Search Results

Search found 62759 results on 2511 pages for 'view first'.

Page 669/2511 | < Previous Page | 665 666 667 668 669 670 671 672 673 674 675 676  | Next Page >

  • Prolem with if function

    - by Ryan
    Hi, something seems to be wrong with the first line of this if function, seems alright to me though. if ($count1 == sizeof($map) && $count2 == sizeof($map[0])){ echo ";"; }else{ echo ","; } This is the error I get (line 36 is the first line of the above line.) Parse error: parse error in C:\wamp\www\game\mapArrayConvertor.php on line 36 EDIT: The OP notes in an answer below that the error was a missing semi-colon on line 35 and not the code included in the question.

    Read the article

  • Make a router like zend

    - by Vahan
    I have a url http://*.com/branch/module/view/id/1/cat/2/etc/3. It becomes. array ( 'module'=>'branch', 'controller'=>'module', 'action'=>'view' ); next I need to get the params. Ihave this array. /*function getNextSegments($n,$segments) { return array_slice ( $q = $this->segments, $n + 1 ); } $params = getNextSegments(3); */ array ( 0 => 'id', 1 => '1', 2 => 'cat', 3 => '2', 4 => 'etc', 5 => '3' );//params And i wanna convert it to this one: array ( 'id'=1, 'cat'=2, 'etc'=3, ); How i can do this using php function. I know I can do using for or foreach, but I think php has such function , but i cant find it :(. Thank you. class A { protected function combine($params) { $count = count ( $params ); $returnArray = array (); for($i = 0; $i < $count; $i += 2) { $g = $i % 2; if ($g == 0 or $g > 0) { if (isset ( $params [$i] ) and isset ( $params [$i + 1] )) $returnArray [$params [$i]] = $params [$i + 1]; } } return $returnArray; } } This works normaly. If anybody has better login for this please help. Thank you again.

    Read the article

  • it's not possible to loop .click function (To create multipple buttons)

    - by user1542680
    Im Trying to create multiple buttons that each one of them doing something else. It working great outside of the "each" loop, But in the moment I'm inserting the .click function in the .each function it doesn't work... Here is the Code: $.each(data.arr, function(i, s){ html += '<div id="mybtn'+s.id+'"><button class="first">Btn1</button><button class="second">Btn2</button></div>'; var btnclass="#mybtn"+s.id+" .first"; $(btnclass).click(function(){ //do something }); }); Please Let me know what is wrong... Thank you very much!!! Eran.

    Read the article

  • Why is it when I set "closeOnEscape" to false and then "closeOnEscape" to true jquery dialog escape

    - by chobo2
    Hi I am using jquery ui 1.8 and I have a model dialog that popups up and if a user clicks on a checkbox another one comes up. This requires them to say "yes" or "no" so I removed the "X" on the dialog and put closeOnEscape to false. However I noticed when I did that the model dialog underneath it would close when they hit escape. So now when the one that pops up when the checkbox is checked I disable closeOnEscape on the first dialog box. When they close it I enable again yet it does not work. I am not sure why $("#Dialog").dialog( "option", "closeOnEscape", true); I even do this in firebug. I just open my first dialog up Do this in firebugs console $("#Dialog").dialog( "option", "closeOnEscape", false); Then verify that escape is now disabled. I then try to enable it again $("#Dialog").dialog( "option", "closeOnEscape", true); Yet it never enables.

    Read the article

  • HandsOnTable - using date functions with methods

    - by briansol
    I have a function used on the datepicker to limit dates selected to the first of the month... I invoke it by setting a class and listener, such as: $( ".datepickfom" ).datepicker( { beforeShowDay: fom, showOn: "both", buttonImage: "/images/calendar.png", buttonImageOnly: true, changeMonth: true, changeYear: true, dateFormat: "m/d/yy", yearRange: "-25:+100", constrainInput: true } ); the fom call: function fom(date){ if (date.getDate() != 1) { return [false, "", "Specify 1st of Month"]; } return [true, ""]; } This works great for regular forms. I'm looking to extend this functionality to the HandsOnTable 'date' cell data types. var $container_1 = $("#datatable_1"); var handsontable_1 = $container_1.data('handsontable'); $("#datatable_1").handsontable( { columns: [ {}, {}, { type: 'date', dateFormat: 'm/d/yy' }, {}, { type: 'dropdown', source: ["","Y","N"] }, {}, {} ] }); This also works as it should, but the date lets me pick other dates besides the first. Is there a way to attach the beforeShowDay option to the HOT cell call as well?

