Search Results

Search found 31578 results on 1264 pages for 'javascript functions'.

Page 675/1264 | < Previous Page | 671 672 673 674 675 676 677 678 679 680 681 682  | Next Page >

  • Pass var to jquery from div

    - by user1518202
    I am using a jquery function to open a dialog box, and I need to be able to change the height and the width of the box. I am wanting to pass it a parameter from within the DIV. I have looked at many different possibilities, but to no avail. Any ideas would be greatly appreciated. $.fx.speeds._default = 1000; $(function() { $("#dialog").dialog({ autoOpen: false, height: 300, width: 500, show: "drop", hide: "drop" }); $("#opener").click(function() { $("#dialog").dialog("open"); return false; }); }); Here is my Div. <div id="dialog"> Some text here </div>

    Read the article

  • add html to div with jQuery

    - by mtwallet
    Hi. I am trying to add some additional html to a div with id slideshow using jQuery. My code: $("#slideshow").append("<a id="prev" title="Previous Slide">Previous Slide</a><a id="next" title="Next Slide">Next Slide</a>"); This isn't working, can anyone tell me what I am doing wrong?

    Read the article

  • Creating Slugs from Titles?

    - by James Jeffery
    I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

    Read the article

  • allignment issue of div tag

    - by Quasar the space thing
    I am trying to create a web page where on click of a button I can add div tags. What I thought to do was that I'll create two div tags within a single div so that over all presentation will be uniform and similar to a table having two columns and multiple rows and the first column contains only label's and second column will contain textbox. Here is the JS file : var counter = 0; function create_div(type){ var dynDiv = document.createElement("div"); dynDiv.id = "divid_"+counter; dynDiv.class="main"; document.body.appendChild(dynDiv); question(); if(type == 'ADDTEXTBOX'){ ADDTEXTBOX(); } counter=counter+1; } function question(){ var question_div = document.createElement("div"); question_div.class="question"; question_div.id = "question_div_"+counter; var Question = prompt("Enter The Question here:", ""); var node=document.createTextNode(Question); question_div.appendChild(node); var element=document.getElementById("divid_"+counter); element.appendChild(question_div); } function ADDTEXTBOX(){ var answer_div = document.createElement("div"); answer_div.class="answer"; answer_div.id = "answer_div_"+counter; var answer_tag = document.createElement("input"); answer_tag.id = "answer_tag_"+counter; answer_tag.setAttribute("type", "text"); answer_tag.setAttribute("name", "textbox"); answer_div.appendChild(answer_tag); var element=document.getElementById("divid_"+counter); element.appendChild(answer_div); } Here is the css file : .question { width: 40%; height: auto; float: left; display: inline-block; text-align: justify; word-wrap:break-word; } .answer { padding-left:10%; width: 40%; height: auto; float: left; overflow: auto; word-wrap:break-word; } .main { width: auto; background-color:gray; height: auto; overflow: auto; word-wrap:break-word; } My problem is that the code is working properly but both the divisions are not coming in a straight line. after the first div prints on the screen the second divisions comes in another line. How can I make both the div's come in the same line ? Thank You. PS : should I stick with the current idea of using div or should I try some other approach ? like tables ?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • finding specific immediate children of an element using prototype

    - by tatilans
    Following DOM structure: <ul> <li class="item">yes</li> <li>no</li> <li class="item">yes</li> <li> <ul> <li class="item">no</li> </ul> </li> </ul> Assuming I have the outer <ul> in $ul. How do I get the two immediate children which have the item-class? In jQuery I would write something like this: $ul.children().filter(".item") $ul.children(".item") $ul.find("> .item") How do I to this with Prototype? I tried the following ... $ul.select("> .item") //WRONG ... but it does does exactly the opposite and returns the one inner <li>

    Read the article

  • Cannot submit form when disabling JSF page

    - by Steve
    Simple submit button. <h:commandButton actionListener="#{regBean.findReg}" action="#{regBean.navigate}" value="Search" /> The form tag is displayed like so: <h:form onsubmit="this.disabled=true;busyProcess();return true;"> This is so if the submit button is pressed, the page shows a "busy" icon until request is processed. The problem is, the request is never submitted and it never reaches the backend. However, if I instead take out the "disabled" call like so: <h:form onsubmit="busyProcess();return true;"> Everything works. Any ideas?

