Search Results

Search found 61986 results on 2480 pages for 'launch time'.

Page 673/2480 | < Previous Page | 669 670 671 672 673 674 675 676 677 678 679 680  | Next Page >

  • how to order a group result with Linq?

    - by Aaron
    How can I order the results from "group ... by... into..." statement in linq? For instance: var queryResult = from records in container.tableWhatever where records.Time >= DateTime.Today group records by tableWhatever.tableHeader.UserId into userRecords select new { UserID = userRecords.Key, Records = userRecords }; The query returns records in table "contain.tableWhatever" grouped by "UserId". I want the returned results within each group ordered by time decending. How can I do that? More specific, assume the above query return only one group like the following: {UserID = 1, Records= {name1 5/3/2010_7:10pm; name2 5/3/2010_8:10pm; name3 5/3/2010_9:10pm} } After insert the orderby statement in the above query, the returned results should be like this: {UserID = 1, Records= {name3 5/3/2010_9:10pm; name2 5/3/2010_8:10pm; name1 5/3/2010_7:10pm} } Thanks for help!

    Read the article

  • Remove items from SWT tables

    - by Dima
    This is more of an answer I'd like to share for the problem I was chasing for some time in RCP application using large SWT tables. The problem is the performance of SWT Table.remove(int start, int end) method. It gives really bad performance - about 50msec per 100 items on my Windows XP. But the real show stopper was on Vista and Windows 7, where deleting 100 items would take up to 5 seconds! Looking into the source code of the Table shows that there are huge amount of windowing events flying around in this call.. That brings the windowing system to its knees. The solution was to hide the damn thing during this call: table.setVisible(false); table.remove(from, to); table.setVisible(true); That does wonders - deleting 500 items on both XP & Windows7 takes ~15msec, which is just an overhead for printing out time stamps I used. nice :)

    Read the article

  • Parallel Task In C#.net

    - by Test123
    I have C#.net application. I wanted to run my application In Thread. But because of third party dll it dont allow to use application in multiThread. There is one object in thrid party dll ,which only allow to create instance at one time only. When i manually run application exe instnace multiple time & process my data it process successfully..(might because of each exe run with its application domain) Same thing i require to implement from C# code. for that i have created dll which can accessible by Type.GetTypeFromProgID()..but multiple dll instnace creating same problem. Is there any way i could achive manual parallelism through code to process same exe code in multiple application domain?

    Read the article

  • Which has been the most reliable, fastest Windows C++ profiler that you have used?

    - by carleeto
    I need to profile a real time C++ app on Windows. Most of the available profilers are either terribly expensive, total overkill, or both. I don't need any .NET stuff. Since it is a real time app, I need the profiler to be as fast as possible. It would be excellent if it integrated in some way with Visual Studio 2005/2008, but that's not necessary. If this description reminds you of a profiler that you have used, I would really like to know about it. I am hoping to draw from people's use of C++ profilers on Windows to pinpoint one that will do the job. Thanks.

    Read the article

  • How do I make a class whose interface matches double, but upon which templates can be specialized?

    - by Neil G
    How do I make a class whose interface matches double, but whose templated types do not dynamic cast to double? The reason is that I have a run-time type system, and I want to be able to have a type that works just like double: template<int min_value, int max_value> class BoundedDouble: public double {}; And then inherit use template specialization to get run-time information about that type: template<typename T> class Type { etc. } template<int min_value, int max_value> class Type<BoundedDouble<min_value, max_value>> { int min() const { return min_value; } etc. } But, you can't inherit from double...

    Read the article

  • What's the proper way of importing option lists into an Android app?

    - by Scott
    I have been storing option lists for my Android app in a cloud table. For example, categories like "historical fiction","biography","science fiction", etc. I see the following pros and cons: Pro: I can make changes to the list without sending an app update to Google Play Not normalized - I can use the text in my other data tables instead of a reference ID Con: App needs to take time to download from the web each time (or at least check for changes) English only I believe the "proper" way to do this is the use the XML resource files. But I need to make sure the selection references correctly with my data. That is, my app needs to understand that "Poetry" and "Poesía" are the same thing. Is the correct thing to do: Forget about it since I'll never get to the point where I'm translating my app anyway Use a string-array and use the index (0...x) to know what the selection is Use a 2-dimensional string-array with a reference ID in the first column and the text in the second?