    Read the article

  • Can I do this in only one query ?

    - by Paté
    Merry christmas everyone, I Know my way around SQL but I'm having a hard time figuring this one out. First here are my tables (examples) User id name friend from //userid to //userid If user 1 is friend with user 10 then you a row with 1,10. User 1 cannot be friend with user 10 if user 10 is not friend with user 1 so you have 1,10 10,1 It may look weird but I need those two rows per relations. Now I'm trying to make a query to select the users that have the most mutual friend with a given user. For example User 1 is friend with user 10,9 and 7 and user 8 is friend with 10,9 and 7 too ,I want to suggest user 1 to invite him (like facebook). I want to get like the 10 first people with the most mutual friend. The output would be like User,NumOfMutualFriends I dont know if that can be done in a single query ? Thanks in advance for any help.

    Read the article

  • Should I be using libraries if I'm trying to learn how to program?

    - by CodeJustin.com
    I have been programming "a lot" in the past few months and at first I was trying to find the "easyest" language. Fortunately I realized that it's not about the language, it's about learning HOW to code. I ran into the Stanford lectures online (programming methodology) and I watched them all (around 23 hours total) awhile ago. Then I got into Java ME and programmed about 28.47% of a mobile RPG game (only around 2k lines of code). I feel like I learned a lot from those two experiences compared to previous ones but now that I'm moving into flash/actionscript 3.0 development and I'm finding myself learning like I did when I first started with PHP. I'm not really getting whats under the hood kind of. I'm finding myself using libraries to speed up development time which doesn't seem like a bad thing BUT I personally do not know how to write the libraries myself off hand. So should I be coding everything myself or is it ok to use libraries when you don't even know how to code them?

    Read the article

  • Mercurial: Recommended way of sending a whole repository to someone

    - by Svish
    I have done some programming and I have used Mercurial for source control. I now need to send all of my code to someone else (because they are going to take over). Since all copies of a mercurial repository is a full and real repository my first thought is to first do a clone of my repository without an update and then zipping and emailing that clone. Is this a good way, or is there a better way? For example when using the TortoiseHg Repository Explorer I can right-click on a changeset and under Export there are various options that looks like they could be doing something interesting, but I don't quite understand them or know which one to use.

    Read the article

  • Qt hide QLayout (switch between two layouts)

    - by Lodhart
    I didn't find solution for my problem with two QLayouts. I need app with QHBoxLayout with possible expandind when I will add new widgets, push buttons, .... So what I have: One QDialog and two layouts. Now I know that I can't hide the layout. So I tray just : layout()->removeItem(firstlayout); layout()->addLayout(secondLayout); But when I did this, I saw all items in first layout on possition [0,0]. So next step I try: for (all items in first layout) if (widget) widget->hide(); But this is working only with QWidget and I have many different items in layouts. Simply way is use the widget, because there is possibole to use hide/show, but I need auto expanding window when I add new items.

    Read the article

  • Find the period of over speed ?

    - by Vimvq1987
    Just something interesting come in my mind. Assume that we have a table (in SQL Server) like this: Location Velocity Time What is the best way to determine over speed periods (speed barrier is defined) ? My first idea was loading the table into an array, and then iterate over array to find these periods: (Pseudo C# code) bool isOverSpeed = false; for (int i =0;i<arr.Length;i++) { if (!isOverSpeed) if (arr[i].Velocity > speedBarrier) { #insert the first record into another array. isOverSpeed = true; } if(isOverSpeed) if (arr[i].Velocity < speedBarrier) { #insert the record into that array isOverSpeed = false; } } It works, but somewhat "not very effectively". Is there a "smarter" way, such as a T-SQL query or another algorithm to do this?

