Search Results

Search found 18028 results on 722 pages for 'atomic values'.

Page 670/722 | < Previous Page | 666 667 668 669 670 671 672 673 674 675 676 677  | Next Page >

  • Jquery $.post and PHP - Prevent the ability to use script outside of main website.

    - by Tim
    I have a PHP script setup using Jquery $.post which would return a response or do an action within the targeted .php file within $.post. Eg. My page has a form where you type in your Name. Once you hit the submit form button, $.post is called and sends the entered Name field value into "mywebsite.xyz/folder/ajaxscript.php" If a user was to visit "mywebsite.xyz/folder/ajaxscript.php" directly and somehow POST the data to the script, the script would return a response / do an action, based on the submitted POST data. The problem is, I don't want others to be able to periodically "call" an action or request a response from my website without using the website directly. Theoretically, right now you could determine what Name values my website allows without even visiting it, or you could call an action without going through the website, by simply visiting "mywebsite.xyz/folder/ajaxscript.php" So, what measures can I take to prevent this from happening? So far my idea is to ensure that it is a $_POST and not a $_GET - so they cannot manually enter it into the browser, but they could still post data to the script... Another measure is to apply a session key that expires, and is only valid for X amount of visits until they revisit the website. ~ Or, just have a daily "code" that changes and they'd need to grab this code from the website each day to keep their direct access to the script working (eg. I pass the daily "code" into each post request. I then check that code matches in the ajax php script.) However, even with these meaures, they will STILL have access to the scripts so long as they know how to POST the data, and also get the new code each day. Also, having a daily code requirement will cause issues when visiting the site at midnight (12:00am) as the code will change and the script will break for someone who is on the website trying to call the script, with the invalid code being passed still. I have attempted using .htaccess however using: order allow,deny deny from all Prevents legitimate access, and I'd have to add an exception so the website's IP is allowed to access it.. which is a hassle to update I think. Although, if it's the only legitimate solution I guess I'll have to. If I need to be more clear please let me know.

    Read the article

  • Is there a recommended approach to handle saving data in response to within-site navigation without

    - by Carvell Fenton
    Hello all, Preamble to scope my question: I have a web app (or site, this is an internal LAN site) that uses jQuery and AJAX extensively to dynamically load the content section of the UI in the browser. A user navigates the app using a navigation menu. Clicking an item in the navigation menu makes an AJAX call to php, and php then returns the content that is used to populate the central content section. One of the pages served back by php has a table form, set up like a spreadsheet, that the user enters values into. This table is always kept in sync with data in the database. So, when the table is created, is it populated with the relevant database data. Then when the user makes a change in a "cell", that change immediately is written back to the database so the table and database are always in sync. This approach was take to reassure users that the data they entered has been saved (long story...), and to alleviate them from having to click a save button of some kind. So, this always in sync idea is great, except that a user can enter a value in a cell, not take focus out of the cell, and then take any number of actions that would cause that last value to be lost: e.g. navigate to another section of the site via the navigation menu, log out of the app, close the browser, etc. End of preamble, on to the issue: I initially thought that wasn't a problem, because I would just track what data was "dirty" or not saved, and then in the onunload event I would do a final write to the database. Herein lies the rub: because of my clever (or not so clever, not sure) use of AJAX and dynamically loading the content section, the user never actually leaves the original url, or page, when the above actions are taken, with the exception of closing the browser. Therefore, the onunload event does not fire, and I am back to losing the last data again. My question, is there a recommended way to handle figuring out if a person is navigating away from a "section" of your app when content is dynamically loaded this way? I can come up with a solution I think, that involves globals and tracking the currently viewed page, but I thought I would check if there might be a more elegant solution out there, or a change I could make in my design, that would make this work. Thanks in advance as always!

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Rails send mail with GMail

    - by Danny McClelland
    Hi Everyone, I am on rails 2.3.5 and have the latest Ruby installed and my application is running well, except, GMail emails. I am trying to setup my gmail imap connection which has worked previously but now doesnt want to know. This is my code: # Be sure to restart your server when you modify this file # Uncomment below to force Rails into production mode when # you don't control web/app server and can't set it the proper way # ENV['RAILS_ENV'] ||= 'production' # Specifies gem version of Rails to use when vendor/rails is not present RAILS_GEM_VERSION = '2.3.5' unless defined? RAILS_GEM_VERSION # Bootstrap the Rails environment, frameworks, and default configuration require File.join(File.dirname(__FILE__), 'boot') Rails::Initializer.run do |config| # Gems config.gem "capistrano-ext", :lib => "capistrano" config.gem "configatron" # Make Time.zone default to the specified zone, and make Active Record store time values # in the database in UTC, and return them converted to the specified local zone. config.time_zone = "London" # The internationalization framework can be changed to have another default locale (standard is :en) or more load paths. # All files from config/locales/*.rb,yml are added automatically. # config.i18n.load_path << Dir[File.join(RAILS_ROOT, 'my', 'locales', '*.{rb,yml}')] #config.i18n.default_locale = :de # Your secret key for verifying cookie session data integrity. # If you change this key, all old sessions will become invalid! # Make sure the secret is at least 30 characters and all random, # no regular words or you'll be exposed to dictionary attacks. config.action_controller.session = { :session_key => '_base_session', :secret => '7389ea9180b15f1495a5e73a69a893311f859ccff1ffd0fa2d7ea25fdf1fa324f280e6ba06e3e5ba612e71298d8fbe7f15fd7da2929c45a9c87fe226d2f77347' } config.active_record.observers = :user_observer end ActiveSupport::CoreExtensions::Date::Conversions::DATE_FORMATS.merge!(:default => '%d/%m/%Y') ActiveSupport::CoreExtensions::Time::Conversions::DATE_FORMATS.merge!(:default => '%d/%m/%Y') require "will_paginate" ActionMailer::Base.delivery_method = :smtp ActionMailer::Base.smtp_settings = { :enable_starttls_auto => true, :address => "smtp.gmail.com", :port => 587, :domain => "XXXXXXXX.XXX", :authentication => :plain, :user_name => "XXXXXXXXXX.XXXXXXXXXX.XXX", :password => "XXXXX" } But the above just results in an SMTP auth error in the production log. I have read varied reports of this not working in Rails 2.2.2 but nothing for 2.3.5, anyone got any ideas? Thanks, Danny

