Search Results

Search found 68147 results on 2726 pages for 'context sensitive help'.

Page 661/2726 | < Previous Page | 657 658 659 660 661 662 663 664 665 666 667 668  | Next Page >

  • How to use a local Leopard Server Mail server acting "like" an Exchange mail server

    - by Richard Chevre
    We have a local Exchange 2003 server (company .local) who is collecting POP3 mail accounts on a distant (company .com) mailserver. The mails are collected by the Exchange server every 5-10 minutes and stored locally (on company .local), so the users can read them without going on the "real" mail server (company.com) What was explaned to me is that the mail collection is made with POP Now we are migrating on Snow Leopard Server. We have chosen to use a new extension for our local domain: .leo So our mailserver's FQDN is mail.company.leo, and the users have a user [email protected] formated mail address. A) All works fine except that I can't find how to tell the mail.company.leo that he must retreive the mails from the "real" public server (mail.company.com) I'm hoping to use IMAP and not POP. I can send mail using SMTP relay from mail.company.leo but (I know it's trivial) answering is not possible, even if I specify the reply-to as [email protected] (this seems to be related to A) ) I don't know if it's very complicated (I suspect not, but...) to achieve what I want to do, and I'm not a genius. But as I'm a little bit lost, I hopesomebody can or will help me. Solving this will allow us to use iCal invitations too, so a lot of services depends of these mailserver settings Some of you discuss the fact thta we choose to use a "new" tld with the .leo extension. We have no problem for that, we could use .local. no problem ;) We used .leo instead of .local just to differentiate the two systems (Exchange and SnowLeopardServer). The question was not about that, it was just to know if we can set a SnowLeopard mail server to act like an Exchange Server. Again thank you for your advice and help Richard Thanks in advance Richard

    Read the article

  • How can I manually install pecl_http on Ubuntu 9.10?

    - by Richard
    This is essentially a repost of http://stackoverflow.com/questions/4159369/ubuntu-9-04-pecl-extension-downloads-but-does-not-install. Hoping maybe someone can help me here. I've done this: sudo apt-get install php-pear sudo apt-get install php5-dev sudo apt-get install libcurl3-openssl-dev which installs fine. However, the next step: sudo pecl install pecl_http Doesn't install the extension, but merely downloads it. There are no error messages. So I have unpacked it and built it myself per http://php.net/manual/en/install.pecl.phpize.php Essentially: cd pecl_http phpize ./configure make make install I also make test'd to check all ok - and it failed one test: HttpRequest, which is kind of fundamental to this package. And indeed this doesn't work: $r = new HttpRequest('http://www.google.com'); $r->send; echo $r->getResponseCode(); No request is sent, the response code is zero, but no errors either. How can I get this damn thing installed? Is this a bug? Am I doing something wrong? Any alternatives, workarounds? Help appreciated. Thanks

    Read the article

  • Htpc aka "Media Center": cheap and *silent*?

    - by Unknown
    It may be me, or the place I live (Italy), but it seems pretty hard to get a build or a prebuilt nettop or a laptop that fits the need. I need something silent able to playback all h.264 fullhd content without stuttering, and well (and not loosing the hw acceleration because of softsubs...) silent not ugly silent and (possibly) cheap. I'm going the linux route, therefore i'm moving towards a cpu-based or nvida-integrated solution (i don't think ati hw accelerated playback - or the intel "hd" acceleration - is useable yet). Ion nettop; it's either the Acer Revo (but here it's incredibly pricey and it's hard to find the dualcore version) or the Asrock Ion 330, that in the current version is rated "silent" at 26Db. 26. Sounds pretty noisy to me!!! the previous version was even worse. was this product really aimed at htpc market?? the Dell Zino - i think it's ATI based unfortunately. Laptop: correct me if I'm wrong: sub 600€/$ units are quite loud under full load (because of the tiny fans). ULW laptops are indeed quite similar: tiniest fans = high pitched noise and the cpu still lacks power for non hd-accelerated video decoding Handmade build: little money can be saved with underpowered cpus, a low-midrange cpu would help in the case of non-hw-accelerated content the cases are quite pricey the PSU one has to get ranges between 100/150 €/$ minimum to keep the noise down a low-mid build, all included, sums up to over 650 €/$ for a still-looking-ugly-unit, without the blu-ray drive. Please help. What do you advise on this? ;) Am I ignoring laptops too much, maybe? Are low-priced Acers that noisy/high pitched under full load?

