Search Results

Search found 38961 results on 1559 pages for 'boost function'.

Page 677/1559 | < Previous Page | 673 674 675 676 677 678 679 680 681 682 683 684  | Next Page >

  • Why are functional languages considered a boon for multi threaded environments?

    - by Billy ONeal
    I hear a lot about functional languages, and how they scale well because there is no state around a function; and therefore that function can be massively parallelized. However, this makes little sense to me because almost all real-world practical programs need/have state to take care of. I also find it interesting that most major scaling libraries, i.e. MapReduce, are typically written in imperative languages like C or C++. I'd like to hear from the functional camp where this hype I'm hearing is coming from....

    Read the article

  • XML pass values to timer, AS3

    - by VideoDnd
    My timer has three variables that I can trace to the output window, but don't know how to pass them to the timer. How to I pass the XML values to my timer? Purpose I want to test with an XML document, before I try connecting it to an XML socket. myXML <?xml version="1.0" encoding="utf-8"?> <SESSION> <TIMER TITLE="speed">100</TIMER> <COUNT TITLE="starting position">-77777</COUNT> <FCOUNT TITLE="ramp">1000</FCOUNT> </SESSION> myFlash //myTimer 'instance of mytext on stage' /* fields I want to change with XML */ //CHANGE TO 100 var timer:Timer = new Timer(10); //CHANGE TO -77777 var count:int = 0; //CHANGE TO 1000 var fcount:int = 0; timer.addEventListener(TimerEvent.TIMER, incrementCounter); timer.start(); function incrementCounter(event:TimerEvent) { count++; fcount=int(count*count/1000);//starts out slow... then speeds up mytext.text = formatCount(fcount); } function formatCount(i:int):String { var fraction:int = i % 100; var whole:int = i / 100; return ("0000000" + whole).substr(-7, 7) + "." + (fraction < 10 ? "0" + fraction : fraction); } //LOAD XML var myXML:XML; var myLoader:URLLoader = new URLLoader(); myLoader.load(new URLRequest("time.xml")); myLoader.addEventListener(Event.COMPLETE, processXML); //PARSE XML function processXML(e:Event):void { myXML = new XML(e.target.data); trace(myXML.ROGUE.*); trace(myXML); //TEXT var text:TextField = new TextField(); text.text = myXML.TIMER.*; text.textColor = 0xFF0000; addChild(text); } RESOURCES OReilly's ActionScript 3.0 Cookbook, Chapter 12 Strings, Chapter 20 XML

    Read the article

  • Mocking imported modules in Python

    - by Evgenyt
    I'm trying to implement unit tests for function that uses imported external objects. For example helpers.py is: import os import pylons def some_func(arg): ... var1 = os.path.exist(...) var2 = os.path.getmtime(...) var3 = pylons.request.environ['HTTP_HOST'] ... So when I'm creating unit test for it I do some mocking (minimock in my case) and replacing references to pylons.request and os.path: import helpers def test_some_func(): helpers.pylons.request = minimock.Mock("pylons.request") helpers.pylons.request.environ = { 'HTTP_HOST': "localhost" } helpers.os.path = minimock.Mock(....) ... some_func(...) # assert ... This does not look good for me. Is there any other better way or strategy to substitute imported function/objects in Python?

    Read the article

  • Get jQuery Error if PHP Breaks

    - by Norbert
    I have a PHP script that breaks if a variable is not populated and it isn't added to the database, but jQuery handles this as a success and I get this error: TypeError: Result of expression 'data' [null] is not an object. Here's the jQuery script: $.ajax({ type: "POST", url: "/clase/do-add", data: $("#adauga").serialize(), dataType: "json", error: function (xhr, textStatus, errorThrown) { alert('Try again.'); }, success: function(data) { var dlHTML = '<dl id="' + data.id + '"> [too long] </dl>'; $('form#adauga').after(dlHTML); $('#main dl:first').hide().fadeIn(); adaugaClasaSubmit.removeAttr('disabled'); adaugaClasa.removeAttr('readonly'); adaugaClasa.val("").focus(); } });

    Read the article

  • Chrome Javascript

    - by Mike
    i have two spans on my page with class='hidden' and then some javascript to remove the class when a condition is met, its working fine in ie 9/10 and firefox but its not working in chrome when I run the function in the chrome JS console I get the message TypeError: Cannot read property 'attributes' of null Anybody know whats going on? <script type='text/javascript' > function showhidden() { var att =document.getElementById('hiddentextbox'); att.attributes[0].value=''; att =document.getElementById('hiddentextbox1'); att.attributes[0].value=''; }</script> Thanks