    Read the article

  • How and when to log account access login with PHP?

    - by Nazgulled
    I want to implement a basic login system in some PHP app where no cookies will be involved. I mean, the user closes the browser and the login expires, it will remain active during the browser session (or if the user explicitly logs out) otherwise. I want to log all this activity and I'm thinking that every time the user refreshes the page, opens a different link or logs out, I record that time as the last access made by that user, overwriting the previous access log. But my problem is when and how should I insert another record into the database instead of overwriting the last one? Should I just define a timeout and if the last access was made above that timeout, another log should be inserted into the database? Should the session expire too after that timeout? Or is there a better way? Ideally, I would like to log the "log out action" when the browser was closed, but I don't think there's a way to detect that is there? Suggestions?

    Read the article

  • Scoping in embedded groovy scripts

    - by Aaron Digulla
    In my app, I use Groovy as a scripting language. To make things easier for my customers, I have a global scope where I define helper classes and constants. Currently, I need to run the script (which builds the global scope) every time a user script is executed: context = setupGroovy(); runScript( context, "global.groovy" ); // Can I avoid doing this step every time? runScript( context, "user.groovy" ); Is there a way to setup this global scope once and just tell the embedded script interpreter: "Look here if you can't find a variable"? That way, I could run the global script once. Note: Security is not an issue here but if you know a way to make sure the user can't modify the global scope, that's an additional plus.

    Read the article

  • Is ReaderWriterLockSlim.EnterUpgradeableReadLock() essentially the same as Monitor.Enter()?

    - by Neil Barnwell
    So I have a situation where I may have many, many reads and only the occasional write to a resource shared between multiple threads. A long time ago I read about ReaderWriterLock, and have read about ReaderWriterGate which attempts to mitigate the issue where many writes coming in trump reads and hurt performance. However, now I've become aware of ReaderWriterLockSlim... From the docs, I believe that there can only be one thread in "upgradeable mode" at any one time. In a situation where the only access I'm using is EnterUpgradeableReadLock() (which is appropriate for my scenario) then is there much difference to just sticking with lock(){}? Here's the excerpt: A thread that tries to enter upgradeable mode blocks if there is already a thread in upgradeable mode, if there are threads waiting to enter write mode, or if there is a single thread in write mode. Or, does the recursion policy make any difference to this?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Where is the best place to run initialization code for a UITabBarController?

    - by bobobobo
    I have a UITabBarController in my application. I have to perform some customization to the NIB file using code the first time a view embedded in that UITabBarController gets loaded. When applicationDidFinishLaunching occurs, the UITabBarController's views apparently are not loaded -- if I try to modify the view controllers inside a tab bar that the tab bar is to load in applicationDidFinishLaunching, then those changes are ignored. I'm assuming this is because the tab bar didn't finish loading yet. So, I need a good place to put code that will run immediately after a tabbar is fully ready -- i.e. after it has loaded all the views from their respective nib files. I'm finding the only place I can do this is to track the first time viewDidAppear on each individual view controller. Note I can't use viewWillAppear because I need the value of tabBarController.selectedIndex to be accurate, and it is only actually updated after viewDidAppear gets fired, not when viewWillAppear gets fired.

    Read the article

  • Mac OS X 10.5+ and POSIX

    - by Phil
    Hello, I need to program an authentication module that has to work with Mac OS X 10.6 Snow Leopard and at the same time needs to be POSIX-compliant. I read here: developer.apple.com/leopard/overview/osfoundations.html that since Mac OS X 10.5 Leopard, Mac OS X is POSIX-compliant (to POSIX 1003.1), but working under MAC OS X 10.5 Leopard myself, I can't find any trace of my user name neither in /etc/passwd nor in its successor /etc/master.passwd, which is mentioned here: developer.apple.com/mac/library/DOCUMENTATION/Darwin/Reference/ManPages/man5/passwd.5.html Instead it says in both files OpenDirectory Service is used, which should be OpenLDAP according to the OpenDirectoryService man-page. Is this still POSIX-compliant ? I guess not. I wonder how Mac OS X would handle my 100% POSIX-compliant code which depends on /etc/passwd ? I would be gratefull if someone could explain the way this works to me. Thank you for your time and trouble. Best regards Phil.