    Read the article

  • JAVASCRIPT ENABLED

    - by kirchoffs415
    HI, I hope somebody can help, i keep getting the following message when i log on-- Your Javascript is disabled. Limited functionality is available. it will stay for maybe a day sometimes two.I have uninstalled javascript and reinstalled but still the same. Iam using chrome. any help would be gratefull many thanks Dominic p.s. my system spec is as follows System InformationOS Name Microsoft® Windows Vista™ Home Premium Version 6.0.6002 Service Pack 2 Build 6002 Other OS Description Not Available OS Manufacturer Microsoft Corporation System Name DOM-PC System Manufacturer Dell Inc. System Model Inspiron 1545 System Type X86-based PC Processor Pentium(R) Dual-Core CPU T4200 @ 2.00GHz, 2000 Mhz, 2 Core(s), 2 Logical Processor(s) BIOS Version/Date Dell Inc. A05, 25/02/2009 SMBIOS Version 2.4 Windows Directory C:\Windows System Directory C:\Windows\system32 Boot Device \Device\HarddiskVolume3 Locale United Kingdom Hardware Abstraction Layer Version = "6.0.6002.18005" User Name DOM-PC\DOM Time Zone GMT Standard Time Installed Physical Memory (RAM) 3.00 GB Total Physical Memory 2.96 GB Available Physical Memory 1.38 GB Total Virtual Memory 5.89 GB Available Virtual Memory 4.25 GB Page File Space 3.00 GB Page File C:\pagefile.sys My System Specs

    Read the article

  • Problems sending email using .Net's SmtpClient

    - by Jason Haley
    I've been looking through questions on Stackoverflow and Serverfault but haven't found the same problem mentioned - though that may be because I just don't know enough about how email works to understand that some of the questions are really the same as mine ... here's my situation: I have a web application that uses .Net's SmtpClient to send email. The configuration of the SmtpClient uses a smtp server, username and password. The SmtpClient code executes on a server that has an ip address not in the domain the smtp server is in. In most cases the emails go without a problem - but not AOL (and maybe others - but that is one we know for sure right now). When I look at the headers in the message that was kicked back from AOL it has one less line than the successful messages hotmail gets: AOL Bad Message: Received: from WEBSVRNAME ([##.###.###.###]) by domainofsmtp.com with MailEnable ESMTP; Mon, 18 Jun 2012 09:48:24 -0500 MIME-Version: 1.0 From: "[email protected]" <[email protected]> ... Good Hotmail Message: Received: from mail.domainofsmtp.com ([###.###.###.###]) by subdomainsof.hotmail.com with Microsoft SMTPSVC(6.0.3790.4900); Thu, 21 Jun 2012 09:29:13 -0700 Received: from WEBSVRNAME ([##.###.###.###]) by domainofsmtp.com with MailEnable ESMTP; Thu, 21 Jun 2012 11:29:03 -0500 MIME-Version: 1.0 From: "[email protected]" <[email protected]> ... Notice the hotmail message headers has an additional line. I'm confused as to why the Web server's name and ip address are even in the headers since I thought I was using the SmtpClient to go through the smtp server (hence the need for the username and password of a valid email box). I've read about SPFs, DKIM and SenderID's but at this point I'm not sure if I would need to do something with the web server (and its ip/domain) or the domain the smtp is coming from. Has anyone had to do anything similiar before? Am I using the smtp server as a relay? Any help on how to describe what I'm doing would also help.

    Read the article

  • What causes "A disk read error occurred, Press Ctrl + Alt + Del to restart"?

