Search Results

Search found 10207 results on 409 pages for 'backbone js collections'.

Page 68/409 | < Previous Page | 64 65 66 67 68 69 70 71 72 73 74 75  | Next Page >

  • Issue pushing object into an array JS

    - by Javacadabra
    I'm having an issue placing an object into my array in javascript. This is the code: $('.confirmBtn').click(function(){ //Get reference to the Value in the Text area var comment = $("#comments").val(); //Create Object var orderComment = { 'comment' : comment }; //Add Object to the Array productArray.push(orderComment); //update cookie $.cookie('order_cookie', JSON.stringify(productArray), { expires: 1, path: '/' }); }); However when I print the array this is the output: Array ( [0] => Array ( [stockCode] => CBL202659/A [quantity] => 8 ) [1] => Array ( [stockCode] => CBL201764 [quantity] => 6 ) [2] => TEST TEST ) I would like it to look like this: Array ( [0] => Array ( [stockCode] => CBL202659/A [quantity] => 8 ) [1] => Array ( [stockCode] => CBL201764 [quantity] => 6 ) [2] Array( [comment] => TEST TEST ) I added products to the array in a similar way and it worked fine: var productArray = []; // Will hold order Items $(".orderBtn").click(function(event){ //Check to ensure quantity > 0 if(quantity == 0){ console.log("Quantity must be greater than 0") }else{//It is so continue //Show the order Box $(".order-alert").show(); event.preventDefault(); //Get reference to the product clicked var stockCode = $(this).closest('li').find('.stock_code').html(); //Get reference to the quantity selected var quantity = $(this).closest('li').find('.order_amount').val(); //Order Item (contains stockCode and Quantity) - Can add whatever data I like here var orderItem = { 'stockCode' : stockCode, 'quantity' : quantity }; //Check if cookie exists if($.cookie('order_cookie') === undefined){ console.log("Creating new cookie"); //Add object to the Array productArray.push(orderItem);

    Read the article

  • PHP or JS to connect with fingerprint scanner save to database

    - by narong
    I have a project to set profile user and save all data to database include fingerprint also. i don't what i should start, I have USB finger scanner already to test. What i think: i should have a input box to read data from USB finger scanner than i should create a function to upload it database. but with this thinking i meet problem: i don't know data that get from USB finger scanner is image or data? if image, how i can read it to input box to save to database ? Anyone have any idea, please share me to resolve it. I am looking to see your helping soon! thanks

    Read the article

  • [DOM/JS] display table in IE

    - by budzor
    I have code like that: var xPola = 10, //how many cols yPola = 10, //how many cols bokPola = 30, //size of cell body = document.getElementsByTagName('body')[0]; var tablica = document.createElement('table'); body.appendChild(tablica); for( var y = 0; y < yPola; y++ ) { var rzad = document.createElement('tr'); tablica.appendChild(rzad); for( var x = 0; x < xPola; x++ ) { var pole = document.createElement('td'); pole.setAttribute('width', bokPola); pole.setAttribute('height', bokPola); rzad.appendChild(pole); } }; it works fine in FF, Chrome & Opera (it displays 10x10 table with 30px width&height rows). In IE nothing happens. I check in firebug lite and it is in HTML section, inside BODY tag but i see nothing. Whats wrong?

    Read the article

  • Angular.js: value() not injected in config()

    - by Nik
    I am having trouble getting the value() injected into the app.config(). Here's the code (coffeescript) window.app = angular.module("app", []) app.value("template_path", "assets/angular/templates/users") app.config(["$routeProvider","template_path" ($routeProvider, template_path) -> console.log template_path it is throwing an "Unknown provider: template_path from app" error Could it be that the config() method cannot be injected with value() set values? I am using 1.0.2 Thank you!

    Read the article

  • Get next key-value pair in an object

    - by captainclam
    So, given a key, I want to find the next property in an object. Then, I want to return the value of the NEXT property. I can not rely on the keys to be ordered or sequential (they're uuids). Please see below for trivial example of what I want: var db ={ a: 1, b: 2, c: 3 } var next = function(db, key) { // ??? } next(db, 'a'); // I want 2 next(db, 'b'); // I want 3 I also want a prev() function, but I'm sure it will be the same solution. This seems like such a trivial problem but I can't for the life of me figure out how to do it. Happy for the solution to use underscore.js or be written in coffeescript :)

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • JS Split ( ) to check if substring exists in Array