    Read the article

  • highlight query string in more than one field using solr search feature

    - by Romi
    i am using solr indexes for showing my search results. to show serch results i am parsing json data received from solr. i am able to highlight a query string in search result but only in a single field. for this i set hl=true and hl.fl="field1". i did it as $.getJSON("http://192.168.1.9:8983/solr/db/select/?wt=json&&start=0&rows=100&q="+lowerCaseQuery+"&hl=true&hl.fl=description,name&hl.usePhraseHighlighter=true&sort=price asc&json.wrf=?", function(result){ var n=result.response.numFound var highlight = new Array(n); $.each(result.highlighting, function(i, hitem){ var match = hitem.text[0].match(/<em>(.*?)<\/em>/); highlight[i]=match[1]; }); $.each(newresult.response.docs, function(i,item){ var word=highlight[item["UID_PK"]]; var result = item.text[0].replace(new RegExp(word,'g'), '<em>' + word + '</em>'); }); for this json object is as : { "responseHeader": { "status": 0, "QTime": 32 }, "response": { "numFound": 21, "start": 0, "docs": [ { "description": "The matte finish waves on this wedding band contrast with the high polish borders. This sharp and elegant design was finely crafted in Japan.", "UID_PK": "8252", }, { "description": "This elegant ring has an Akoya cultured pearl with a band of bezel-set round diamonds making it perfect for her to wear to work or the night out.", "UID_PK": "8142", }, ] }, "highlighting": { "8252": { "description": [ " and <em>elegant</em> design was finely crafted in Japan." ] }, "8142": { "description": [ "This <em>elegant</em> ring has an Akoya cultured pearl with a band of bezel-set round diamonds making" ] }, } } Now if i want to highlight query string in two fields i did as hl=true hl.fl=descrption, name my json is as: { "responseHeader":{ "status":0, "QTime":16 }, "response":{ "numFound":1904, "start":0, "docs":[ { "description":"", "UID_PK":"7780", "name":[ "Diamond bracelet with Milgrain Bezel1" ] }, { "description":"This pendant is sure to win hearts. Round diamonds form a simple and graceful line.", "UID_PK":"8121", "name":[ "Heartline Diamond Pendant" ] }, "highlighting":{ "7780":{ "name":[ "<em>Diamond</em> bracelet with Milgrain Bezel1" ] }, "8121":{ "description":[ "This pendant is sure to win hearts. Round <em>diamonds</em> form a simple and graceful line." ], "name":[ "Heartline <em>Diamond</em> Pendant" ] } } } Now how should i parse it to get the result. suggest me some general technique, so if i want to highlight query in more fields then i could do so. Thanks

    Read the article

  • Javascript: Using the Module Pattern for larger projects

    - by Rob
    I'm interested in using the Module Pattern to better organize my future projects. Unfortunately, there are only a few brief tutorials and proof-of-concept examples of the Module Pattern. Using the module pattern, I would like to organize projects into this sort of structure: project.arm.object.method(); Where "project" is my global project name, "arm" is a sub-section or branch of the project, "object" is an individual object, and so on to the methods and properties. However, I'm not sure how I should be declaring and organizing multiple "arms" and "objects" under "project". var project = window.project || {}; project.arm = project.arm || {}; project.arm.object = (function() { var privateVar = "Private contents."; function privateMethod() { alert(privateVar); } return { method: privateMethod }; }()); Are there any best practices or conventions when defining a complex module structure? Should I just declare a new arm/object underneath the last?

    Read the article

  • PHP: Do we have any command via which we can delete the contents of an file without opening it.

    - by Rachel
    Is there any way to remove the contents of an file in php, do we have any php command that does that, I know unlink but I do not want to delete the file instead I just want to remove the contents of that file. I have an file which I pass while called a getCurrentDBSnap function, it takes in the file from /home/test/incoming folder and populates currentDB table state into the file using fputcsv and puts back file to /home/test/outgoing. Currently file stays in incoming folder and when I can call the function getCurrentDBSnap it would take the file and override with latest state of DB into it. Q: My question is, is it possible instead of overwriting the file, we can remove the content of file after ever getCurrentDBSnap such that file in incoming folder would be always empty ? Hope it makes sense :)

    Read the article

  • Unix: millionth number in the serie 2 3 4 6 9 13 19 28 42 63 ... ?