    - by Mehrdad
    I have a virtual machine containing Windows XP SP3. When I resized the VHD file (and the embedded partition), and tried booting, I got: A disk read error occurred Press Ctrl + Alt + Del to restart Some notes: FixBoot and FixMBR don't help. ChkDsk doesn't help. The partition is indeed active. The partition starts at sector 63 (it also did so before the problem) of cylinder 1, head 1, and is marked as type 0x07 (NTFS) My host OS reads the VHD and the partition completely fine I'm interested in knowing the cause rather than the fix. So "re-format the disk", "reinstall Windows", etc. aren't valid solutions. It's a virtual machine after all... I have nothing to lose, so I don't care about fixing it. I just want to know what's causing this problem, in case I run into it again on a physical machine (which I have done before). More info: The layout of the original, dynamic VHD (which works correctly): +-----------------------------------------------------------------------------+ ¦ Disk: 3 MBR/GPT: MBR ¦ ¦ Size: 127.00GB CHS: 16578 255 63 ¦ ¦ Sectors: 266338304 Disk Signature: 0xEE3EEE3E ¦ ¦ Partitions: 1 Partition Order: 1 ¦ ¦ Media Type: Fixed Interface: SCSI ¦ ¦ Description: Msft Virtual Disk ¦ +-----------------------------------------------------------------------------¦ ¦Pos Idx Type/Name Size Boot Hide Start Sector Total Sectors DL Vol Label ¦ +--- --- --------- ---- ---- ---- -------------- -------------- -- -----------¦ ¦ 1 1 07-NTFS 1.5G Yes No 63 3,148,677 F: <None> ¦ +-----------------------------------------------------------------------------+ The layout of the resized, fixed-size VHD (which doesn't work): +-----------------------------------------------------------------------------+ ¦ Disk: 3 MBR/GPT: MBR ¦ ¦ Size: 1.50GB CHS: 196 255 63 ¦ ¦ Sectors: 3149824 Disk Signature: 0xEE3EEE3E ¦ ¦ Partitions: 1 Partition Order: 1 ¦ ¦ Media Type: Fixed Interface: SCSI ¦ ¦ Description: Msft Virtual Disk ¦ +-----------------------------------------------------------------------------¦ ¦Pos Idx Type/Name Size Boot Hide Start Sector Total Sectors DL Vol Label ¦ +--- --- --------- ---- ---- ---- -------------- -------------- -- -----------¦ ¦ 1 1 07-NTFS 1.5G Yes No 63 3,148,677 F: <None> ¦ +-----------------------------------------------------------------------------+

    Read the article

  • problem booting crusty old windows XP

    - by Carson Myers
    I have an acer aspire laptop running Windows XP home. I believe I have some virus on it, I'm not sure--I mostly just run linux in a VM on it so I wasn't too worried. I'm not sure if that virus caused this problem. The laptop wasn't recognizing my USB hard drive for some reason so I decided to restart it. When it started up, it got past the memory test, past the boot screen, (but it paused right here on a blank screen for awhile) and flashed the desktop once (like it does just before the login screen) and then crashed. I got a quick BSOD and then it restarted. Then it tried to boot again, etc etc infinite loop of failure. Well, before trying safe mode, I disabled automatic restart on system crash so I could read the blue screen. There wasn't anything important on it, it said *** STOP: 0x00000000 (0xC0000000 0x,.... ) beginning physical memory dump physical memory dump complete That's not verbatim (obviously) but it didn't help me. so I booted in safe mode, and it stopped on the driver gagp30kx.sys and then restarted (and infinite loop of failure again). I burned a recovery CD and tried that. It loaded it, and I went into repair mode. I ran chkdsk and then disabled the AGP driver. Same thing on booting in safe mode except it stopped at mup.sys instead. I enabled the AGP driver again, and ran chkdsk again from the CD. It said it found problems but didn't say it fixed them. So I ran it a second time, and it said "performing additional checking or recovery" lots of times (I can't tell how many, they went above the screen top). I tried booting again and no luck. Every time I run chkdsk after trying to boot again it says it found and fixed more errors. I think it might be whatever driver is after the AGP driver, but I don't know what it is or how to find out. Can anyone help me fix this?

    Read the article

  • Slow upload speeds with pfsense virtual appliance

    - by Justin Shin
    I have a pfSense virtual appliance set up in front of a Windows server. The pfSense appliance has been configured with two L2L IPSec VPN sites and not too much else. The appliance has two vNics which both exist on the same VLAN, but one is "WAN" and the other is "LAN." When I run speedtest.net on my Windows server when I have configured it to use a static WAN address and gateway, I get great speeds - maybe around 50 down, 15 up. However, when I configure it with a private IP address, I get similar download speeds but terrible upload speeds - around 2 or 3 Mbps consistently. I used Wireshark to see what gives but there didn't appear to be too much helpful information there, or I just could not find it. Besides the L2L VPNs, other configurations include: Automatic Outbound NAT Virtual P-ARP IP for the Windows Server WAN Firewall rule to allow * to * on RDP WAN Firewall rule to allow * to * (enabled this just for testing... didn't help!) No DHCP or any other services besides IPSec VPN No Errors LAN or WAN No collisions LAN or WAN I would be happy to post the full config file if it would help. I've been scratching my head at this one all day!

