Search Results

Search found 31578 results on 1264 pages for 'javascript functions'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 675/1264 | < Previous Page | 671 672 673 674 675 676 677 678 679 680 681 682  | Next Page >

  • Bind event to AJAX populated list items

    - by AnPel
    I have an unordered list with no list items. I get some information from the user, I run it through my database using AJAX and the servers sends back a JSON object response. Then I append each list item I want to display to the list using something like $('blabla').append('<li>information</li>') My question is, since the li elements were not there at the time the DOM was ready, how can I bind a click event to them? Here is my full code: $(function(){ var timer; $('#f').keyup(function(){ clearTimeout(timer); timer = setTimeout(getSuggestions, 400); }); }) function getSuggestions(){ var a = $('#f')[0].value.length; if( a < 3){ if(a == 0){ $('#ajaxerror').hide(300,function(){ $('#loading').hide(300,function(){ $('#suggest').hide(300) }) }) } return; } $('#loading').slideDown(200,function(){ $.ajax({ url: '/models/AJAX/suggest.php', dataType: 'json', data: {'data' : $('#f')[0].value }, success: function(response){ $('#ajaxerror').hide(0,function(){ $('#loading').hide(100,function(){ $('#suggest ul li').remove(); for(var b = 0; b < ( response.rows * 3); b = b + 3){ $('#suggest ul').append('<li>'+response[b]+' '+response[b+1]+' '+response[b+2]+'</li>') // MISSING SOME CODE HERE TO BIND CLICK EVENT TO NEWLY CREATED LI } $('#suggest').show(300) }) }) }, error: function(){ $('#suggest').hide(0,function(){ $('#loading').slideUp(100,function(){ $('#ajaxerror').show(300) }) }) } }) }) }

    Read the article

  • How to use Jquery UI in my Custom Function? (Autocomplete)

    - by bakazero
    I want to create a function to simplify configuration of jQuery UI AutoComplete. Here is my function code: (function($) { $.fn.myAutocomplete = function() { var cache = {}; var dataUrl = args.dataUrl; var dataSend = args.dataItem; $.autocomplete({ source: function(request, response) { if (cache.term == request.term && cache.content) { response(cache.content); } if (new RegExp(cache.term).test(request.term) && cache.content && cache.content.length < 13) { var matcher = new RegExp($.ui.autocomplete.escapeRegex(request.term), "i"); response($.grep(cache.content, function(value) { return matcher.test(value.value) })); } $.ajax({ url: dataUrl, dataType: "json", type: "POST", data: dataSend, success: function(data) { cache.term = request.term; cache.content = data; response(data); } }); }, minLength: 2, }); } }) (jQuery); but when I'm using this function like: $("input#tag").myAutocomplete({ dataUrl: "/auto_complete/tag", dataSend: { term: request.term, category: $("input#category").val() } }); It's give me an error: Uncaught ReferenceError: request is not defined

    Read the article

  • drawImage don't work on chrome extention

    - by shrwea
    I use canvas drawImage in popup.html. But it doesn't work. Please advise me. popup.html <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8"> </head> <body> <canvas id="test"></canvas> <script src="test.js"></script> </body> </html> test.js var image = document.createElement("img"); image.src = "test.png"; image.onload = function(){ var canvas = document.getElementById('test'); var ctx = canvas.getContext('2d'); ctx.drawImage(image, 0, 0); }

    Read the article

  • How to add "Back to top" link at bottom at <div> is browser window is shorter than page, using jquer

    - by metal-gear-solid
    How to add "Back to top" link at bottom at is browser window is shorter than page, using jquery? <div id="mainContent"> <p>Some content</p> </div> If some content is bigger than browser window ( I mean if vertical bar comes on the page) then i want to add Back to top just before closing the div. <div id="mainContent"> <p>Some content</p> <p>Some content</p> <p>Some content</p> <a href="#"> Back to top </a> </div>

    Read the article

  • jQuery/Tablesorter: maintain secondary alphabetical sort

    - by user460847
    I have a table of names and ages that I want the user to be able to sort. When the page initally loads, sortList lists the rows in order from oldest to youngest, and then secondarily from A to Z. I want the same thing (a SECONDARY alphabetical sort) when the user actually clicks on the age <th>, but sortForce is making the alphabetical sort primary. Is there an alternative? $('#super_results table').tablesorter({ sortForce: [[0,0]], sortList: [[1,1],[0,0]] }); Or am I misunderstanding sortForce? Documentation here.