    Read the article

  • Trying to integrate CakePHP and jQuery

    - by user198003
    Trying to integrate CakePHP and jQuery, using next example http://bakery.cakephp.org/articles/view/dynamic-select-boxes-with-ajax-jquery What I want is to when user change first option element, to automaticly fill second select option box with proper values. But, nothing happens, if you can help me why. So, there is a Invoice add form (add.ctp), with next code... <?php echo $form->create('Invoice');?> <?php echo $javascript->link('jquery.js'); $category = array('1' => 'First', '4' => 'Fourth', '7' => 'Seventh'); echo $form->input('client_id', array('options' => $category, 'empty' => 'Choose:')); echo $form->select('clientBank_id', array("Choose category first"), null, null, false); ?> <script> $("#InvoiceClientId").change(function () { $.post('/invoices/listTitleByCategory/' + $(this).val(), function(data) { $("#InvoiceClientBankId").empty().append(data); }, 'html'); }) </script> Also, there is controller (invoices_controller.php): <?php var $name = 'Invoices'; var $helpers = array('Html', 'Form', 'Time', 'Number', 'Javascript'); var $paginate = array('order' => array('Invoice.pinned DESC', 'Invoice.invoiceNumber')); var $components = array('RequestHandler'); function beforeRender(){ // prevent useless warnings for Ajax if($this->RequestHandler->isAjax()){ Configure::write('debug', 0); } } // etc... function listTitleByCategory($category = "") { $this->layout = 'ajax'; $this->beforeRender(); $this->autoRender = false; $data = $this->Invoice->Client->find('list'); echo "<option value=0>just for testing...</option>"; foreach($data as $key => $val) { echo "<option value=$key>$val</option>"; } } ?> Please, if you can help me solving this. Thank you in advance!

    Read the article

  • how to develop a program to minimize errors in human transcription of hand written surveys

    - by Alex. S.
    I need to develop custom software to do surveys. Questions may be of multiple choice, or free text in a very few cases. I was asked to design a subsystem to check if there is any error in the manual data entry for the multiple choices part. We're trying to speed up the user data entry process and to minimize human input differences between digital forms and the original questionnaires. The surveys are filled with handwritten marks and text by human interviewers, so it's possible to find hard to read marks, or also the user could accidentally select a different value in some question, and we would like to avoid that. The software must include some automatic control to detect possible typing differences. Each answer of the multiple choice questions has the same probability of being selected. This question has two parts: The GUI. The most simple thing I have in mind is to implement the most usable design of the questions display: use of large and readable fonts and space generously the choices. Is there something else? For faster input, I would like to use drop down lists (favoring keyboard over mouse). Given the questions are grouped in sections, I would like to show the answers selected for the questions of that section, but this could slow down the process. Any other ideas? The error checking subsystem. What else can I do to minimize or to check human typos in the multiple choice questions? Is this a solvable problem? is there some statistical methodology to check values that were entered by the users are the same from the hand filled forms? For example, let's suppose the survey has 5 questions, and each has 4 options. Let's say I have n survey forms filled in paper by interviewers, and they're ready to be entered in the software, then how to minimize the accidental differences that can have the manual transcription of the n surveys, without having to double check everything in the 5 questions of the n surveys? My first suggestion is that at the end of the processing of all the hand filled forms, the software could choose some forms randomly to make a double check of the responses in a few instances, but on what criteria can I make this selection? This validation would be enough to cover everything in a significant way? The actual survey is nation level and it has 56 pages with over 200 questions in total, so it will be a lot of hand written pages by many people, and the intention is to reduce the likelihood of errors and to optimize speed in the data entry process. The surveys must filled in paper first, given the complications of taking laptops or handhelds with the interviewers.

    Read the article

  • How to created filtered reports in WPF?

    - by Michael Goyote
    Creating reports in WPF. I have two related tables. Table A-Customer: CustomerID(PK) Names Phone Number Customer Num Table B-Items: Products Price CustomerID I want to be able to generate a report like this: CustomerA Items Price Item A 10 Item B 10 Item C 10 --------------- Total 30 So this is what I have done: <Window x:Class="ReportViewerWPF.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:rv="clr-namespace:Microsoft.Reporting.WinForms; assembly=Microsoft.ReportViewer.WinForms" Title="Customer Report" Height="300" Width="400"> <Grid> <WindowsFormsHost Name="windowsFormsHost1"> <rv:ReportViewer x:Name="reportViewer1"/> </WindowsFormsHost> </Grid> Then I created a dataset and loaded the two tables, followed by a report wizard (dragged all the available fields and dropped them to the Values pane). The code behind the WPF window is this: public partial class CustomerReport : Window { public CustomerReport() { InitializeComponent(); _reportViewer.Load += ReportViewer_Load; } private bool _isReportViewerLoaded; private void ReportViewer_Load(object sender, EventArgs e) { if (!_isReportViewerLoaded) { Microsoft.Reporting.WinForms.ReportDataSource reportDataSource1 = new Microsoft.Reporting.WinForms.ReportDataSource(); HM2DataSet dataset = new HM2DataSet(); dataset.BeginInit(); reportDataSource1.Name = "DataSet";//This is the dataset name reportDataSource1.Value = dataset.CustomerTable; this.reportViewer1.LocalReport.DataSources.Add(reportDataSource1); this.reportViewer1.LocalReport.ReportPath = "../../Report3.rdlc"; dataset.EndInit(); HM2DataSetTableAdapters.CustomerTableAdapter funcTableAdapter = new HM2DataSetTableAdapters.CustomerTableAdapter(); funcTableAdapter.ClearBeforeFill = true; funcTableAdapter.Fill(dataset.CustomerTable); _reportViewer.RefreshReport(); _isReportViewerLoaded = true; } } As you might have guessed this loaded this list of customer with items and price: Customer Items Price Customer A Items A 10 Customer A Items B 10 Customer B Items D 10 Customer B Items C 10 How can I fine-tune this report to look like the one above, where the user can filter the customer he wants displayed on the report? Thanks in advance for the help. I would have preferred to use LINQ whenever filtering data

    Read the article

  • Unsure how to design JavaScript / jQuery functionality which uses XML to create HTML objects