    Read the article

  • Windows Vista will not boot; the file header checksum does not match the computed checksum

    - by Magnus
    Right out of the blue, my wife's Sony Vaio stopped booting. This, not so fun, error message displays immediately after POST: The system cannot boot. The file is possibly corrupt. The file header checksum does not match the computed checksum The repair option on the Vista DVD says everything is fine and dandy, it couldn't be more happier or more clueless... Any ideas? Update: CHKDSK reports no issues. CHKDSK /r reports no issues. (Heck, both Windows Repair and CHKDSK could just as well tell me that I have won on lottery or that the earth is flat... ) Some have reported that a mem diagnostic could help, but for me the mem diag has just ran through 5 passes. It doesn't seem to help. According to Sony, pressing F10 should bring up the restore menu, but it doesn't, the error pops up straight after Bios POST. It seems that this error is first in line of all options at this point, and is doesn't put a smile on my face. I have attached an external USB drive and copied all user data/documents to it. I feel an OS re-install is around the corner.

    Read the article

  • How can I cache a Subversion password on a server, without storing it in unencrypted form?

    - by Zilk
    My Subversion server only provides access via HTTPS; support for svn+ssh has been dropped because we wanted to avoid creating system users on that machine just for SVN access. Now I'm trying to provide a way for users to cache their passwords for a while, without leaving them stored on the filesystem in unencrypted form. This is no problem for Gnome or KDE users, because they can use gnome-keyring and kwallet, respectively. IIRC, TortoiseSVN has a similar caching mechanism, too. But what about users on a non-GUI system? Some context: in this case, we have a development/testing server where one project has been checked out into the Apache htdocs directory. Development for this project is almost complete, and only minor text/layout changes are performed directly on this server. Nevertheless, the changes should be checked into the repository. There's no kwallet and no gnome-keyring on this system, and the ssh-agent can't help because the repository is accessed via https instead of svn+ssh. As far as I know, that leaves them the choice of entering the password every time they talk to the SVN server, or storing it in an insecure way. Is there any way to get something like what gnome-keyring and kwallet provide in a non-GUI environment?

    Read the article

  • Powershell: Execute exe on remote server and capture output

    - by user364825
    I am trying to script the execution of an installer on remote web servers. The installer in question is also a Windows Service that hosts NServiceBus. If RDP'd into the server, the application is installed by the following command: &"$theInstaller" /install /serviceName:TheServiceName The installer prints output about its progress registering the service and connecting to the database to stdout, among other things. This works fine from an RDP session, but when I execute it remotely via PS, I get a you-can't-do-this-over-the-network message if I execute it directly or via Invoke-Command -computername $theRemoteServer: System.IO.FileLoadException: Could not load file or assembly 'file://\\theRemoteServer\c$ \thePath\AutoMapper.dll' or one of its dependencies. Operation is not supported. (Exception from HRESULT: 0x80131515) --- System.NotSupportedException: An attempt was made to load an assembly from a network location which would have caused the assembly to be sandboxed in previous versions of the .NET Framework. This release of the .NET Framework does not enable CAS policy by default, so this load may be dangerous. If this load is not intended to sandbox the assembly, please enable the loadFromRemoteSources switch. See http://go.microsoft.com/fwlink/?LinkId=155569 for more information. (Note: I added an additional "\" to the path in the first line in order to get it to show up correctly in the preview on this site.) This, and other DLLs, are loaded by the service, and the service's execution context cannot, apparently, be remotified. I have also tried using Invoke-WmiMethod, which does something, but it's not clear what, and the output from the installer is lost: Invoke-WMIMethod win32_process create '"$theInstaller" /install /serviceName:TheServiceName' -ComputerName $server (with and without cmd.exe /k before the intaller reference): __GENUS : 2 __CLASS : __PARAMETERS __SUPERCLASS : __DYNASTY : __PARAMETERS __RELPATH : __PROPERTY_COUNT : 2 __DERIVATION : {} __SERVER : __NAMESPACE : __PATH : ProcessId : ReturnValue : 9 How does one remotely execute such an EXE and capture the output? Thanks!

