make some changes too. Basically its a fairly long timeline animation with sound. So far I've successfully added a few button functions for sound etc.. but one has got me stumped. One of the buttons needs to load a child swf. I'm using the code below but I'm recieving an error - 'Error #1009: Cannot access a property or method of a null object reference'. I believe this may be refferring to an object that isn't set yet but I have no idea which one it is: Code: var mcExt:MovieClip = new MovieClip(); var ldr:Loader = new Loader(); ldr.contentLoaderInfo.addEventListener(Event.COMPLETE, swfLoaded); ldr.load(new URLRequest("Downloads.swf")); function swfLoaded(e:Event):void { mcExt = MovieClip(ldr.contentLoaderInfo.content); ldr.contentLoaderInfo.removeEventListener(Event.COMPLETE, swfLoaded); mcExt.x = 50; mcExt.y = 50; addChild(mcExt); } Any help on what is going wrong would be greatly appreciated! Thanks

    Read the article

  • Program execution stop at scanf???

    - by Mohit Deshpande
    main.c (with all the headers like stdio, stdlib, etc): int main() { int input; while(1) { printf("\n"); printf("\n1. Add new node"); printf("\n2. Delete existing node"); printf("\n3. Print all data"); printf("\n4. Exit"); printf("Enter your option -> "); scanf("%d", &input); string key = ""; string tempKey = ""; string tempValue = ""; Node newNode; Node temp; switch (input) { case 1: printf("\nEnter a key: "); scanf("%s", tempKey); printf("\nEnter a value: "); scanf("%s", tempValue); //execution ternimates here newNode.key = tempKey; newNode.value = tempValue; AddNode(newNode); break; case 2: printf("\nEnter the key of the node: "); scanf("%s", key); temp = GetNode(key); DeleteNode(temp); break; case 3: printf("\n"); PrintAllNodes(); break; case 4: exit(0); break; default: printf("\nWrong option chosen!\n"); break; } } return 0; } storage.h: #ifndef DATABASEIO_H_ #define DATABASEIO_H_ //typedefs typedef char *string; /* * main struct with key, value, * and pointer to next struct * Also typedefs Node and NodePtr */ typedef struct Node { string key; string value; struct Node *next; } Node, *NodePtr; //Function Prototypes void AddNode(Node node); void DeleteNode(Node node); Node GetNode(string key); void PrintAllNodes(); #endif /* DATABASEIO_H_ */ I am using Eclipse CDT, and when I enter 1, then I enter a key. Then the console says . I used gdb and got this error: Program received signal SIGSEGV, Segmentation fault. 0x00177024 in _IO_vfscanf () from /lib/tls/i686/cmov/libc.so.6 Any ideas why?

    Read the article

  • loading multiple line query in one row

    - by bharath
    Hi, How to load a multiple line query in one row using mysql.The data is stored in a text file. For example: "GGAGTTGTGGGAGTGGAGGAGGAAGAGGCGGTGGGGAGTACGGGGGCTGGTCCCAGAAGATGGCGGAGGC GGGGGATTTCTGGTAGGTCCTACTTTAGGACAAGATGTGGTGGTACTGTTGAAGCGTCAGTCTTTGATTC" Thanks in advance.