    Read the article

  • NSTimer won't stop it only resets when invalidated & released

    - by J Fries
    When I press my stop button to stop the timer it just resets to the original time and begins counting down again. I have looked everywhere and all I have found is "invalidate" and it isn't working. I want the time to stop when I hit stop and the label to display the original time. I also turned off automatic counting so I could try releasing and it is giving me an error: 0x10e20a5: movl 16(%edx), %edx EXC_BAD_ACCESS (code=2, address=0x10) `NSTimer *rockettTimer; int rocketCount; @interface FirstViewController () @property (strong, nonatomic) IBOutlet UILabel *rocketTimer; - (IBAction)stopButton:(id)sender; - (IBAction)startButton:(id)sender; @end @implementation FirstViewController @synthesize rocketTimer; -(void) rocketTimerRun{ rocketCount = rocketCount - 1; int minuts = rocketCount / 60; int seconds = rocketCount - (minuts * 60); NSString *timerOutput = [NSString stringWithFormat:@"%d:%.2d", minuts, seconds]; rocketTimer.text = timerOutput; } - (IBAction)startButton:(id)sender { rocketCount = 180; rockettTimer = [NSTimer scheduledTimerWithTimeInterval:1.0 target:self selector:@selector(rocketTimerRun) userInfo:nil repeats:YES]; - (IBAction)stopButton:(id)sender { [rockettTimer invalidate]; //[rockettTimer release]; } - (void)viewDidLoad { [super viewDidLoad]; // Do any additional setup after loading the view, typically from a nib. } - (void)viewDidUnload { [self setRocketTimer:nil]; [super viewDidUnload]; // Release any retained subviews of the main view. } - (BOOL)shouldAutorotateToInterfaceOrientation: (UIInterfaceOrientation)interfaceOrientation { if ([[UIDevice currentDevice] userInterfaceIdiom] == UIUserInterfaceIdiomPhone) { return (interfaceOrientation != UIInterfaceOrientationPortraitUpsideDown); } else { return YES; } } @end`

    Read the article

  • How to hang up (disconnect, terminate,..) incomings call???

    - by Cesar Valiente
    "How do you hang up incoming calls (in Android of course)?" First, I know this question has been asked and answered several times, and the response is always "you can't". But if we look in the market we get a few applications (all private software, no access to the source code... :-( ) that do this action, such as CallFilter, Panda firewall and others... So... does somebody know how these apps do the hang up action, (or terminate, or disconnect or whatever you call it..)? And other question, if the first don't get a response.. does somebody know how send an incoming call to the voice mail? Of course, all questions are about how to do it programmatically. So with the voicemail question I know there's a flag in contacts that is used for that, but like I said, I'd like to know the programmatical way. Thanks all!

    Read the article

  • C# Same DataSource + Multiple DataGridViews = Data Binding Issues?

    - by C. Griffin
    Here's what I'm doing: I have (2) DataGridView controls DGV #1 is bound to the DataSet, DGV #2 is bound to a DataView of the SAME DataSet Now, what I'm needing to accomplish here is this: When a user checks a boolean column on the original DGV, the second DGV should now display the newly checked row also. The context is that the first DGV is a master list, and the second one is a "favorite" view of the first. When I check the rows, the favorite column does NOT update. Do I need to use a DataAdapter to actually update the database, or can I operate directly on the DataSet (DataTable) -- or even with the Rows in the original DataGridView?

    Read the article

  • Passing data from one viewcontroller to another

    - by user1392515
    I subclassed two view controllers. The first one is supposed to pass data, a NSUrl object to the second one. .m of the first one: NSURL *temp = [NSURL URLWithString:@"http://example.com"]; UIViewController *presentationsFullScreen_ViewController = [self.storyboard instantiateViewControllerWithIdentifier:@"PresentationsFullScreen_ViewController"]; presentationsFullScreen_ViewController.urlToUse = temp; .h of the second one: #import <UIKit/UIKit.h> @interface PresentationsFullScreen_ViewController : UIViewController { NSURL *urlToUse; } @property (nonatomic,retain) NSURL *urlToUse; It is obviously not working and not compiling,telling me essentially that I didn't subclass it and that the property urlToUse is not found on UIViewController. How do I subclass correctly? Thanks!