    Read the article

  • mysql startup, shtudown and logging on osx

    - by Joelio
    Hi, I am trying to troubleshoot some mysql problems (I have a table I cant seem to delete or drop, it hangs forever) I have 10.5.8 osx, I dont remember how/if I installed mysql, here is what I know: it automatically starts on boot the process looks like this: /usr/local/mysql/libexec/mysqld --basedir=/usr/local/mysql --datadir=/usr/local/mysql/var --pid-file=/usr/local/mysql/var/Joels-New-Pro.local.pid _mysql 96 0.0 0.0 75884 684 ?? Ss Sat06PM 0:00.02 /bin/sh /usr/local/mysql/bin/mysqld_safe when I run: /usr/local/mysql/libexec/mysqld --verbose --help it says: /usr/local/mysql/libexec/mysqld Ver 5.0.45 for apple-darwin9.1.0 on i686 (Source distribution) it seems to use my.cnf from /etc/my.cnf Now here are my questions: I dont see anything in the startupitems that remotely looks like mysql ls /Library/StartupItems/ BRESINKx86Monitoring ChmodBPF HP IO HP Trap Monitor Parallels ParallelsTransporter 1.) So how does it startup automatically? 2.) How do I start & stop this type of installation? Also, looking at the config, the logs have no values: /usr/local/mysql/libexec/mysqld --verbose --help|grep '^log' log (No default value) log-bin (No default value) log-bin-index (No default value) log-bin-trust-function-creators FALSE log-bin-trust-routine-creators FALSE log-error log-isam myisam.log log-queries-not-using-indexes FALSE log-short-format FALSE log-slave-updates FALSE log-slow-admin-statements FALSE log-slow-queries (No default value) log-tc tc.log log-tc-size 24576 log-update (No default value) log-warnings 1 3.) Does that mean there is no logging enabled in mysetup? thanks in advance! Joel

    Read the article

  • Setting up a Pagefile and Partition in Server 2008

    - by Brett Powell
    I am setting up 18 new machines for our company, and I have instructions from my new boss on setting up a Pagefile and Partition. I have looked at their existing machines to base the new setups off of, but there is no consistency between any 2 machines, which has left me extremely frustrated to say the least. My instructions are... 1) Set a static pagefile (use recommended value as max/min), set it on SSD if SSD available. 2) Make 3 partitions: C: is used for OS and install files D: is used for backups on machines with a SSD. On machines without SSD create a D: partition for pagefile (2*installed RAM for partition size) E: must be the partition hosting user files I have never messed with Pagefiles before, and looking at their existing machines is offering no help. My questions are... 1) As the machines I am setting up have no SSD (just 2 SATA drives) does it sound like the Pagefile should be setup on the C: (primary) drive or the D:? The instructions are vague so I have no idea. 2) As C: and D: are both Physical drives, does it sound like C: should be partitioned out to create the E: drive or D:? Thanks for any help I can get. I am extremely stressed out under a massive workload right now, and these vague instructions are quite infuriating.

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Change the default program for a filetype to something not in "Program Files" in Windows Vista

    - by Carson Myers
    I'm trying to make my python scripts run in python 2.6 by default when run from the command line. This is paired with adding certain scripts to the PATH variable and .py to PATHEXT for convenience. But I'll be damned if I can get the file type association to work. In the default programs dialog (found in control panel) I find .py, and click "Change Program." This gives me the same dialog as clicking "Open with..." on a file's context menu. I search for python. Tell it to use python, but it doesn't add it to the list of programs I am allowed to use. I tried making a shortcut to python in Program Files, but that won't work either. If I copy python into a folder in Program Files, then that works. But why can't I just point it at C:\python26\python.exe (which is in the PATH variable) in the first place? Is there a way around this, or do I have to just reinstall python into Program Files?

    Read the article

  • win8: access denied to external USB disk; update access rights fails

    - by Gerard
    I use to work with 2 laptops (vista and win7), my work being files on an external usb disk. My oldest laptop broke down, so I bought a new one. I had no option other than take win8. 1/ I suspect something changed with access rights, as my external disk suffered some "access denied" problem on win8. I was prompted (by win8) somehow to fix the access rights, which I tried to do, getting to the properties - security. This process was very slow and ended up saying "disk is not ready". Additonnally, the usb somehow was not recognized anymore. 2/ Back to win7, I was warned that my disk needed to be verified, which I did. In this process, some files were lost (most of them i could recover from the folder found00x, but I have some backup anyway). Also, I don't know why, but under win7, all the folder showed with a lock. 3/ Then back again to win8. Same problem : access denied to my disk + no way to change access rights as it gets stuck "disk is not ready". Now I am pretty sure there is some kind of bug or inconsistence in win8 / win7. I did 2/ and 3/ a few times. At some point, I also got an access denied in win7. I could restore access rigths to the disk to "system" (properties - security - EDIT for full control to group "system" ...). But then I still get the same access right pb on win8, and getting stuck in the process to restore full control to "system" -- and "admin" groups. Now, after I tried for more than 3 days, I am losing my patience with that bloody win8 which I did not want to buy but had no choice. I upgraded win8 with the windows updates available. Does not help. Anybody can help me ?