    Read the article

  • css to replace characters in paragraph tag

    - by Thariama
    Already checked exisitng questions for this, but didn't find an exact match. My aim is to replace characters (like spaces) on a webpage with a small image using css. Example: <p><span>This is a text</span></p> becomes: <p><span>ThisIMGisIMGaIMGtext</span></p> (where IMG stands for a visible image (middot-pic for a space f.e.)) I cannot think of a suitable css selector. But myabe one of you guys (or girls) know a solution. Is this possible at all?

    Read the article

  • jQuery - Why doesn't combining has() and gt() work in some cases?

    - by KatieK
    I wanted to select any ul which contains more than 3 lis. This code worked with the 1.2.6 jQuery library: $("ul:has(li:gt(2))") .each( function() { $(this).css("border", "solid red 1px"); }); But not 1.3.2 or 1.4.2. This code worked with the 1.4.2 jQuery library: $('ul').has('li:nth-child(3)').css('border', 'solid red 1px'); But not v1.2.6. Why does each version work with one library version, but not the other? Am I encountering some kind of bug, or am I doing something wrong? Any help understanding , or differences to be aware of between different versions of the jQuery libraries, would be much appreciated. Thanks!

    Read the article

  • Capturing clicks even when stopPropagation has been called (ie by 3rd party code)?

    - by josh
    I want to detect any click that happens on a page (to close a custom context menu). I'm using jQuery and trying to do $(document).click(function(){ ...close my context menu ... }); However, I'm using some code that calls evt.stopPropagation() in the click handlers for certain elements on the page, and those clicks aren't making it up to my top-level handler. Is there any way of capturing those clicks? Can be jQuery or not jQuery, as long as it works cross-browser.

    Read the article

  • jQuery changing images with animation and waiting for it to trigger hyperlink

    - by user1476298
    I want to switch images on .click() using the url attr I can do so, but I can't figure out how to make it wait, until the animation is done to redirect to the new webpage. Here's the js $(function() { $('.cv').click(function(){ $("#cv img").fadeOut(2000, function() { $(this).load(function() { $(this).fadeIn(); }); $(this).attr("src", "images/cv2.png"); return true; }); }); }); Here's the html: <div id="cv" class="img one-third column"> <a class="cv" target="#" href="cv.joanlascano.com.ar"> <img src="images/cv1.png" alt="Curriculum"/> <br />CV</a> </div> Thank you in advantage!

    Read the article

  • Why is my index view not working when I implement datepicker in my rails app

    - by user3736107
    Hi I am new to rails and would really appreciate some help, I am using the jQuery datepicker, the show view works however the index view doesn't, i get "undefined method `start_date' for nil:NilClass" in my index.html.erb file. Can you please let me know what is wrong with my index view and how i can fix it. The following are included in my app: meetups_controller.rb def show @meetup = Meetup.find(params[:id]) end def index @meetups = Meetup.where('user_id = ?', current_user.id).order('created_at DESC') end show.html.erb <h3>Title: <%= @meetup.title %></h3> <p>Start date: <%= @meetup.start_date.strftime("%B %e, %Y") %></p> <p>Start time: <%= @meetup.start_time.strftime("%l:%M %P") %></p> <p>End date: <%= @meetup.end_date.strftime("%B %e, %Y") %></p> <p>End time: <%= @meetup.end_time.strftime("%l:%M %P") %></p> index.html.erb <% if @meetups.any? %> <% @meetups.each do |meetup| %> <h3><%= link_to meetup.title, meetup_path(meetup) %></h3> <p>Start date: <%= meetup.start_date.strftime("%B %e, %Y") %></p> <p>Start time: <%= meetup.start_time.strftime("%l:%M %P") %></p> <p>End date: <%= @meetup.end_date.strftime("%B %e, %Y") %></p> <p>End time: <%= @meetup.end_time.strftime("%l:%M %P") %></p>