    Read the article

  • Delegate Example From C# In Depth Confusion

    - by ChloeRadshaw
    I am looking at this example: List<Product> products = Product. GetSampleProducts() ; products.Sort( (first, second) => first.Name.CompareTo(second. Name) ) ; foreach (Product product in products) { Console. WriteLine(product) ; } What function is actually called in the API when you do that? Does the compiler create a class which implemnents the IComparer interface? I thought delegates were anonymous methods - Here it seems to be an anonymous interface implementation which is casuing confusion

    Read the article

  • Shared memory of same DLL in different 32 bit processes is sometimes different in a terminal session

    - by KBrusing
    We have an 32 bit application consisting of some processes. They communicate with shared memory of a DLL used by every process. Shared memory is build with global variables in C++ by "#pragma data_seg ("Shared")". When running this application sometime during starting a new process in addition to an existing (first) process we observe that the shared memory of both processes is not the same. All new started processes cannot communicate with the first process. After stopping all of our processes and restarting the application (with some processes) everything works fine. But sometime or other after successfully starting and finishing new processes the problem occurs again. Running on all other Windows versions or terminal sessions on Windows server 2003 our application never got this problem. Is there any new "feature" on Windows server 2008 that might disturb the hamony of our application?

    Read the article

  • How to add sub category on my codeigniter php application ?

    - by sagarmatha
    Hello friends I have a view echo "<label for='parent'>Category</label><br/> "; echo form_dropdown('category_id', $categories). "<p>"; controller function create(){ if($this->input->post('name')){ $this->MProducts->addProduct(); $this->session->set_flashdata('message', 'Products Created'); redirect('admin/products/index', 'refresh'); }else{ $data['title'] = "Create Product"; $data['main'] = 'admin_product_create'; $data['categories']= $this->MCats->getTopCategories(); $this->load->vars($data); $this->load->view('dashboard'); } } and the model is function getTopcategories(){ $data = array(); $data[0] = 'root'; $this->db->where('parentid',0); $Q = $this->db->get('categories'); if($Q->num_rows() > 0){ foreach($Q->result_array() as $row){ $data[$row['id']] = $row['name']; } } $Q->free_result(); return $data; } Basically, what i want is we get sub categories when we click categories and 'selected' subcategory id goes to database when we create products, So that we can list products by sub categories. Please help me how do we do that ?

    Read the article

  • image list, listview,picturebox

    - by user548694
    I wanted to show my pics in picturebox. but also wanted to show a preview of pics. When user select a pic, it is shown in picbox but i have problem in resoulution. Here is my code private void openToolStripMenuItem_Click(object sender, EventArgs e) { ofd = new OpenFileDialog(); ofd.Title = "Open an Image File"; ofd.FileName = ""; ofd.Filter = "Image Files(*.jpg; *.jpeg; *.gif; *.bmp)|*.jpg; *.jpeg; *.gif; *.bmp"; if (ofd.ShowDialog() == DialogResult.OK) { DirectoryInfo dir = new DirectoryInfo(@"c:\pic"); foreach (FileInfo file in dir.GetFiles()) { this.imageList1.Images.Add(Image.FromFile(file.FullName)); } this.listView1.View = View.LargeIcon; this.imageList1.ImageSize = new Size(40, 40); this.listView1.LargeImageList = this.imageList1; for (int j=0; j < this.imageList1.Images.Count; j++) { ListViewItem item = new ListViewItem(); item.ImageIndex = j; listView1.Items.Add(item); ListViewItem item2 = new ListViewItem(); item2.SubItems.Add(j.ToString()); } private void listView1_SelectedIndexChanged(object sender, EventArgs e) { int i = this.listView1.FocusedItem.Index; this.PicBox1.Image = this.imageList1.Images[i]; } On click i see only image of resolution of (40,40) becuse i have set it this.imageList1.ImageSize = new Size(40, 40); and not orignal size. How can I have it. 2- I want to write also image names and index(image no) under each images. Its it possible. reagrsd,

    Read the article

  • How do I link (dependency) properties in my ViewModel?