    Read the article

  • Enabling AHCI in BIOS for SSD

    - by Robert
    I am trying to help a friend with a desktop upgrade. It is an old machine with an Intel DG31 main board. The board has 1 IDE port to which a DVD-ROM drive is connected, and 2 SATA ports. 1 SATA port had a hard drive with XP on it. I have made that the secondary drive now and wiped the OS as requested, so it is just for data. The new SSD has been installed but I read that for best results one must enable AHCI in the BIOS? So I checked and in the BIOS there is a SATA Mode setting with 2 options - Native and Legacy. I think Native means AHCI? After setting to Native, I installed Windows 7 Home Premium and all the latest drivers from Intel's website and all Windows Updates. Now when I check Device Manager I see this: Also Microsoft says HKEY_LOCAL_MACHINE\System\CurrentControlSet\Services\Msahci\Start and HKEY_LOCAL_MACHINE\System\CurrentControlSet\Services\IastorV\Start should have value 0 for AHCI but I see that the value is 3 for both. So does this mean that Native mode is not AHCI? Or Windows 7 ignored BIOS setting and installed in IDE mode, maybe because both cables are present? Please help me enable AHCI on this system. Thanks!

    Read the article

  • Are there any Microsoft Exchange Clients for iOS and Android that store their local data in an encrypted manner?

    - by Zac B
    I don't feel like this is a product recommendation question, more of a "does this tech even exist and is it feasible" question, but if I'm wrong, feel free to give this question the boot. Context: Our company has a bunch of traveling employees who access the company's Exchange server via thier iDevices or android phones, but because of the data protection laws in the state where our company is based (and the nature of the data our company works with), a recent security audit found that all mobile devices (laptops, phones, etc) operated by our company need to have all company correspondence and related data encrypted all the time. For laptops, that was easy: BitLocker or TrueCrypt, problem solved. For phones and tablets, however, I'm stumped. Sure, you can put lock screens/passwords on the phones, but the data is still accessible via external extraction, as law enforcement authorities already know. Question: Are there any clients for Microsoft Exchange that run on iOS or Android which store local data encrypted? The people using our mobile devices do a lot of their work while offline, so just giving them OWA access with SSL connection security isn't enough. Are there apps/technologies that present an additional login credential prompt to decrypt locally stored data in the app's storage area on the phone? My gut reaction when I started looking into this was "that doesn't sound like something Apple would allow into the App Store", but I've been wrong before...

    Read the article

  • Fedora 17 - Dropping into debug shell after attempted partitioning

    - by i.h4d35
    So I tried creating a new partition on Fedora 17 using fdisk as follows: Command (m for help): n Command action e extended p primary partition (1-4) p Partition number (1-4): 1 First cylinder (2048-823215039, default 2048): Using default value 2048 Last cylinder or +size or +sizeM or +sizeK (1-9039, default 9039): +15G Once this was done,instead of formatting the partition I created, I ran the partprobe command to write the changes to the partition table. On rebooting the computer, it drops to the debug shell and gives me the error as follows: dracut warning:unable to process initqueue dracut warning:/dev/disk/by-uuid/vg_mymachine does not exist dropping to debug shell dracut:/# While trying to run fsck on the said partition from the debug shell, it says "etc/fstab not found" and inside /etc I see a fstab.empty file. Is it now possible to retrieve what I have from the computer? Any help would be appreciated. Thanks in advance Edit: I've also tried the following steps for additional troubleshooting: I tried to boot using the Fedora disk and tried the rescue mode - says no Linux partition detected. I tried to create an fstab file by combining the entries from blkid and the /etc/mtab file and using the UUIDs from the mtab file - It didn't work. As soon as I rebooted the machine, it promptly dropped me in to the debug shell and the fstab file which i created wansn't there anymore in /etc (part of this solution)

    Read the article

  • Event Log: atapi - the device did not respond within the timeout period - Freeze