    - by Jack Roscoe
    Hi, I'm using JavScript and jQuery to read an XML document and subsequently use the information from the XML to create HTML objects. The main 'C' nodes in the XML document all have a type attribute, and depending on the type I want to run a function which will create a new html object using the other attributes assigned to that particular 'C' node node. Currently, I have a for loop which extracts each 'C' node from the XML and also it's attributes (e.g. width, height, x, y). Also inside the for loop, I have an if statement which checks the 'type' attribute of the current 'C' node being processed, and depending on the type it will run a different function which will then create a new HTML object with the attributes which have been drawn from the XML. The problem is that there may be more than one 'C' node of the same type, so for example when I'm creating the function that will run when a 'C' node of 'type=1' is detected, I cannot use the 'var p = document.createElement('p')' because if a 'C' node of the same type comes up later in the loop it will clash and override that element with that variable that has just been created. I'm not really sure how to approach this? Here is my entire script. If you need me to elaborate on any parts please ask, I'm sure it's not written in the nicest possible way: var arrayIds = new Array(); $(document).ready(function(){ $.ajax({ type: "GET", url: "question.xml", dataType: "xml", success: function(xml) { $(xml).find("C").each(function(){ arrayIds.push($(this).attr('ID')); }); var svgTag = document.createElement('SVG'); // Create question type objects function ctyp3(x,y,width,height,baC) { alert('test'); var r = document.createElement('rect'); r.x = x; r.y = y; r.width = width; r.height = height; r.fillcolor = baC; svgTag.appendChild(r); } // Extract question data from XML var questions = []; for (j=0; j<arrayIds.length; j++) { $(xml).find("C[ID='" + arrayIds[j] + "']").each(function(){ // pass values questions[j] = { typ: $(this).attr('typ'), width: $(this).find("I").attr('wid'), height: $(this).find("I").attr('hei'), x: $(this).find("I").attr('x'), y: $(this).find("I").attr('x'), baC: $(this).find("I").attr('baC'), boC: $(this).find("I").attr('boC'), boW: $(this).find("I").attr('boW') } alert($(this).attr('typ')); if ($(this).attr('typ') == '3') { ctyp3(x,y,width,height,baC); // alert('pass'); } else { // Add here // alert('fail'); } }); } } }); });

    Read the article

  • Core Plot: x-axis labels not plotted when using scaleToFitPlots

    - by AlexR
    Problem: I can't get Core Plot (1.1) to plot automatic labels for my x-axis when using autoscaling ([plotSpace scaleToFitPlots:[graph allPlots]). What I have tried: I changed the values for the offsets and paddings, but this did not change the result. However, when turning autoscale off (not using [plotSpace scaleToFitPlots:[graph allPlots]]and setting the y scale automatically, the automatic labeling of the x-axis works. Question: Is there a bug in Core Plot or what did I do wrong? I would appreciate any help! Thank you! This is how I have set up my chart: CPTBarPlot *barPlot = [CPTBarPlot tubularBarPlotWithColor:[CPTColor blueColor] horizontalBars:NO]; barPlot.baseValue = CPTDecimalFromInt(0); barPlot.barOffset = CPTDecimalFromFloat(0.0f); // CPTDecimalFromFloat(0.5f); barPlot.barWidth = CPTDecimalFromFloat(0.4f); barPlot.barCornerRadius = 4; barPlot.labelOffset = 5; barPlot.dataSource = self; barPlot.delegate = self; graph = [[CPTXYGraph alloc]initWithFrame:self.view.bounds]; self.hostView.hostedGraph = graph; graph.paddingLeft = 40.0f; graph.paddingTop = 30.0f; graph.paddingRight = 30.0f; graph.paddingBottom = 50.0f; [graph addPlot:barPlot]; graph.plotAreaFrame.masksToBorder = NO; graph.plotAreaFrame.cornerRadius = 0.0f; graph.plotAreaFrame.borderLineStyle = borderLineStyle; double xAxisStart = 0; CPTXYAxisSet *xyAxisSet = (CPTXYAxisSet *)graph.axisSet; CPTXYAxis *xAxis = xyAxisSet.xAxis; CPTMutableLineStyle *lineStyle = [xAxis.axisLineStyle mutableCopy]; lineStyle.lineCap = kCGLineCapButt; xAxis.axisLineStyle = lineStyle; xAxis.majorTickLength = 10; xAxis.orthogonalCoordinateDecimal = CPTDecimalFromDouble(yAxisStart); xAxis.paddingBottom = 5; xyAxisSet.delegate = self; xAxis.delegate = self; xAxis.labelOffset = 0; xAxis.labelingPolicy = CPTAxisLabelingPolicyAutomatic; [plotSpace scaleToFitPlots:[graph allPlots]]; CPTMutablePlotRange *yRange = plotSpace.yRange.mutableCopy; [yRange expandRangeByFactor:CPTDecimalFromDouble(1.3)]; plotSpace.yRange = yRange; NSInteger xLength = CPTDecimalIntegerValue(plotSpace.xRange.length) + 1; plotSpace.xRange = [CPTPlotRange plotRangeWithLocation:CPTDecimalFromDouble(xAxisStart) length:CPTDecimalFromDouble(xLength)] ;

    Read the article

  • Where should I initialize variables for an OO Recursive Descent Parse Tree?

    - by Vasto
    I'd like to preface this by stating that this is for a class, so please don't solve this for me. One of my labs for my cse class is creating an interpreter for a BNF that was provided. I understand most of the concepts, but I'm trying to build up my tree and I'm unsure where to initialize values. I've tried in both the constructor, and in the methods but Eclipse's debugger still only shows the left branch, even though it runs through completely. Here is my main procedure so you can get an idea of how I'm calling the methods. public class Parser { public static void main(String[] args) throws IOException { FileTokenizer instance = FileTokenizer.Instance(); FileTokenizer.main(args); Prog prog = new Prog(); prog.ParseProg(); prog.PrintProg(); prog.ExecProg(); } Now here is My Prog class: public class Prog { private DeclSeq ds; private StmtSeq ss; Prog() { ds = new DeclSeq(); ss = new StmtSeq(); } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) // ds = new DeclSeq(); ds.ParseDS(); instance.skipToken(); //Skips begin (2) // ss = new StmtSeq(); ss.ParseSS(); instance.skipToken(); } I've tried having Prog() { ds = null; ss = null; } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) ds = new DeclSeq(); ds.ParseDS(); ... But it gave me the same error. I need the parse tree built up so I can do a pretty print and an execute command, but like I said, I only get the left branch. Any help would be appreciated. Explanations why are even more so appreciated. Thank you, Vasto