    - by HH
    It takes about minute to achieve 3000 in my comp but I need to know the millionth number in the serie. The definition is recursive so I cannot see any shortcuts except to calculate everything before the millionth number. How can you fast calculate millionth number in the serie? Serie Def n_{i+1} = \floor{ 3/2 * n_{i} } and n_{0}=2. Interestingly, only one site list the serie according to Goolge: this one. Too slow Bash code #!/bin/bash function serie { n=$( echo "3/2*$n" | bc -l | tr '\n' ' ' | sed -e 's@\\@@g' -e 's@ @@g' ); # bc gives \ at very large numbers, sed-tr for it n=$( echo $n/1 | bc ) #DUMMY FLOOR func } n=2 nth=1 while [ true ]; #$nth -lt 500 ]; do serie $n # n gets new value in the function throught global value echo $nth $n nth=$( echo $nth + 1 | bc ) #n++ done

    Read the article

  • Network switches for LAN party

    - by guywhoneedsahand
    I am working on setting up the network for a small LAN party (less than 16 people). Most of them do not have wireless cards in their rigs, so I need to set up some way for everyone to a) play LAN games and b) access the internet. The LAN party will probably take place in my basement, where I have enough space. However, the basement is not wired up with the router which is actually on the floor above. I make a cantenna a while back that can boost the wireless performance of my computer significantly. How can I use this to provide internet and LAN to guests? My hope was that I could use a switch like this http://www.newegg.com/Product/Product.aspx?Item=N82E16833181166 for the LAN - but how can I give people access to the internet? Is there such thing as a network extender / 16-port switch? Obviously, the internet performance doesn't need to be super stellar, because the games will be using LAN - so I am looking to provide some usable internet for web browsing, and very high speed LAN for games. Thanks!

    Read the article

  • jquery iterating through newly created elements

    - by jaeyun
    Hi All, I am trying to add new rows in my table, and save them into DB. First, I use .append() to append rows on the table: $("#tablename").append("<tr id='newRow'><td>newly added row</td></tr>"); The appending function works fine. My page displays the correct result. However, I am unable to select them with $("#newRow").each(function () { alert "it never reaches here!"; }); I am guessing it is because the elements are added after the DOM is loaded. Can anyone please tell me how I can iterate through all my newly added elements? Thank you.

    Read the article

  • Inline assembler get address of pointer Visual Studio

    - by Joe
    I have a function in VS where I pass a pointer to the function. I then want to store the pointer in a register to further manipulate. How do you do that? I have tried void f(*p) { __asm mov eax, p // try one FAIL __asm mov eax, [p] // try two FAIL __asm mov eax, &p // try three FAIL } Both 1 and 2 are converted to the same code and load the value pointed to. I just want the address. Oddly, option 1 works just fine with integers. void f() { int i = 5; __asm mov eax, i // SUCCESS? }

    Read the article

  • Global javascript variable inside ready

    - by w0rldart
    Which is the right way of declaring a global javascript variable? The way I'm trying it, doesn't work $(document).ready(function() { var intro; if ($('.intro_check').is(':checked')) { intro = true; $('.intro').wrap('<div class="disabled"></div>'); }; $('.intro_check').change(function(){ if(this.checked) { intro = false; $('.enabled').removeClass('enabled').addClass('disabled'); } else { intro = true; if($('.intro').exists()) { $('.disabled').removeClass('disabled').addClass('enabled'); } else { $('.intro').wrap('<div class="disabled"></div>'); } } }); }); console.log(intro);

    Read the article

  • warning: (Internal error: pc 0x804a6b0 in read in psymtab, but not in symtab.) g++

    - by Sriram
    Hi, I am trying to debug a program using ddd. When I try to enter any function, or within main() itself, I get the following warning: warning: (Internal error: pc 0x804a6b0 in read in psymtab, but not in symtab.) This warning flashes whenever I try to move to another instruction using 'n' or enter or leave a function. I have tried to look this up in other forums, but with no conclusive answer. The code I am trying to debug runs into several files and I am not sure if I can post the entire code here. I am using g++ version: g++ (GCC) 4.4.1 20090725 (Red Hat 4.4.1-2) Any help on this is most welcome. Thanks, Sriram.