    - by rjlopes
    Hi, I have a Windows Server 2003 that stops working randomly (displays image on monitor but is completely frozen), all I could found on the event log as causes were an error from atapi and a warning from msas2k3. The event log entries are: Event Type: Error Event Source: atapi Event Category: None Event ID: 9 Date: 22-07-2009 Time: 16:13:33 User: N/A Computer: SERVER Description: The device, \Device\Ide\IdePort0, did not respond within the timeout period. For more information, see Help and Support Center at http : // go.microsoft.com / fwlink / events.asp. Data: 0000: 0f 00 10 00 01 00 64 00 ......d. 0008: 00 00 00 00 09 00 04 c0 .......À 0010: 01 01 00 50 00 00 00 00 ...P.... 0018: f8 06 20 00 00 00 00 00 ø. ..... 0020: 00 00 00 00 00 00 00 00 ........ 0028: 00 00 00 00 01 00 00 00 ........ 0030: 00 00 00 00 07 00 00 00 ........ Event Type: Warning Event Source: msas2k3 Event Category: None Event ID: 129 Date: 22-07-2009 Time: 16:14:23 User: N/A Computer: SERVER Description: Reset to device, \Device\RaidPort0, was issued. For more information, see Help and Support Center at http : // go.microsoft.com / fwlink / events.asp. Data: 0000: 0f 00 10 00 01 00 68 00 ......h. 0008: 00 00 00 00 81 00 04 80 ......? 0010: 04 00 00 00 00 00 00 00 ........ 0018: 00 00 00 00 00 00 00 00 ........ 0020: 00 00 00 00 00 00 00 00 ........ 0028: 00 00 00 00 00 00 00 00 ........ 0030: 01 00 00 00 81 00 04 80 ......? Any hints?

    Read the article

  • Magento Apache Config & Memory Issues

    - by cheshirepine
    I have a Magento installation on a VPS that is giving me a headache. This particular VPS has a reasonable spec - 2gb Memory and 50gb storage. It runs a single domain, with a single Magento install - and nothing else. About 5 months ago we started having issues. Every so often (about once every 2 or 3 weeks) the VPS would crash - all processes stopped and the only way to restart the container is via Virtuozzo. Now, however its 2 or 3 times a week. My VPS hosts confirm I am breaching the 2gb memory limit, at which point all VPS processes are killed to stop it bringing the entire node down. I have not made any config changes to it at all - I was running New Relic on it for a short while, but have removed that in case it was contributing to the issues. I can see nothing in the logs which indicates an issue and we have no CRON jobs running at the time the crashes happen. The site generates steady, but not huge amounts of traffic (averaging usually less than 100 visits per day) Is there anything in particular I should have done to the Apache or PHP configs to help? Im not a massivley experienced Apache admin, but know more than enough to solve most problems... Failing that, any other ideas that might help? Can't afford for this site to be down this much.

    Read the article

  • Passenger not booting Rails App

    - by firecall
    I'm at the end of ability, so time to ask for help. My hosting company are moving me to a new server. I've got my own VPS. It's a fresh CentOS 5 install with Plesk 9.5.2 Essentially Passenger just doesnt seem to be booting the Rails app. It's like it doesnt see it's a Rails app to be booted. I've got Rails 3.0 install with Ruby 1.9.2 built from source. I can run Bundle Install and that works. I've currently got Passenger 3 RC1 installed as per here, but have tried v2 as well. My conf/vhost.conf file looks like this: DocumentRoot /var/www/vhosts/foosite.com.au/httpdocs/public/ RackEnv development #Options Indexes I've got a /etc/httpd/conf.d/passenger.conf file which looks like this: LoadModule passenger_module /usr/local/lib/ruby/gems/1.9.1/gems/passenger-3.0.0.pre4/ext/apache2/mod_passenger.so PassengerRoot /usr/local/lib/ruby/gems/1.9.1/gems/passenger-3.0.0.pre4 PassengerRuby /usr/local/bin/ruby PassengerLogLevel 2 and all I get is a 403 forbidden or the directory listing if I enable Indexes. I dont know what else to do! Yikes. There's nothing in the Apache error log that I can see. The new server admin isnt much help as I think he's a bit junior and says he doesnt know about Rails... sigh :/ I'm a programmer and server admin isnt my bag :(