    Read the article

  • json retrival failed with jquery .each

    - by user545520
    {"paging": {"pageNum":2,"action":"Next","type":"","availableCacheName":"getAllFunds","selectedCacheName":"","showFrom":101,"showTo":200,"totalRec":289,"pageSize":100}, "Data":[{"sourceCodeId":0,"radio_fund":"individua l","availableFunds":[],"fundId":288,"searchName":[],"fundName":"Asian Equity Fund A Class Income","srcFundGrpId":"PGI","firstElement":0,"las tElement":0,"totalElements":0,"pageList":[],"standardExtract":true}] I have json file with above format with two fileds,one paging and one is Data array. I able to retrieve values of paging,but i am not able to retrieve the values of data array with .each function of jquery. Any suggestions or inputs really appreciated.

    Read the article

  • Another way to handle a common JQuery event handling pattern

    - by bradgonesurfing
    I have the following code for example $("a.foo").bind(function (e){ var t; if ( $(e.target).is("a") ){ t = $(e.target); }else{ t = $(e.target).parent("a"); } var data = t.attr("data-info"); }); In english. I might have a list of anchors within which there may be a number of spans. Each anchor is declared as <a class="foo" href="#" data-info="1"> <span> ... </span> <span> ... </span> </a> <a class="foo" href="#" data-info="2"> <span> ... </span> <span> ... </span> </a> ... ... I bind a handler to the click event of the anchor but the event object comes back with the anchor OR one of the spans depending on where I click. So to get my html5 "data-info" value into the callback I have to insert a bit of messy code. This is now appearing throughout my code to the point where I am guessing there might be an idiomatic JQuery way of handling this.

    Read the article

  • How do i make form data not disappear after hitting refresh?

    - by acidzombie24
    I went to test my page on another browser. On google chrome i can fill out a form, hit back and forward and still have the data there. Now i need to refresh the page so certain data is correct (such as session id if the cookie expires or user logs out before submitting). I refresh and lose all data. Is there some option i can set so all data is kept?

    Read the article

  • My HTML5 web app crashes and I have no clue how to debug

    - by Shouvik
    Hi All, I have written a word game using HTML5 canvas tag and a little bit of audio. I developed the application on the chrome web browser on a linux system. Recently during the testing phase it was tried on safari 5.0.3 on Mac and the webpage froze. Not just the canvas element, but interactive element on the page froze. I have at some times experienced this problem on google chrome when I was developing but since the console did not throw any error before this happened, I did not give it much credence. Now as per requirements I am supposed to support both chrome and safari but this dismal performance on safari has left me shocked and I cannot see what error can be thrown which might lead to such a situation. Worse yet the CPU usage on using this application peaks to 70-80percent on my 2yr old macbook running ubuntu... I can only but pity the person who uses mac to operate this app, which undoubtedly is a heavier OS. Could someone help me out with a place I can start with to find out what exactly is causing this issue. I have run profiles on this webapp on google chromes console and noticed that in the heap spanshot value increases steadily with the playing of the game, specifically (root) value which jumps up by 900 counts. Any help would be very appreciated! Thanks EDIT: I don't know if this helps, but I have noticed that even on refreshing the page after the app becomes unresponsive the page reloads and I am still not able to interact with the page elements but the tab scroll bar continues to work and I can see my application window completely. So to summaries the tab stops accepting any sort of user interaction inside the page. Edit2: Nop. It doesn't work still... The app crashes on double click on the canvas element. The console is not throwing any errors either! =/ I have noticed this problem is isolated only to safari!

    Read the article

< Previous Page | 671 672 673 674 675 676 677 678 679 680 681 682  | Next Page >