    Read the article

  • ASP.NET Elements are null when assigning data source

    - by deccks
    For some reason, all of the objects in my ASP.NET markup are now null when I try to assign values to their properties in the code behind. My project was going fine and then now when I try to assign a data source to a GridView, I get a null reference error. I have no idea why it's doing this. I am not doing nothing special. I am just trying to assign a value to a property to an asp.net element in on the page. The intellisense knows that the element is there and I get no errors when I build the project. It's just when I am running the website I get the null reference. I have been trying to fix this issue for a couple weeks now. Please Help. Thanks. Here is the code: protected void Page_PreRender(object sender, EventArgs e) { LoadData(); } private void LoadData() { Entities context = new Entities(); var types = (from t in context.CustomerTypes select t).OrderBy(t => t.TypeName); gvCustomerTypes.DataSource = types; gvCustomerTypes.DataBind(); } and on in the markup the gridview looks like this: <asp:GridView ID="gvCustomerTypes" runat="server" ShowHeader="true" GridLines="Both" AutoGenerateColumns="false" AlternatingRowStyle-BackColor="AliceBlue" Width="100%"> <Columns> <asp:TemplateField HeaderText="Customer Type Name" HeaderStyle-HorizontalAlign="Left" ItemStyle-HorizontalAlign="Left"> <ItemTemplate> <asp:Label ID="lblType" runat="server" Text='<%# Eval("TypeName") %>' /> </ItemTemplate> </asp:TemplateField> <asp:TemplateField HeaderText="Edit" HeaderStyle-HorizontalAlign="Center" ItemStyle-HorizontalAlign="Center"> <ItemTemplate> <asp:HyperLink ID="HyperLink1" NavigateUrl='<%#Eval("CustomerTypeID", "CreateEditCustomerType.aspx?ID={0}") %>' Text="Edit" runat="server" /> </ItemTemplate> </asp:TemplateField> <asp:TemplateField HeaderText="Delete" HeaderStyle-HorizontalAlign="Center" ItemStyle-HorizontalAlign="Center"> <ItemTemplate> <asp:LinkButton ID="LinkButton1" CommandName='<%#Eval("CustomerTypeID") %>' OnClientClick="javascript:return confirm('Are you sure you want to delete this Customer Type?');" OnCommand="DeleteCustomerType" Text="Delete" runat="server" /> </ItemTemplate> </asp:TemplateField> </Columns> </asp:GridView>

    Read the article

  • Arbitrary Form Processing with Drupal

    - by Aaron
    I am writing a module for my organization to cache XML feeds to static files to an arbitrary place on our webserver. I am new at Drupal development, and would like to know if I am approaching this the right way. Basically I: Expose a url via the menu hook, where a user can enter in a an output directory on the webserver and press the "dump" button and then have PHP go to drupal and get the feed xml. I don't need help with that functionality, because I actually have a prototype working in Python (outside of Drupal).. Provide a callback for the form where I can do my logic, using the form parameters. Here's the menu hook: function ncbi_cache_files_menu() { $items = array(); $items['admin/content/ncbi_cache_files'] = array( 'title' => 'NCBI Cache File Module', 'description' => 'Cache Guide static content to files', 'page callback' => 'drupal_get_form', 'page arguments' => array( 'ncbi_cache_files_show_submit'), 'access arguments' => array( 'administer site configuration' ), 'type' => MENU_NORMAL_ITEM, ); return $items; } I generate the form in: function ncbi_cache_files_show_submit() { $DEFAULT_OUT = 'http://myorg/foo'; $form[ 'ncbi_cache_files' ] = array( '#type' => 'textfield', '#title' => t('Output Directory'), '#description' => t('Where you want the static files to be dumped. This should be a directory that www has write access to, and should be accessible from the foo server'), '#default_value' => t( $DEFAULT_OUT ), '#size' => strlen( $DEFAULT_OUT ) + 5, ); $form['dump'] = array( '#type' => 'submit', '#value' => 'Dump', '#submit' => array( 'ncbi_cache_files_dump'), ); return system_settings_form( $form ); } Then the functionality is in the callback: function ncbi_cache_files_dump( $p, $q) { //dpm( get_defined_vars() ); $outdir = $p['ncbi_cache_files']['#post']['ncbi_cache_files']; drupal_set_message('outdir: ' . $outdir ); } The question: Is this a decent way of processing an arbitrary form in Drupal? I not really need to listen for any drupal hooks, because I am basically just doing some URL and file processing. What are those arguments that I'm getting in the callback ($q)? That's the form array I guess, with the post values? Is this the best way to get the form parameters to work on? Thanks for any advice.

    Read the article

  • PHP Parse Error unexpected '{'

    - by Laxmidi
    Hi, I'm getting a "Parse error: syntax error, unexpected '{' in line 2". And I don't see the problem. <?php class pointLocation {     var $pointOnVertex = true; // Check if the point sits exactly on one of the vertices     function pointLocation() {     }                   function pointInPolygon($point, $polygon, $pointOnVertex = true) {         $this->pointOnVertex = $pointOnVertex;                  // Transform string coordinates into arrays with x and y values         $point = $this->pointStringToCoordinates($point);         $vertices = array();          foreach ($polygon as $vertex) {             $vertices[] = $this->pointStringToCoordinates($vertex);          }                  // Check if the point sits exactly on a vertex         if ($this->pointOnVertex == true and $this->pointOnVertex($point, $vertices) == true) {             return "vertex";         }                  // Check if the point is inside the polygon or on the boundary         $intersections = 0;          $vertices_count = count($vertices);              for ($i=1; $i < $vertices_count; $i++) {             $vertex1 = $vertices[$i-1];              $vertex2 = $vertices[$i];             if ($vertex1['y'] == $vertex2['y'] and $vertex1['y'] == $point['y'] and $point['x'] > min($vertex1['x'], $vertex2['x']) and $point['x'] < max($vertex1['x'], $vertex2['x'])) { // Check if point is on an horizontal polygon boundary                 return "boundary";             }             if ($point['y'] > min($vertex1['y'], $vertex2['y']) and $point['y'] <= max($vertex1['y'], $vertex2['y']) and $point['x'] <= max($vertex1['x'], $vertex2['x']) and $vertex1['y'] != $vertex2['y']) {                  $xinters = ($point['y'] - $vertex1['y']) * ($vertex2['x'] - $vertex1['x']) / ($vertex2['y'] - $vertex1['y']) + $vertex1['x'];                  if ($xinters == $point['x']) { // Check if point is on the polygon boundary (other than horizontal)                     return "boundary";                 }                 if ($vertex1['x'] == $vertex2['x'] || $point['x'] <= $xinters) {                     $intersections++;                  }             }          }          // If the number of edges we passed through is even, then it's in the polygon.          if ($intersections % 2 != 0) {             return "inside";         } else {             return "outside";         }     }               function pointOnVertex($point, $vertices) {         foreach($vertices as $vertex) {             if ($point == $vertex) {                 return true;             }         }          }                   function pointStringToCoordinates($pointString) {         $coordinates = explode(" ", $pointString);         return array("x" => $coordinates[0], "y" => $coordinates[1]);     }           } $pointLocation = new pointLocation(); $points = array("30 19", "0 0", "10 0", "30 20", "11 0", "0 11", "0 10", "30 22", "20 20"); $polygon = array("10 0", "20 0", "30 10", "30 20", "20 30", "10 30", "0 20", "0 10", "10 0"); foreach($points as $key => $point) { echo "$key ($point) is " . $pointLocation->pointInPolygon($point, $polygon) . "<br>"; } ?> Does anyone see the problem? Thanks, -Laxmidi