    Read the article

  • flash cs4 file reference. Event.COMPLETE not called on a MAC,

    - by jobbie jones
    Hi, I am working with a fileReference, however I'm having issues running on Safari on a MAC... EDIT The below example also doesnt work on Safari on a MAC... http://www.permadi.com/blog/2010/06/flash-as3-using-filereference-to-load-files-example-for-flash-cs4-and-above/ # The workflow on a PC runs as such: 1) Create file reference 2) attach addEventListener's for Event.SELECT and Event.COMPLETE 3) call the browse() method On a PC, Event.SELECT is fired when a file has been selected. Event.COMPLETE is fired when the file data is available to flash. If I select an 500meg file, it takes a few seconds before Event.COMPLETE is fired. If I attempt to access the file data properties (such as reading the data stream) before Event.COMPLETE is fired, I receive null reference errors... So far so good. However, on a MAC (speficially Safari, not tested other browsers), the Event.COMPLETE is not fired. I have checked the Adobe docs, which say Event.COMPLETE is fired when the upload is completed. So why does it get fired on windows when the fileReference has parsed the file, but the upload method has not yet been called... Can anyone help? Here's snippets of the code I am working on: public function browseFile(target:Object):void { var imagesFilter:FileFilter = new FileFilter("Allowed files", "*.jpg;*.bmp;*.flv;"); fileReference.browse([imagesFilter]); fileReference.addEventListener(Event.SELECT, fileSelect); fileReference.addEventListener(Event.COMPLETE, fileSelectComplete); } private function fileSelect(event:Event):void { // update label - IMPORTANT for large files as there's a delay while flash parses file, before control is handed back to this script... setStatusLabel("...loading file"); var fileReference:FileReference = event.target as FileReference; fileReference.addEventListener(Event.COMPLETE, fileSelectComplete); // load the file into the fileReference object fileReference.load(); } // Called when upload file has been processed by flash (a few secs for large files, or fileRef.data is null...) private function fileSelectComplete(event:Event):void { var fileReference:FileReference=event.target as FileReference; trace("ready to do things - but not fired on Safari on a MAC "); }

    Read the article

  • Problem in passing arrays from C# to C++

    - by Rakesh K
    Hi, I have an application in which I need to pass an array from C# to a C++ DLL. What is the best method to do it? I did some search on Internet and figured out that I need to pass the arrays from C# using ref. The code for the same: status = IterateCL(ref input, ref output); The input and output arrays are of length 20. and the corresponding code in C++ DLL is IterateCL(int *&inArray, int *&outArray) This works fine for once. But if I try to call the function from C# in a loop the second time, the input array in C# is showing up as an array of one element. Why is this happening and please help me how I can call this function iteratively from C#. Thanks, Rakesh.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • AJAX XML reply node value iteration

    - by XpiritO
    Hi there, guys. I would really appreciate to get your help on this, as I can't seem to detect and solve the problem I'm having with an AJAX functionality on a site that I'm currently developing. I have a webform that makes an asynchronous call to a handler (.ashx) that delivers a XML response that is later processed by a Javascript client-side function that places it's contents into the user-interface. I'm attaching an example of the response generated by my handler, and what I would like to know is how can I get all the <body> element innerHTML (with the text and child nodes) contents to append it to a <span> element on the user-interface. Can anyone help me out with this? XML Response returned by the handler (checked via Firebug): <message> <content> <messageId>2</messageId> <from>Barack Obama</from> <fromMail>[email protected]</fromMail> <subject>Yes, we can... get World Peace</subject> <body>Hello, dear citizen. I'm sending you this message to invite you to join us! <a href="http://www.whitehouse.gov">Test link</a> Thank you for your time.</body> </content> </message> Client-side Javascript function to affect the user-interface innerHTML property with the data returned via AJAX: function GetMessageContentsCallback(args, resp) { //XML Parser try { //Internet Explorer xmlDoc = new ActiveXObject("Microsoft.XMLDOM"); xmlDoc.async = "false"; xmlDoc.loadXML(resp); } catch (e) { parser = new DOMParser(); xmlDoc = parser.parseFromString(resp, "text/xml"); } var msgReply = xmlDoc.getElementsByTagName('message')[0]; var ajaxRespondeBodyInnerHTML = msgReply.getElementsByTagName(body)[0].firstChild.nodeValue; //this currently only delivers inner text content, without the <a href... bit and subsequent text document.getElementById("bodySpan").innerHTML = ajaxRespondeBodyInnerHTML; }

    Read the article

  • JQuery response is null but actual response is not

    - by Paul Petrick
    I'm using JQuery to make an Ajax call. I used a sniffer to catch the response text: {"error_code":0,"message":"SUCCESS","data":{"session_token":"3efd9dde-a839-4e91-9415-4c2f6cba5b7b"}} But the response returned on the success callback is null. Anyone got any ideas? (see jquery code below. Jquery code: $.ajax({ type: "GET", url: "http://184.72.58.99/matchaapi/API/User/Login", data: { email: emailval, password: pwordval, developer_key: devkey }, dataType: "json", cache: false, beforeSend: function(xhr) { xhr.setRequestHeader( "Content-Type", "application/json; charset=utf-8" ); }, success: function(resp) { alert(resp); $("#status p").html(resp.message); }});