    Read the article

  • MediaElement.js setSrc() Loading The File But Not Changing pluginType

    - by doubleJ
    I'm working on a page that uses mediaelement.js to play mp3/mp4/wmv (yes, we have a lot of wmv). I have a list of links and those links should change the player. My effort is to make the changes to the player through javascript so that the page doesn't refresh. This code is working, but it refreshes every time. See a live demo of the non-ajax version. <?php $file = null; $file = $_GET["file"]; $format = null; if (preg_match("/mp4/i", $file)) $format = "mp4"; if (preg_match("/webm/i", $file)) $format = "webm"; if (preg_match("/wmv/i", $file)) $format = "wmv"; if (preg_match("/mp3/i", $file)) $format = "mp3"; if (preg_match("/ogg/i", $file)) $format = "ogg"; $mime = null; if ($format == "mp4") $mime = "video/mp4"; if ($format == "webm") $mime = "video/webm"; if ($format == "wmv") $mime = "video/wmv"; if ($format == "mp3") $mime = "audio/mp3"; if ($format == "ogg") $mime = "audio/ogg"; $element = "video"; if ($format == "mp3" || $format == "ogg") $element = "audio"; // you have to escape (\) the escape (\) character (hehehe...) $poster = "media\\120701Video.jpg"; $height = "360"; if ($format == "mp3") $height = "30"; ?> <!doctype html> <html> <head> <meta charset="utf-8"> <title>Embed</title> <link rel="stylesheet" href="include/johndyer-mediaelement-b090320/build/mediaelementplayer.min.css"> <style> audio {width:640px; height:30px;} video {width:640px; height:360px;} </style> <script src="include/johndyer-mediaelement-b090320/build/jquery.js"></script> <script src="include/johndyer-mediaelement-b090320/build/mediaelement-and-player.js"></script> </head> <body> <ul> <li><a href="embed.php">Reset</a></li> <li><a href="?file=media/120701Video-AnyVideoConverter.mp4">Alternative (mp4)</a></li> <li><a href="?file=media/120701Video-Ffmpeg-Defaults.webm">Alternative (webm)</a></li> <li><a href="?file=media/AreYouHurting-Death.wmv">Alternative (wmv)</a><li> <li><a href="?file=media/AreYouHurting-Death.mp3">Alternative (mp3)</a></li> </ul> <?php if ($file) { ?> <video src="<?php echo $file; ?>" controls poster="<?php echo $poster; ?>" width="640" height="360"></video> <div id="type"></div> <script> var video = document.getElementsByTagName("video")[0]; var player = new MediaElementPlayer(video, { success: function(player) { $('#type').html(player.pluginType); } }); <?php } ?> </script> </body> </html> This code requires <video> to be loaded, initially and with a file, so that the player mode (pluginType) is set. It will, then, only play formats that the pre-established mode supports (firefox in native mode won't play mp4). See a live demo of the ajax version. <!doctype html> <html> <head> <meta charset="utf-8"> <title>Embed</title> <link rel="stylesheet" href="http://www.mediaelementjs.com/js/mejs-2.9.2/mediaelementplayer.min.css"> <script src="//ajax.googleapis.com/ajax/libs/jquery/1.7.2/jquery.min.js"></script> <script src="http://www.mediaelementjs.com/js/mejs-2.9.2/mediaelement-and-player.js"></script> </head> <body> <ul> <li><a href="javascript:player.pause(); player.setSrc('media/120701Video-AnyVideoConverter.mp4'); player.load(); player.play();">Alternative (mp4)</a></li> <li><a href="javascript:player.pause(); player.setSrc('media/120701Video-Ffmpeg-Defaults.webm'); player.load(); player.play();">Alternative (webm)</a></li> <li><a href="javascript:player.pause(); player.setSrc('media/AreYouHurting-Death.wmv'); player.load(); player.play();">Alternative (wmv)</a></li> <li><a href="javascript:player.pause(); player.setSrc('media/AreYouHurting-Death.mp3'); player.load(); player.play();">Alternative (mp3)</a></li> </ul> <video controls src="media/WordProductionCenter.mp4"></video> <div id="type"></div> <script> var video = document.getElementsByTagName("video")[0]; var player = new MediaElementPlayer(video, { success: function(player) { $('#type').html(player.pluginType); } }); </script> </body> </html> It seems like I need something like setType(), but I see no such option. I've read a couple pages that referenced refreshing the DOM after the javascript runs, but I haven't been able to successfully do it (I know enough about javascript to hack things around and get stuff working, but not enough to create whole new things). It is worth noting that Silverlight doesn't work with Internet Explorer 8 or Safari (not sure if it's my code, mejs, or the browsers). Also, neither Silverlight nor Flash play mp3 or webm (again, not sure where the problem lies). Is there a way to dynamically load different types of files into mediaelement?

    Read the article

  • Trouble with loading jquery onload.

    - by Darcy
    Hi guys, I'm trying to build some jquery tabs based on the request (which is stored in a table). I have two pages sharing one .js file. One page is for the user to create the request, and the other is for the administrator to approve/deny the request. On the admin page, here is my javascript code: $(function() { GetRequest(); }); Which is just calling a function I have inside my .js file. All the code in the .js file is also wrapped in a '$(function(){ //...code here })'. The problem is the function isn't built yet when calling it from the page. Is there a way I can tell the page to wait until the script is complete?