    Read the article

  • Methodology for a Rails app

    - by Aaron Vegh
    I'm undertaking a rather large conversion from a legacy database-driven Windows app to a Rails app. Because of the large number of forms and database tables involved, I want to make sure I've got the right methodology before getting too far. My chief concern is minimizing the amount of code I have to write. There are many models that interact together, and I want to make sure I'm using them correctly. Here's a simplified set of models: class Patient < ActiveRecord::Base has_many :PatientAddresses has_many :PatientFileStatuses end class PatientAddress < ActiveRecord::Base belongs_to :Patient end class PatientFileStatus < ActiveRecord::Base belongs_to :Patient end The controller determines if there's a Patient selected; everything else is based on that. In the view, I will be needing data from each of these models. But it seems like I have to write an instance variable in my controller for every attribute that I want to use. So I start writing code like this: @patient = Patient.find(session[:patient]) @patient_addresses = @patient.PatientAddresses @patient_file_statuses = @patient.PatientFileStatuses @enrollment_received_when = @patient_file_statuses[0].EnrollmentReceivedWhen @consent_received = @patient_file_statuses[0].ConsentReceived @consent_received_when = @patient_file_statuses[0].ConsentReceivedWhen The first three lines grab the Patient model and its relations. The next three lines are examples of my providing values to the view from one of those relations. The view has a combination of text fields and select fields to show the data above. For example: <%= select("patientfilestatus", "ConsentReceived", {"val1"="val1", "val2"="val2", "Written"="Written"}, :include_blank=true )% <%= calendar_date_select_tag "patient_file_statuses[EnrollmentReceivedWhen]", @enrollment_complete_when, :popup=:force % (BTW, the select tag isn't really working; I think I have to use collection_select?) My questions are: Do I have to manually declare the value of every instance variable in the controller, or can/should I do it within the view? What is the proper technique for displaying a select tag for data that's not the primary model? When I go to save changes to this form, will I have to manually pick out the attributes for each model and save them individually? Or is there a way to name the fields such that ActiveRecord does the right thing? Thanks in advance, Aaron.

    Read the article

  • [C#] Problems with implementing generic IEnumerator and IComparable

    - by r0h
    Hi all! I'm working on an AVL Tree. The tree itself seems to be working but I need a iterator to walk through the values of the tree. Therefore I tried to implement the IEnumerator interace. Unfortunately I get a compile time error implementing IEnumerator and IComparable. First the code and below that the error. class AvlTreePreOrderEnumerator<T> : IEnumerator<T> where T :IComparable<T> { private AvlTreeNode<T> current = default(T); private AvlTreeNode<T> tree = null; private Queue<AvlTreeNode<T>> traverseQueue = null; public AvlTreePreOrderEnumerator(AvlTreeNode<T> tree) { this.tree = tree; //Build queue traverseQueue = new Queue<AvlTreeNode<T>>(); visitNode(this.tree.Root); } private void visitNode(AvlTreeNode<T> node) { if (node == null) return; else { traverseQueue.Enqueue(node); visitNode(node.LeftChild); visitNode(node.RightChild); } } public T Current { get { return current.Value; } } object IEnumerator.Current { get { return Current; } } public void Dispose() { current = null; tree = null; } public void Reset() { current = null; } public bool MoveNext() { if (traverseQueue.Count > 0) current = traverseQueue.Dequeue(); else current = null; return (current != null); } } The error given by VS2008: Error 1 The type 'T' cannot be used as type parameter 'T' in the generic type or method 'Opdr2_AvlTreeTest_Final.AvlTreeNode'. There is no boxing conversion or type parameter conversion from 'T' to 'System.IComparable'. For now I've not included the tree and node logic. I anybody thinks is necessary to resolve this probleem, just say so! Thx!

    Read the article

  • sed - trying to replace first occurrence after a match

    - by wakkaluba
    I am facing a situation that drives me nuts. I am setting up an update server which uses a json file. Don't ask why or how, it sucks and is my only possibility to achieve it. I have been trying and researching for HOURS (many) because I went ballistic and wanted to crack this on my own. But I have to realize I got stuck and need help. So sorry for this chunk but I think it is somewhat important to see... The file is a one liner and repeating the following sequence with changing values (of course). "plugin_name_foo_bar": {"buildDate": "bla", "dependencies": [{"name": "bla", "optional": true, "version": "1.00"}], "developers": [{"developerId": "bla", "email": "[email protected]", "name": "Bla bla2nd"}], "excerpt": "some text {excerpt} !bla.png|thumbnail,border=1! ", "gav": "bla", "labels": ["report", "scm-related"], "name": "plugin_name_foo_bar", "previousTimestamp": "bla", "previousVersion": "1.0", "releaseTimestamp": "bla", "requiredCore": "1", "scm": "github.com", "sha1": "ynnBM2jWo25ZLDdP3ybBOnV/Pio=", "title": "bla", "url": "http://bla.org", "version": "1.0", "wiki": "https://bla.org"}, "Exclusion": {"buildDate": "bla", "dependencies": [], and the next plugin block is glued straight afterwards. What I now want to do is to search for "plugin_foo_bar": {" as this is the unique identifier for a new plugin description block. I want to replace the first sha1 value occuring afterwards. That's where I keep failing. I always grab the first,last or any occurrence in the entire file and not the block :( "title" is the unique identifier after the sha1 value. So I tried to make the .* less greedy but it ain't working out. last attempt was heading towards: sed -i 's/("name": "plugin_name_foo_bar.*sha1": ")([a-zA-Z0-9!@#\$%^&*()\[\]]*)(", "title"\)/\1blablabla\2/1' default.json to find the sha1 value of that plugin but still no joy. I hope someone knows - preferably a simpler approach - before I now continue with trial and error until I have to puke and freakout. I am working with SED on Windows, so Unix approach might help me to figure out how to achieve this in batch but please make it as one-liner if possible. Scripts are a real pain to convert. And I just need SED and no other solution with other tools like AWK. That is absolutely out of discussion. Any help is appreciated :) Cheers Jan