    Read the article

  • prevent race condition without using locks C++

    - by Hristo
    How do I prevent a race condition with locking or using mutexes/semaphors in C++? I'm dealing with a nested for loop in which I will be setting a value in an array: for (int i = 0; i < m; ++i) for (int j = 0; j < n; ++j) for (int k = 0; k < o; ++k) array[k] += foo(...); More or less, I want to deal with this so that I can ensure different threads running at the same time don't write to array[k] at the same time. Any suggestions on how to approach this? Thanks, Hristo

    Read the article

  • Sending bulk notification emails without blocking

    - by FreshCode
    For my client's custom-built CRM, I want users (technicians) to be notified of changes to marked cases via email. This warrants a simple subscription mapping table between users and cases and automated emails to be sent every time a change is made to a case from within the logging method. How do I send 10-100 emails to subscribed users without bogging down my logging method? My SMTP server is on a peer on my LAN, so sends should be quick, but ideally this should be handled by an external queuing process. I can have a cron job send any outstanding emails every 10 minutes, but for this specific client cases are quite time-sensitive and instant notification (as instant as email can be) would be great. How can I send bulk notification emails from within ASP.NET MVC without bogging down my logging method?

    Read the article

  • The case against Maven?

    - by Asgeir S. Nilsen
    Time and time again I've read and heard people frustrated over Maven and how complicated it is. And that it's much easier to use Ant to build code. However, in order to: Compile code Run tests Package a deployable unit This is all you need from Maven: <project> <modelVersion>4.0.0</modelVersion> <groupId>type something here</groupId> <artifactId>type something here</artifactId> <version>type something here</version> </project> What would be the corresponding minimal Ant build file?

    Read the article

  • Marker on Google Map added only once.

    - by Vafello
    I have the following code: function clicked(overlay, latlng) { var icon3 = new GIcon(); icon3.image = "marker.png"; icon3.iconAnchor = new GPoint(15, 40); var marker2 = new GMarker(latlng, { icon: icon3, draggable: true, title: 'Drag me' }); map.addOverlay(marker2); } Each time I click on the map a new marker is placed on the map. The problem is that I need only one marker and if I click several times, each time a new marker is added. How to change the code so only one marker is placed and when the map is clicked again it just changes its location?

    Read the article

  • Getting Started with Fluent NHibernate

    - by Andy
    I'm trying to get into using Fluent NHibernate, and I have a couple questions. I'm finding the documentation to be lacking. I understand that Fluent NHibernate / NHibernate allows you to auto-generate a database schema. Do people usually only do this for Test/Dev databases? Or is that OK to do for a production database? If it's ok for production, how do you make sure that you're not blowing away production data every time you run your app? Once the database schema is already created, and you have production data, when new tables/columns/etc. need to be added to the Test and/or Production database, do people allow NHibernate to do this, or should this be done manually? Is there any REALLY GOOD documentation on Fluent NHibernate? (Please don't point me to the wiki because in following along with the "Your first project" code building it myself, I was getting run-time errors because they forget to tell you to add a reference. Not cool.) Thanks, Andy

    Read the article

  • How do I safely destroy a dialog window of a wxPython application?

    - by Akira
    I created a wxPython application which shows some messages on a dialog window. The dialog window is needed to be force-destroyed by the application before I click the dialog OK button. I used wx.lib.delayedresult to make the destroy call. My code is: import wx dlg=wx.MessageDialog(somewindow,'somemessage') from wx.lib.delayedresult import startWorker def _c(d): dlg.EndModal(0) dlg.Destroy() def _w(): import time time.sleep(1.0) startWorker(_c,_w) dlg.ShowModal() This can do what I desire to do while I got a error message below: (python:15150): Gtk-CRITICAL **: gtk_widget_destroy: assertion `GTK_IS_WIDGET (widget)' failed How do I "safely" destroy a dialog without clicking the dialog button?