    Read the article

  • GRE Tunnel over IPsec with Loopback

    - by Alek
    I'm having a really hard time trying to estabilish a VPN connection using a GRE over IPsec tunnel. The problem is that it involves some sort of "loopback" connection which I don't understand -- let alone be able to configure --, and the only help I could find is related to configuring Cisco routers. My network is composed of a router and a single host running Debian Linux. My task is to create a GRE tunnel over an IPsec infrastructure, which is particularly intended to route multicast traffic between my network, which I am allowed to configure, and a remote network, for which I only bear a form containing some setup information (IP addresses and phase information for IPsec). For now it suffices to estabilish a communication between this single host and the remote network, but in the future it will be desirable for the traffic to be routed to other machines on my network. As I said this GRE tunnel involves a "loopback" connection which I have no idea of how to configure. From my previous understanding, a loopback connection is simply a local pseudo-device used mostly for testing purposes, but in this context it might be something more specific that I do not have the knowledge of. I have managed to properly estabilish the IPsec communication using racoon and ipsec-tools, and I believe I'm familiar with the creation of tunnels and addition of addresses to interfaces using ip, so the focus is on the GRE step. The worst part is that the remote peers do not respond to ping requests and the debugging of the general setup is very difficult due to the encrypted nature of the traffic. There are two pairs of IP addresses involved: one pair for the GRE tunnel peer-to-peer connection and one pair for the "loopback" part. There is also an IP range involved, which is supposed to be the final IP addresses for the hosts inside the VPN. My question is: how (or if) can this setup be done? Do I need some special software or another daemon, or does the Linux kernel handle every aspect of the GRE/IPsec tunneling? Please inform me if any extra information could be useful. Any help is greatly appreciated.

    Read the article

  • Installed Paragon HFS+ for Windows 8, now my pc won't recognize the external firewire drive

    - by Steve
    I'm not incredibly knowledgeable about computers and I really need some help. Just got a Seagate external firewire drive this morning. I downloaded the necessary pc driver (Paragon HFS+ for Windows 8) through their website per the instructions that came with the drive. After installation, I restarted and the pc recognized the firewire drive just fine. About three hours into copying files from my pc to the firewire drive, it gave me an error and told me the files couldn't be copied. When I clicked to get out of the message, the computer crashed. After an hour of it trying to repair itself in safe mode, it restored me to an earlier version before the system crashed. Here's my current dilemma: The Paragon HFS+ is still showing up in my programs as installed, but the Device Manager is not recognizing the drive. When I try to uninstall and reinstall Paragon, it interrupts me with a message saying "The setup must update files or services that cannot be updated while the system is running" and basically gives me the finger. I have no idea what to do now, as it won't let me uninstall and reinstall Paragon, and I have no idea why it crashed my computer in the first place. Is there possibly another Mac - PC firewire driver I can try downloading instead? I really don't know what I'm doing and any help would be greatly appreciated.

    Read the article

  • Can I have a single solid state drive and a RAID array on the same machine?

    - by jaminto
    Hi- To summarize, i'm looking to use a single solid state drive as my primary drive, and two conventional sata drives in a RAID 1 configuration for data. I am trying to install 64-bit Windows 7 onto this configuration. Is this possible? Here are the details: I built a desktop that has been running 64-bit Vista on two 500Gb in a RAID 1 array for a few years. I just purchased an Intel X25-M 80Gb Sata Solid-State Drive, and was planning on using this a my primary drive, and keeping the RAID 1 array as my data drive. I added the SSD drive and in the RAID setup, configured it as a RAID 0 array of only one disk. Then, I tried to do a clean install of windows 7 64-bit, but got stuck in the "Missing driver for CD/DVD drive" black hole of selecting driver files and Windows telling me that i don't have the appropriate driver for my hardware. The missing hardware is NOT a CD/DVD drive, since i'm installing off of my only CD/DVD drive. Plus at one point i was able to point it at a driver for my raid controller, and then my hard drives magically showed up as browsable sources for finding drivers for some other unnamed device that setup couldn't recognize. After a few hours of trying drivers (this was a very slow process) i decided to reboot and look at the BIOS settings. I'm using an ASUS M2A-VM motherboard which has an ATI SB600 RAID controller on board. I switched the "On board SATA Type" setting from "SATA" to "AHCI" thinking that since AHCI is an Intel thing, this would help. Unfortunately, this abandoned my RAID configuration, and my previously mirrored drives are showing up as separate drives when i boot into my current windows installation. Am i trying to do the impossible here? Should i just buy a separate SATA/RAID PCI card and plug the SSD into that? Any help would be greatly appreciated.

    Read the article

< Previous Page | 657 658 659 660 661 662 663 664 665 666 667 668  | Next Page >