    Read the article

  • UCA + Natural Sorting

    - by Alix Axel
    I recently learnt that PHP already supports the Unicode Collation Algorithm via the intl extension: $array = array ( 'al', 'be', 'Alpha', 'Beta', 'Álpha', 'Àlpha', 'Älpha', '????', 'img10.png', 'img12.png', 'img1.png', 'img2.png', ); if (extension_loaded('intl') === true) { collator_asort(collator_create('root'), $array); } Array ( [0] => al [2] => Alpha [4] => Álpha [5] => Àlpha [6] => Älpha [1] => be [3] => Beta [11] => img1.png [9] => img10.png [8] => img12.png [10] => img2.png [7] => ???? ) As you can see this seems to work perfectly, even with mixed case strings! The only drawback I've encountered so far is that there is no support for natural sorting and I'm wondering what would be the best way to work around that, so that I can merge the best of the two worlds. I've tried to specify the Collator::SORT_NUMERIC sort flag but the result is way messier: collator_asort(collator_create('root'), $array, Collator::SORT_NUMERIC); Array ( [8] => img12.png [7] => ???? [9] => img10.png [10] => img2.png [11] => img1.png [6] => Älpha [5] => Àlpha [1] => be [2] => Alpha [3] => Beta [4] => Álpha [0] => al ) However, if I run the same test with only the img*.png values I get the ideal output: Array ( [3] => img1.png [2] => img2.png [1] => img10.png [0] => img12.png ) Can anyone think of a way to preserve the Unicode sorting while adding natural sorting capabilities?

    Read the article

  • How to reduce redundant code when adding new c++0x rvalue reference operator overloads

    - by Inverse
    I am adding new operator overloads to take advantage of c++0x rvalue references, and I feel like I'm producing a lot of redundant code. I have a class, tree, that holds a tree of algebraic operations on double values. Here is an example use case: tree x = 1.23; tree y = 8.19; tree z = (x + y)/67.31 - 3.15*y; ... std::cout << z; // prints "(1.23 + 8.19)/67.31 - 3.15*8.19" For each binary operation (like plus), each side can be either an lvalue tree, rvalue tree, or double. This results in 8 overloads for each binary operation: // core rvalue overloads for plus: tree operator +(const tree& a, const tree& b); tree operator +(const tree& a, tree&& b); tree operator +(tree&& a, const tree& b); tree operator +(tree&& a, tree&& b); // cast and forward cases: tree operator +(const tree& a, double b) { return a + tree(b); } tree operator +(double a, const tree& b) { return tree(a) + b; } tree operator +(tree&& a, double b) { return std::move(a) + tree(b); } tree operator +(double a, tree&& b) { return tree(a) + std::move(b); } // 8 more overloads for minus // 8 more overloads for multiply // 8 more overloads for divide // etc which also has to be repeated in a way for each binary operation (minus, multiply, divide, etc). As you can see, there are really only 4 functions I actually need to write; the other 4 can cast and forward to the core cases. Do you have any suggestions for reducing the size of this code? PS: The class is actually more complex than just a tree of doubles. Reducing copies does dramatically improve performance of my project. So, the rvalue overloads are worthwhile for me, even with the extra code. I have a suspicion that there might be a way to template away the "cast and forward" cases above, but I can't seem to think of anything.

    Read the article

  • Multi-tier applications using L2S, WCF and Base Class

    - by Gena Verdel
    Hi all. One day I decided to build this nice multi-tier application using L2S and WCF. The simplified model is : DataBase-L2S-Wrapper(DTO)-Client Application. The communication between Client and Database is achieved by using Data Transfer Objects which contain entity objects as their properties. abstract public class BaseObject { public virtual IccSystem.iccObjectTypes ObjectICC_Type { get { return IccSystem.iccObjectTypes.unknownType; } } [global::System.Data.Linq.Mapping.ColumnAttribute(Storage = "_ID", AutoSync = AutoSync.OnInsert, DbType = "BigInt NOT NULL IDENTITY", IsPrimaryKey = true, IsDbGenerated = true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order = 1)] public virtual long ID { //get; //set; get { return _ID; } set { _ID = value; } } } [DataContract] public class BaseObjectWrapper<T> where T : BaseObject { #region Fields private T _DBObject; #endregion #region Properties [DataMember] public T Entity { get { return _DBObject; } set { _DBObject = value; } } #endregion } Pretty simple, isn't it?. Here's the catch. Each one of the mapped classes contains ID property itself so I decided to override it like this [global::System.Data.Linq.Mapping.TableAttribute(Name="dbo.Divisions")] [global::System.Runtime.Serialization.DataContractAttribute()] public partial class Division : INotifyPropertyChanging, INotifyPropertyChanged { [global::System.Data.Linq.Mapping.ColumnAttribute(Storage="_ID", AutoSync=AutoSync.OnInsert, DbType="BigInt NOT NULL IDENTITY", IsPrimaryKey=true, IsDbGenerated=true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order=1)] public override long ID { get { return this._ID; } set { if ((this._ID != value)) { this.OnIDChanging(value); this.SendPropertyChanging(); this._ID = value; this.SendPropertyChanged("ID"); this.OnIDChanged(); } } } } Wrapper for division is pretty straightforward as well: public class DivisionWrapper : BaseObjectWrapper<Division> { } It worked pretty well as long as I kept ID values at mapped class and its BaseObject class the same(that's not very good approach, I know, but still) but then this happened: private CentralDC _dc; public bool UpdateDivision(ref DivisionWrapper division) { DivisionWrapper tempWrapper = division; if (division.Entity == null) { return false; } try { Table<Division> table = _dc.Divisions; var q = table.Where(o => o.ID == tempWrapper.Entity.ID); if (q.Count() == 0) { division.Entity._errorMessage = "Unable to locate entity with id " + division.Entity.ID.ToString(); return false; } var realEntity = q.First(); realEntity = division.Entity; _dc.SubmitChanges(); return true; } catch (Exception ex) { division.Entity._errorMessage = ex.Message; return false; } } When trying to enumerate over the in-memory query the following exception occurred: Class member BaseObject.ID is unmapped. Although I'm stating the type and overriding the ID property L2S fails to work. Any suggestions?