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • submit in html on sql query

    - by user1644661
    i need to run this sql query , which give me a list of Id and Dates i want to click each result and take with me the Id value to the next form i wrote this query above but i see in the debager that the hidden ID get his value but not pass to the next form i think i have a problem with the submit() . where should i put him ? thanks anat function ShowAllCarts($user_email) { $connB = new ProductDAO(); $connB->Connect(); $pro_query = "SELECT * FROM Cart WHERE `Email`='$user_email';"; $db_result = $connB->ExecSQL($pro_query); $html_result = '<div data-role="content"> <ul data-role="listview" data-theme="b"> '; $html_result .= '<form action="PreviouscartProduct.php" method="POST"/>'; while($row_array = $db_result->fetch_array(MYSQLI_ASSOC)) { $Id= $row_array['Id']; $Date= $row_array['Date']; //$html_result // $html_result .="<li><a href='PreviouscartProduct.php'>Cart number: $Id from Date: $Date><input type='hidden' name='Id' value'<?=$Id?>'</input></a></li>'"; $html_result .= '<a onclick="this.form.submit();" </a>; } $html_result .= ' </ul> </div>'; $html_result .= '</form>'; $connB->Disconnect(); return $html_result; } //display all carts $func_result = ShowAllCarts($Email);

    Read the article

  • Vertically And Horizonatally center main wrap div

    - by Hello you all men
    Now i try <html> <head> <title>?????????????????</title> <style type="text/css"> body { margin-left: auto; margin-right:auto; } #wrap { background: black; margin-left: auto; margin-right:auto; height:450px; width:450px; position:absolute; top:50%; right:50%; left:50%; margin-top:-225px; } </style> </head> <body> <div id="wrap"> Hello </div> </body> </html> ?????

    Read the article

  • Matching a String and then incrementing a number within HTML elements

    - by Abs
    Hello all, I have tags in a html list, here is an example of two tags. <div class="tags"> <ul> <li> <a onclick="tag_search('tag1');" href="#">tag1 <span class="num-active">1</span></a> </li> <li> <a onclick="tag_search('tag2');" href="#">tag2 <span class="num-active">1</span></a> </li> </ul> </div> I would like to write a function that I can pass a string to, that will match the strings in the a hyperlink i.e. "tag1" or "tag2", if there is a match then increment the number in the span, if not then add a new li. The bit I am having trouble with is how do I search for a string in the div with class tags and then when I find a match identifying the element. I can't even do the first bit as I am use to using an ID or a Class. I appreciate any help on this using JQuery Thanks all Code so far function change_tag_count(item){ alert(item);//alerts the string test $.fn.searchString = function(str) { return this.filter('*:contains("' + item + '")'); }; if($('body').searchString(item).length){ var n = $('a').searchString(item).children().text(); n = parseInt(n) + 1; $('a').searchString(item).children().text(n); }else{ alert('here');//does not alert this when no li contains the word test $("#all_tags ul").append('<a onclick="tag_search(\''+item+'\');" href="#">'+item+'<span class="num-active">1</span></a>'); } }

    Read the article

  • How to break a jquery variable dynamically based on condition

    - by Adi
    I have a jquery variable which has is showing the value in the console as .. ["INCOMING", 0, "INETCALL", 0, "ISD", 31.8, "LOCAL", 197.92, "STD", 73.2] Now as per my need i have to break these values and make it like this ["INCOMING", 0],["INETCALL", 0],["ISD", 31.8],["LOCAL", 197.92],["STD", 73.2] but these values i need to make in the required formate dynamically as this is received from database. Here is my ajax call to get the values from server side.. var dbdata=""; $(document).ready(function() { $.ajax({ type: 'GET', url: 'getPieChartdata', async:false, dataType: "text", success: function(data) { dbdata=JSON.parse(data); } }); console.log(dbdata); }); Please guys help me . Thanks in advance..

    Read the article

  • jQuery won't parse xml with nodes called option

    - by user170902
    hi all, I'm using jQuery to parse some XML, like so: function enumOptions(xml) { $(xml).find("animal").each(function(){ alert($(this).text()); }); } enumOptions("<root><animal>cow</animal><animal>squirrel</animal></root>"); This works great. However if I try and look for nodes called "option" then it doesn't work: function enumOptions(xml) { $(xml).find("option").each(function(){ alert($(this).text()); }); } enumOptions("<root><option>cow</option><option>squirrel</option></root>"); There's no error, just nothing gets alerted, as if the find isn't finding anything. It only does it for nodes called option everything else I tested works ok! I'm using the current version of jQuery - 1.4.2. Anyone any idea? TIA. bg

    Read the article

  • Regular Expression Fails

    - by Meander365
    Anyone help? When I run this I get " invalid quantifier ?<=href= " var aHrefMatch = new RegExp("(?<=href\=")[^]+?(?=")"); var matchedLink = mystring.match(aHrefMatch); But I know the regular expression is valid. Any ideas?