    Read the article

  • How to send web browser a loading page, then some time later a results page

    - by Kurt W. Leucht
    I've wasted at least a half day of my company's time searching the Internet for an answer and I'm getting wrapped around the axle here. I can't figure out the difference between all the different technology choices (long polling, ajax streaming, comet, XMPP, etc.) and I can't get a simple hello world example working on my PC. I am running Apache 2.2 and ActivePerl 5.10.0. JavaScript is completely acceptable for this solution. All I want to do is write a simple Perl CGI script that when accessed, it immediately returns some HTML that tells the user to wait or maybe sends an animated GIF. Then without any user intervention (no mouse clicks or anything) I want the CGI script to at some time later replace the wait message or the animated GIF with the actual results from their query. I know this is simple stuff and websites do it all the time using JavaScript, but I can't find a single working example that I can cut and paste onto my machine that will work in Perl. Here is my simple Hello World example that I've compiled from various Internet sources, but it doesn't seem to work. When I refresh this Perl CGI script in my web browser it prints nothing for 5 seconds, then it prints the PLEASE BE PATIENT web page, but not the results web page. So the Ajax XMLHttpRequest stuff obviously isn't working right. What am I doing wrong? #!C:\Perl\bin\perl.exe use CGI; use CGI::Carp qw/fatalsToBrowser warningsToBrowser/; sub Create_HTML { my $html = <<EOHTML; <html> <head> <meta http-equiv="pragma" content="no-cache" /> <meta http-equiv="expires" content="-1" /> <script type="text/javascript" > var xmlhttp=false; /*@cc_on @*/ /*@if (@_jscript_version >= 5) // JScript gives us Conditional compilation, we can cope with old IE versions. // and security blocked creation of the objects. try { xmlhttp = new ActiveXObject("Msxml2.XMLHTTP"); } catch (e) { try { xmlhttp = new ActiveXObject("Microsoft.XMLHTTP"); } catch (E) { xmlhttp = false; } } @end @*/ if (!xmlhttp && typeof XMLHttpRequest!='undefined') { try { xmlhttp = new XMLHttpRequest(); } catch (e) { xmlhttp=false; } } if (!xmlhttp && window.createRequest) { try { xmlhttp = window.createRequest(); } catch (e) { xmlhttp=false; } } </script> <title>Ajax Streaming Connection Demo</title> </head> <body> Some header text. <p> <div id="response">PLEASE BE PATIENT</div> <p> Some footer text. </body> </html> EOHTML return $html; } my $cgi = new CGI; print $cgi->header; print Create_HTML(); sleep(5); print "<script type=\"text/javascript\">\n"; print "\$('response').innerHTML = 'Here are your results!';\n"; print "</script>\n";

    Read the article

  • htaccess rewrite rule not loading site content

    - by peter
    I am struggling with .htaccess rewrite rules. Let's say I have this URL. localhost/site/index.php and I want to rewrite it as this URL localhost/site/tutorial I would use this RewriteRule Options +FollowSymLinks RewriteEngine on RewriteRule ^tutorial/(.*)$ /up/index.php The page works, but the CSS files don't load. Also, if I have a URL like this: index.php?page=home Then I would have to parse through that URL to get 'home' not using $_GET anymore correct??

    Read the article

  • Dynamic adding of usercontrols not showing control on page

    - by Phil
    I am trying to insert a user control dynamically into my default.aspx page via the following method in the page_init: Dim control As UserControl = LoadControl("~\Modules\Content.ascx") Controls.Add(control) When I run the page there is no sign of the usercontrol. Am I using the correct code to insert the usercontrol? Is there an alternative method of insertion available? Does the fact that the usercontrol has a page_load make a difference? Do I need to register the control in my aspx page at design time? Thanks in advance for any assistance you can offer.

    Read the article

  • Ajax Content Loading(Processing) image or indicator

    - by Arny
    Hi there, in part of my web page, I have couple of asp:image Thumbnails, onclick I use ajax modal popup extender to show the imgae in full size which are working fine, what I need to add is to have a processing image or indicator both in thumbnail and modal popup extender, I also have ajax autocomplete that is working fine, I need to add some indicator or processing image to it as soon as user start typing a word. any idea? Thanks in advance

    Read the article

< Previous Page | 62 63 64 65 66 67 68 69 70 71 72 73  | Next Page >