    Read the article

  • PHP - error when insert date into MySQL

    - by Michael Mao
    Hello everyone: I've got a typical problem when trying to insert a date into MySQL. The column defined in MySQL is of type DATE. My PHP version is 5.3.0 Apart from this date-related issue, the rest of my code works just fine. And this is my PHP script to do this: $tablename = BOOKS_TABLE; $insert = mysql_query("INSERT INTO $tablename (barcode, book_name, volume_num,". " author, publisher, item_type, buy_price, buy_date) VALUES ". "(". "'" . $barcode . "', ". "'" . $bookname . "', ". "'" . $volumenum . "', ". "'" . $author . "', ". "'" . $publisher . "', ". "'" . $itemtype . "', ". "'" . $buyprice . "', ". "'" . getMySQLDateString($buydate). //"'STR_TO_DATE('".$buydate ."', '%d/%m/%Y'))'". //nothing changes in MySQL ")"); And this is the faulty function : function getMySQLDateString($buydate) //typical buydate : 04/21/2009 { $mysqlDateString = date('Y-m-d H:i:s', $strtotime($buydate)); return $mysqlDateString; } The first commented out line wouldn't do anything, the script is executed with no error, however, there is nothing changed in datebase after this. The current approach will cause a Fatal error saying function name must be a string in this line. Actually I followed this thread on SO, but just cannot pass the date into MySQL... Can anyone help me figure out which part is not right? How would you do it, in this case, to get it right? Sorry about such a journeyman-like question, thanks a lot in advance.

    Read the article

  • Passing password value through URL

    - by Steven Wright
    OK I see a lot of people asking about passing other values, URLS, random stuff through a URL, but don't find anything about sending a password to a password field. Here is my situation: I have a ton of sites I use on a daily basis with my work and oh about 90% require logins. Obviously remembering 80 bajillion logins for each site is dumb, especially when there are more than one user name I use for each site. So to make life easier, I drew up a nifty JSP app that stores all of my logins in a DB table and creates a user interface for the specific page I want to visit. Each page has a button that sends a username, password into the id parameters of the html inputs. Problem: I can get the usernames and other info to show up just dandy, but when I try and send a password to a password field, it seems that nothing gets received by the page I'm trying to hit. Is there some ninja stuff I need to be doing here or is it just not easily possible? Basically this is what I do now: http://addresshere/support?loginname=steveoooo&loginpass=passwordhere and some of my html looks like this: <form name="userform" method="post" action="index.jsp" > <input type="hidden" name="submit_login" value="y"> <table width="100%"> <tr class="main"> <td width="100" nowrap>Username:</td> <td><input type="text" name="loginname" value="" size="30" maxlength="64"></td> </tr> <tr class="main"> <td>Password: </font></td> <td><input type="password" name="loginpass" value="" size="30" maxlength="64"></td> </tr> <tr class="main"> <td><center><input type="submit" name="submit" value="Login"></center></td> </tr> </table> </form> Any suggestions?

    Read the article

  • Linking two models in a multi-model form

    - by Elliot
    Hey Guys, I have a nested multimodel form right now, using Users and Profiles. Users has_one profile, and Profile belongs_to Users. When the form is submitted, a new user is created, and a new profile is created, but they are not linked (this is the first obvious issue). The user's model has a profile_id row, and the profile's model has a user_id row. Here is the code for the form: <%= form_for(@user, :url => teams_path) do |f| %> <p><%= f.label :email %><br /> <%= f.text_field :email %></p> <p><%= f.label :password %><br /> <%= f.password_field :password %></p> <p><%= f.label :password_confirmation %><br /> <%= f.password_field :password_confirmation %></p> <%= f.hidden_field :role_id, :value => @role.id %></p> <%= f.hidden_field :company_id, :value => current_user.company_id %></p> <%= fields_for @user.profile do |profile_fields| %> <div class="field"> <%= profile_fields.label :first_name %><br /> <%= profile_fields.text_field :first_name %> </div> <div class="field"> <%= profile_fields.label :last_name %><br /> <%= profile_fields.text_field :last_name %> </div> <% end %> <p><%= f.submit "Sign up" %></p> <% end %> A second issue, is even though the username, and password are successfully created through the form for the user model, the hidden fields (role_id & company_id - which are also links to other models) are not created (even though they are part of the model) - the values are successfully shown in the HTML for those fields however. Any help would be great!

    Read the article

  • Linux, GNU GCC, ld, version scripts and the ELF binary format -- How does it work??

    - by themoondothshine
    Hey all, I'm trying to learn more about library versioning in Linux and how to put it all to work. Here's the context: -- I have two versions of a dynamic library which expose the same set of interfaces, say libsome1.so and libsome2.so. -- An application is linked against libsome1.so. -- This application uses libdl.so to dynamically load another module, say libmagic.so. -- Now libmagic.so is linked against libsome2.so. Obviously, without using linker scripts to hide symbols in libmagic.so, at run-time all calls to interfaces in libsome2.so are resolved to libsome1.so. This can be confirmed by checking the value returned by libVersion() against the value of the macro LIB_VERSION. -- So I try next to compile and link libmagic.so with a linker script which hides all symbols except 3 which are defined in libmagic.so and are exported by it. This works... Or at least libVersion() and LIB_VERSION values match (and it reports version 2 not 1). -- However, when some data structures are serialized to disk, I noticed some corruption. In the application's directory if I delete libsome1.so and create a soft link in its place to point to libsome2.so, everything works as expected and the same corruption does not happen. I can't help but think that this may be caused due to some conflict in the run-time linker's resolution of symbols. I've tried many things, like trying to link libsome2.so so that all symbols are alised to symbol@@VER_2 (which I am still confused about because the command nm -CD libsome2.so still lists symbols as symbol and not symbol@@VER_2)... Nothing seems to work!!! Help!!!!!! Edit: I should have mentioned it earlier, but the app in question is Firefox, and libsome1.so is libsqlite3.so shipped with it. I don't quite have the option of recompiling them. Also, using version scripts to hide symbols seems to be the only solution right now. So what really happens when symbols are hidden? Do they become 'local' to the SO? Does rtld have no knowledge of their existence? What happens when an exported function refers to a hidden symbol?