    Read the article

  • [JavaScript] Loading Google Maps API after the page is displayed

    - by Goro
    Hello, My landing page contains a big google maps portion, which slows down the loading time. I am trying to do the following: Load the static elements first so the page loads fast initially. Display a loading notification in the map placeholder so that the user knows that the map is coming up Load and display the map I have done this: $(document).ready(function() { map_initialize(); } map_initialize() being the function which loads the map into its container div. However, this still will not display the static elements fist. The page will wait until the map_initialize() is finished, then load the static elements at the same time as the map. Thanks,

    Read the article

  • Implementing a multi-state planner

    - by MoominTroll
    I've been asked to develop a system wherein employees can mark on a form their availability on a given day of the week - for instance an employee could mark themselves as available on a given time on a given week, and unavailable on some other time. It looks a little like this: Currently this works by rendering checkboxes within the table, picking up click events in each cell and marking the checkbox and hence the cell appropriately. I'm using the JQuery "click n drag checkbox" plugin from here. However, I've been informed that there could well be more than two states for a given cell (for instance available, unavailable, available in a given circumstance), in which case binding to a checkboxes checked value isnt going to be a lot of help. I've never used javascript or asp.net before and am unsure as to the best way to approach this problem. Ideally I could stick a data structure behind each cell which I could update to a certain state and then get my cell colour by binding to this - however I'm at something as a loss as how to best achieve this.

    Read the article

  • How can I try a new language or framework without installing it?

    - by flamingLogos
    With so many languages and frameworks that exist, and with new ones appearing all the time, I don't have the time to download, install, and configure each one to evaluate it. In the past I've run across webapps that allow one to write or paste code into a window, and see the results in realtime in the browser, usually in a tutorial setting. What are your favorite sandbox sites for a given technology? Edit: @fretj provided the link to the excellent Google Code Playground (+1 upvote), but I thought that it was just for experimenting with Google's own apps (Search, Maps, Earth, Language, etc). But it turns out that it contains a few hidden gems: In addition to their apps, you can try out the many Javascript libraries that they host including jQuery, jQuery UI, MooTools, Dojo, and Prototype Scriptaculous. They're all hidden under the Libraries category in the "Pick an API" box. I overlooked the category because I thought it was for an app called Google Libraries. There's also a Javascript category for Javascript itself.

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • Windows Service suddenly doing nothing

    - by TB
    Hi, My windows service is using a Thread (not a timer) which is always looping and sleeps for 1 second every loop using : evet.WaitOne(interval); When I start the service it works fine and I can see in the task manager that it is running, consuming and releasing memory, consuming processor ... etc that is all normal, but after a while (random amount of time) the service simply stops!! it is still there in the task manager but it is not consuming any processor work now and its consumption to the memory is not changing. it simply (died but still there in the task manager like a Zombie). I know that many exceptions might have happened during running the service (it is really doing many things) but all those exceptions are handled in Try catch blocks, so why is my "always looping" thread stops ??? This thread also logs every time he loops, when he is freezig in this way he is not logging anything (of course)

    Read the article

  • Publish failed in Web Application Project (MVC)

    - by Stuck
    I usually use the "Publish" feature in VS 2008 to get the correct files and so on that I can publish to my website. But from time to time publish fails without any good error message at all. I know that it can be a couple of different reasons but I am starting to grow really tired with this now. Can anyone teach me how to build the website from the command line? As I said it is a MVC project. Can I use the aspnet_compiler for this? What parameters should I use to simulate the same behavior as a "Publish"?

    Read the article

  • Apache 2.2 / Win7 - slow or not responsive

    - by joey
    My configuration - Windows 7 x64, Php 5.3, Apache 2.2.15, latest Mysql. When loading pages from localhost, the response time shown by firebug is more 530ms for the main 'index.php' file, sometimes the connection is reset. It's painfully slow. I googled the problem and found a workaround - switch off and on again a win service called BFE - base filtering engine. Then everything works like a lightning but xdebug doesn't work in netbeans. Why is this response time so long? Can you think of any other solution than BFE toggling? joey33

    Read the article

< Previous Page | 669 670 671 672 673 674 675 676 677 678 679 680  | Next Page >