    Read the article

  • How to determine magnitude of trigonometric function? C++

    - by seaworthy
    > if (((test>=0) && (test<=90)) || ((test>270) && (test<=360))){n_y=1;} > else {n_y=-1;} I need the magnitude of trigonometric function in order to determine the sign of the trigonometric function for an angle falling into a particular quadrant. My plan is to replace the code above with something equivalent. Here is what I want to do in pseudo-code. n_y = cos(test) / (magnitude of cos (test)); This will give me same thing. Abs() only takes integers. Any help is appreciated.

    Read the article

  • mootools 1.11 .setHTML not working in IE

    - by moleculezz
    Hello, I am trying to make a form dynamic using mootools 1.11, for specific reasons I cannot upgrade atm. I'm trying to manipulate a select field to have dynamic options. This works in Firefox & Chrome but not IE8. Hope there's a fix for this. bits of the code: myOptions(hrs+1, 23, 'uur'); $('vertrektijd_uur').setHTML('<option value="">Kies uur</option>'+options_uur); $('vertrektijd_uur').addEvent('change', function() { hrsChanged = $('vertrektijd_uur').getValue(); hrsChanged = parseInt(hrsChanged); if(hrs+1 == hrsChanged) { myMinutes(parseInt(min)); myOptions(minChanged, 55, 'min'); $('vertrektijd_min').setHTML('<option value="">Kies minuten</option>'+options_min); } else { myOptions(0, 55, 'min'); $('vertrektijd_min').setHTML('<option value="">Kies minuten</option>'+options_min); } });

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • jQuery Treemap Plugin

    - by Revert
    Hello, I am trying to get the Treemap plugin (http://www.jquery.info/spip.php?article40) working with jQuery v1.3.x. The plugin works with jQuery v1.1 and v1.2 but for some reason it fails with the v1.3 base. This is the browser error "Error: uncaught exception: Syntax error, unrecognized expression: " Does anyone know changes occurred between JQuery v1.2 and v1.3 that could cause this? Cheers, D

    Read the article

  • json retrival failed with jquery .each

    - by user545520
    {"paging": {"pageNum":2,"action":"Next","type":"","availableCacheName":"getAllFunds","selectedCacheName":"","showFrom":101,"showTo":200,"totalRec":289,"pageSize":100}, "Data":[{"sourceCodeId":0,"radio_fund":"individua l","availableFunds":[],"fundId":288,"searchName":[],"fundName":"Asian Equity Fund A Class Income","srcFundGrpId":"PGI","firstElement":0,"las tElement":0,"totalElements":0,"pageList":[],"standardExtract":true}] I have json file with above format with two fileds,one paging and one is Data array. I able to retrieve values of paging,but i am not able to retrieve the values of data array with .each function of jquery. Any suggestions or inputs really appreciated.

    Read the article

  • Problem with adding integers in an array

    - by rshivers
    Hello again, I'm trying to loop through my totals in order to get a grand total for my web app. So far the code I am working with is the following: function calcAllFields() { var name = parseFloat($('div [name = total[]]').text()); var totArray = $.makeArray(name); var total = 0; for (var i = 0; i < totArray.length; i++) { total += totArray[i]; } $("#target1").text(total); } Instead of adding integers, something is being read as a string. Say I want to add 200 + 50, instead of 250 I get 20050. Could anyone please point out what I'm doing wrong? Thanks!

    Read the article

  • jQuery setinterval does not show first element

    - by Me-and-Coding
    Hi, I am creating this content slider, you can view/edit here: http://jsbin.com/esame4 I have put in place setInterval so that animation runs automatically, however, when it is run for the first time, google image is shown but not afterwords. Should be simple but i am unable to figure out the problem.

    Read the article

  • Real time content editing html5

    - by Mark Lauzon
    So I've seen things like WordPress and FCKEditor, and basically a bunch of stuff that uses external code that I can't see or edit. Whenever I ask about editing and saving the content of a page in real time I just get referenced to an API or I get handed code that only changes the page until it's reloaded. What I want to know is how do I code it myself? I want to add real time content editing to a page without the use of someone else's code. I've checked out code for various forums and wikipedia and whatnot, and all of it references code I don't have access to. Is this a thing? Can I edit a page in real time? I thought of writing the edited text to a file on the server, and then when they click save, reading it back into the code to the section they were editing, but I don't know how to do that or if it's even possible. As a side note, I'm very new to html, but not new to coding. EDIT: The structure can be very much like Wikipedia, it doesn't have to be real time, it just has to work

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 671 672 673 674 675 676 677 678 679 680 681 682  | Next Page >