    Read the article

  • CTE Join query issues

    - by Lee_McIntosh
    Hi everyone, this problem has me head going round in circles at the moment and i wondering if anyone could give any pointers as to where im going wrong. Im trying to produce a SPROC that produces a dataset to be called by SSRS for graphs spanning the last 6 months. The data for example purposes uses three tables (theres more but the it wont change the issue at hand) and are as follows: tbl_ReportList: Report Site ---------------- North abc North def East bbb East ccc East ddd South poa South pob South poc South pod West xyz tbl_TicketsRaisedThisMonth: Date Site Type NoOfTickets --------------------------------------------------------- 2010-07-01 00:00:00.000 abc Support 101 2010-07-01 00:00:00.000 abc Complaint 21 2010-07-01 00:00:00.000 def Support 6 ... 2010-12-01 00:00:00.000 abc Support 93 2010-12-01 00:00:00.000 xyz Support 5 tbl_FeedBackRequests: Date Site NoOfFeedBackR ---------------------------------------------------------------- 2010-07-01 00:00:00.000 abc 101 2010-07-01 00:00:00.000 def 11 ... 2010-12-01 00:00:00.000 abc 63 2010-12-01 00:00:00.000 xyz 4 I'm using CTE's to simplify the code, which is as follows: DECLARE @ReportName VarChar(200) SET @ReportName = 'North'; WITH TicketsRaisedThisMonth AS ( SELECT [Date], Site, SUM(NoOfTickets) AS NoOfTickets FROM tbl_TicketsRaisedThisMonth WHERE [Date] >= DATEADD(mm, DATEDIFF(m,0,GETDATE())-6,0) GROUP BY [Date], Site ), FeedBackRequests AS ( SELECT [Date], Site, SUM(NoOfFeedBackR) AS NoOfFeedBackR FROM tbl_FeedBackRequests WHERE [Date] >= DATEADD(mm, DATEDIFF(m,0,GETDATE())-6,0) GROUP BY [Date], Site ), SELECT trtm.[Date] SUM(trtm.NoOfTickets) AS NoOfTickets, SUM(fbr.NoOfFeedBackR) AS NoOfFeedBackR, FROM Reports rpts LEFT OUTER JOIN TotalIncidentsDuringMonth trtm ON rpts.Site = trtm.Site LEFT OUTER JOIN LoggedComplaints fbr ON rpts.Site = fbr.Site WHERE rpts.report = @ReportName GROUP BY trtm.[Date] And the output when the sproc is pass a parameter such as 'North' to be as follows: Date NoOfTickets NoOfFeedBackR ----------------------------------------------------------------------------------- 2010-07-01 00:00:00.000 128 112 2010-08-01 00:00:00.000 <data for that month> <data for that month> 2010-09-01 00:00:00.000 <data for that month> <data for that month> 2010-10-01 00:00:00.000 <data for that month> <data for that month> 2010-11-01 00:00:00.000 <data for that month> <data for that month> 2010-12-01 00:00:00.000 122 63 The issue I'm having is that when i execute the query I'm given a repeated list of values of each month, such as 128 will repeat 6 times then another value for the next months value repeated 6 times, etc. argh!

    Read the article

  • How do I write sql data into a textbox after a submit type event

    - by Matt
    Finishing up some homework and Im having trouble with figuring out how to take information generated in sql column(a primary key set up to assign a record number to a customer example 1046) at submit and writing it to my redirected recipt page. I call it recipt.aspx. Any takers Professor says to use a datareader...but things go bad after that. public partial class _Default : System.Web.UI.Page { String cnStr = "EDITED FOR THE PURPOSE OF NOT DISPLAYED SQL SERVERta Source=111.11.111.11; uid=xxxxxxx; password=xxxx; database=xxxxxx; "; String insertStr; SqlDataReader reader; SqlConnection myConnection = new SqlConnection(); protected void submitbutton_Click(object sender, EventArgs e) { myConnection.ConnectionString = cnStr; try { //more magic happens as myConnection opens myConnection.Open(); insertStr = "insert into connectAssignment values ('" + TextBox2.Text + "','" + TextBox3.Text + "','" + TextBox4.Text + "','" + TextBox5.Text + "','" + bigtextthing.Text + "','" + DropDownList1.SelectedItem.Value + "')"; //magic happens as Connection string is assigned to connection object and passes in the SQL statment //associate the command to the the myConnection connection object SqlCommand cmd = new SqlCommand(insertStr, myConnection); cmd.ExecuteNonQuery(); Session["passmyvalue1"] = TextBox2.Text; Session["passmyvalue2"] = TextBox3.Text; Session["passmyvalue3"] = TextBox4.Text; Session["passmyvalue4"] = TextBox5.Text; Session["passmyvalue5"] = bigtextthing.Text; Session["I NEED SOME HELP RIGHT HERE"] =Textbox6.Text; Response.Redirect("receipt.aspx"); } catch { bigtextthing.Text = "Error submitting" + "Possible casues: Internet is down,server is down, check your settings!"; } finally { myConnection.Close(); TextBox2.Text = ""; TextBox3.Text = ""; TextBox4.Text = ""; TextBox5.Text = ""; bigtextthing.Text = ""; } //reset validators? } The recipt page public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { if(Session["passmyvalue1"] != null) { TextBox1.Text = (string)Session["passmyvalue1"]; TextBox2.Text = (string)Session["passmyvalue2"]; TextBox3.Text = (string)Session["passmyvalue3"]; TextBox4.Text = (string)Session["passmyvalue4"]; TextBox5.Text = (string)Session["passmyvalue5"]; TextBox6.Text = I don't know ; } } } THanks for the help

    Read the article

< Previous Page | 666 667 668 669 670 671 672 673 674 675 676 677  | Next Page >