    Read the article

  • Server Error Message: No File Access

    - by iMayne
    Hello. Im having an issues but dont know where to solve it. My template works great in xampp but not on the host server. I get this message: Warning: file_get_contents() [function.file-get-contents]: URL file-access is disables in the server configuration in homepage/......./twitter.php. The error is on line 64. <?php /* For use in the "Parse Twitter Feeds" code below */ define("SECOND", 1); define("MINUTE", 60 * SECOND); define("HOUR", 60 * MINUTE); define("DAY", 24 * HOUR); define("MONTH", 30 * DAY); function relativeTime($time) { $delta = time() - $time; if ($delta < 2 * MINUTE) { return "1 min ago"; } if ($delta < 45 * MINUTE) { return floor($delta / MINUTE) . " min ago"; } if ($delta < 90 * MINUTE) { return "1 hour ago"; } if ($delta < 24 * HOUR) { return floor($delta / HOUR) . " hours ago"; } if ($delta < 48 * HOUR) { return "yesterday"; } if ($delta < 30 * DAY) { return floor($delta / DAY) . " days ago"; } if ($delta < 12 * MONTH) { $months = floor($delta / DAY / 30); return $months <= 1 ? "1 month ago" : $months . " months ago"; } else { $years = floor($delta / DAY / 365); return $years <= 1 ? "1 year ago" : $years . " years ago"; } } /* Parse Twitter Feeds */ function parse_cache_feed($usernames, $limit, $type) { $username_for_feed = str_replace(" ", "+OR+from%3A", $usernames); $feed = "http://twitter.com/statuses/user_timeline.atom?screen_name=" . $username_for_feed . "&count=" . $limit; $usernames_for_file = str_replace(" ", "-", $usernames); $cache_file = dirname(__FILE__).'/cache/' . $usernames_for_file . '-twitter-cache-' . $type; if (file_exists($cache_file)) { $last = filemtime($cache_file); } $now = time(); $interval = 600; // ten minutes // check the cache file if ( !$last || (( $now - $last ) > $interval) ) { // cache file doesn't exist, or is old, so refresh it $cache_rss = file_get_contents($feed); (this is line 64) Any help on how to give this access on my host server?

    Read the article

  • How modify ascii table in C?

    - by drigoSkalWalker
    like this: My ASCII Chart 0 1 2 3 4 5 6 7 8 9 A B C D E F 0 NUL SOH STX ETX EOT ENQ ACK BEL BS HT LF VT FF CR SO SI 1 DLE DC1 DC2 DC3 DC4 NAK SYN ETB CAN EM SUB ESC FS GS RS US 2 SP ! " # $ % & ' ( ) * + , - . / 3 0 1 2 3 4 5 6 7 8 9 : ; ? 4 @ A B C D E F G H I J K L M N O 5 P Q R S T U V W X Y Z [ \ ] ^ _ 6 ` a b c d e f g h i j k l m n o 7 p q r s t u v w x y z { | } ~ DEL I want to call a function, alter the ascii sequence in this function and when it return, the ascii sequence back to the original. thanks in advance!

    Read the article

  • Generating random numbers in C

    - by moonstruckhorrors
    While searching for Tutorials on generating random numbers in C I found This Topic When I try to use the rand() function with parameters, I always get the random number generated 0. When I try to use the rand() function with parameters, I always get the value 41. And whenever I try to use arc4random() and random() functions, I get a LNK2019 error. Here's what I'm doing: #include <stdlib.h> int main() { int x; x = rand(6); printf("%d", x); } This code always generate 41. Where am I going wrong?? P.S. : I'm running Windows XP SP3 and using VS2010 Command Prompt as compiler. P.P.S. : Took me 15 minutes to learn how to format properly.

    Read the article

  • Get the WPMU default blog domain

    - by RobertWHurst
    I have a network of blogs that link to each other. The problem is when I want to get the primary blog's domain. I need it for things like the the target of the logo when clicked. I can't seem to find a function in WPMU the retrieves this. I can see the value I want in the wp_site table. I could easily get it with $wpdb, but its a bit over kill, and if there is a function that can get the value already, then I want to use it.

    Read the article

< Previous Page | 673 674 675 676 677 678 679 680 681 682 683 684  | Next Page >