    - by mos
    Simplified example: I have an object that models a user. Users have a first name and a last name. The UserViewModel has a dependency property for my Models.User object. In the declaration of the UserView's xaml, I want to bind a couple of TextBlocks to the first and last name properties. What is the correct way to do this? Should I have readonly DependencyProperties for the name fields, and when the dependency property User is set, update them? Can the name fields be regular C# properties instead? Or, should I bind like this: <TextBlock Text="{Binding User.FirstName}" />

    Read the article

  • How does linq decide between inner & outer joins

    - by user287795
    Hi Usually linq is using an left outer join for its queries but on some cases it decides to use inner join instead. I have a situation where that decision results in wrong results since the second table doesn't always have suitable records and that removes the records from the first table. I'm using a linqdatasource over a dbml where the relevant tables are identical but one holds historical records removed from the first. both have the same primary key. and I'm using a dataloadoption to load both tables at once with out round trips. Would you explain why linq decided to use an inner join here? Thanks

    Read the article

  • Handle edittexts onKeyListener ?

    - by hungson175
    Hi everyone, I am creating login screen with 2 editTexts: etUsername and etPassword. On the etUsername, user should input the username and press Enter to go to the edit text etPassword, then he inputs the password, press Enter to login. Here are my current codes: etUsername.setOnKeyListener(new OnKeyListener() { @Override public boolean onKey(View v, int keyCode, KeyEvent event) { if ((keyCode == KeyEvent.KEYCODE_ENTER)) { etPassword.requestFocus(); return true; } else return false; } }); etPassword.setOnKeyListener(new OnKeyListener() { @Override public boolean onKey(View v, int keyCode, KeyEvent event) { if ((keyCode == KeyEvent.KEYCODE_ENTER)) { loginToServer(); return true; } else return false; } }); But when I input the username, and then press Enter – the program tries to log in to the server. In the debug mode, I saw that when I pressed Enter once (on the etUsername) then first: etUsername.onKey() is called and then etPassword.onKey() is also called ! Can anyone please tell me, how to implement what I want ? Thank you very much, Son

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • css of pagination links

    - by fusion
    i'd like a basic idea of how to go about formatting the following paging of the search result. this is the paging code: //Create and print the Navigation bar $nav=""; $next = $page+1; $prev = $page-1; if($page > 1) { $nav .= "<div class=\"search_mainpg\"><div class=\"searchpage\" style=\"width:5%;\"><a onclick=\"showPage('','$prev'); return false;\" href=\"$self?page=" . $prev . "&q=" .urlencode($search_result) . "\">< Prev</a></div>"; $first = "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('','1'); return false;\" href=\"$self?page=1&q=" .urlencode($search_result) . "\"> << </a></div>" ; } else { $nav .= "&nbsp;"; $first = "&nbsp;"; } for($i = 1 ; $i <= $numpages ; $i++) { if($i == $page) { $nav .= "<b>$i</b>"; }else{ $nav .= "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('',$i); return false;\" href=\"$self?page=" . $i . "&q=" .urlencode($search_result) . "\">$i</a></div>"; } } if($page < $numpages) { $nav .= "<div class=\"searchpage\" style=\"width:5%;\"><a onclick=\"showPage('','$next'); return false;\" href=\"$self?page=" . $next . "&q=" .urlencode($search_result) . "\">Next ></a></div>"; $last = "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('','$numpages'); return false;\" href=\"$self?page=$numpages&q=" .urlencode($search_result) . "\"> >> </a></div></div>"; } else { $nav .= "&nbsp;"; $last = "&nbsp;"; } echo $first . $nav . $last; currently, it displays like this:

    Read the article

  • Is using a DataSet's column Expression works in background same as manual calculation?

    - by Harikrishna
    I have one datatable which is not bindided and records are coming from the file by parsing it in the datatable dynamically every time. Now there is three columns in the datatable Marks1,Marks2 and FinalMarks. And their types is decimal. Now for making addition of columns Marks1 and Marks2 's records and store it into FinalMarks column,For that what I do is : datatableResult.Columns["FinalMarks"].Expression="Marks1+Marks2"; It's works properly. It can be done in other way also is foreach (DataRow r in datatableResult.Rows) { r["FinalMarks"]=Convert.ToDecimal(r["Marks1"])+Convert.ToDecimal(r["Marks2"]); } Is first approach same as second approach in background means is both approach same or what? EDIT: I want to know that first approach works in background as second approach.

    Read the article

< Previous Page | 665 666 667 668 669 670 671 672 673 674 675 676  | Next Page >