    - by Javacadabra
    I have an array of products that are stored as Strings in this format productname:quantity. The issue I am running into is that if a user adds one product with a quantity of x it is inserted into the array as it should. However, if they then decide to add more of a particular product a new entry is made into the array instead of checking if the product already exists and adjusting the quantity to the new value. oldQty + newQty. For example this is my array: ["CBL202659/A:1","OUTER9:1","PALLET CARDS:1"] If I add another PALLET CARDS product it creates a new entry rather than updating the quantity of the existing item to 2. New array ["CBL202659/A:1","OUTER9:1","PALLET CARDS:1","PALLET CARDS:1"] I would like the array to end up like this: - updating the quantity ["CBL202659/A:1","OUTER9:1","PALLET CARDS:2"] Currently this is my code: I use the split() method to seperate the String where a colon occurs and store the product name and quantity in two seperate variables. $(".orderBtn").click(function(event){ //Show the order Box $(".order-alert").show(); event.preventDefault(); //Create the Array var productArray = []; //Get reference to the product clicked var stockCode = $(this).closest('li').find('.stock_code').html(); //Get reference to the quantity selected var quantity = $(this).closest('li').find('.order_amount').val(); var item = stockCode + ":" + quantity; var itemCheck = stockCode + ":"; if(quantity == 0){ console.log("Quantity must be greater than 0") }else{ //If no Cookie exists, create one and add the Array if ($.cookie('order_cookie') === undefined) { console.log("CREATE NEW COOKIE"); //Add items to Array productArray.push(item); //Add Array to Cookie $.cookie('order_cookie', JSON.stringify(productArray), { expires: 1, path: '/' }); //If the Cookie already exists do this } else { productArray = JSON.parse($.cookie('order_cookie'));//get ref to array if(productArray.indexOf(itemCheck)!= -1){//It exists so update qty console.log("EXISTS... updating item: " + itemCheck); //var index = productArray.indexOf(item); //var update = productArray[index].split(":"); //var name = update[0]; //var oldQty = update[1]; //console.log(name + ":" + oldQty); //productArray[index] = item; }else{//It does not exist, so add to array console.log("Does not exist... adding new item: " + item); //Append items onto the Array productArray.push(item); } //Update the Cookie $.cookie('order_cookie', JSON.stringify(productArray), { expires: 1, path: '/' }); console.log($.cookie('order_cookie')); } //Display the number of items in the Array in the Order Box $('#order_counter').html(productArray.length); } }); I suppose the real question I am asking here, is if it is possible to search the array for a subString - containing productname: ??

    Read the article

  • require.js - How can I set a version on required modules as part of the URL?

    - by Ovesh
    I am using require.js to require JS modules in my application. I need a way to bust client cache on new JS modules, by way of a different requested URL. i.e., if the file hello/there.js has already been cached on the client, I can change the file name to force the browser to get the new file. In other words, for the module hello/there, I'd like require.js to request the url hello/there___v1234___.js (the file name can look different, it's just an example), according to a version string which is accessible on the client. What is the best way to achieve that?

    Read the article

  • I want to style within JS

    - by 422
    Issue I have is I can use tags, but I would like to style particular words. Adding a class doesnt work, is it because I am within script dom ? Example: var config = [ { "name" : "tour_1", "bgcolor" : "black", "color" : "white", "position" : "BR", "text" : "Customize your user profile, it's easy. This is your shop window on <strong>here</strong> and <strong>there</strong>", "time" : 4000 } Instead of strong, I would like to apply class, like <p class="orange"> But it wont have it, any suggestions... please

    Read the article

  • MooTools is not a function js error

    - by Adriane
    hello whatever i append to $('click_filter1') it shows the error ... is not a function (for show(), hide(), toggle()) if i insert an alert, the alert gets executed, so the framework is init ok the element with the id exists for sure what can be the problem of this? why iam getting this error? $('click_filter1').addEvent('click', function() { $('click_filter1').show(); }.bind(this));

    Read the article

  • Is it easy to develop a simple Firefox plugin (JS injection)

    - by Moons
    Hello everyone! So I was just wondering if it was easy to develop a very simple Firefox plugin where you could click a button, and it would execute some Javascript code! Please note that I have never developed any kind of plugin for firefox, I just want to know if that is an easy task to do (like less than an hour)

    Read the article

  • With JS add default date on TextBox

    - by senzacionale
    <asp:TextBox ID="txtDate" runat="server" AutoPostBack="true" OnTextChanged="txtDate_TextChanged"></asp:TextBox> how can with Jquery add default date. I do not know where and when to call this code: function addDefaultDate() { if ($('#txtDate').val().length == 0) { var now = new Date(); $('#txtDate').text(now.getDate() + '.' + now.getMonth() + '.' + now.getYear()); } }

    Read the article

  • Hide / show content via CSS:hover (or JS if need be)

    - by Chris
    I have the following html: <li> <span class="one">Stuff here</span> <span class="two">More stuff</span> </li> .one { display: block; } .two { display: none; } What is the easiest method, preferably CSS only, to hide one and show two when the mouse rolls over the <li> container. If this cannot be done via CSS and only Javascript, I would prefer jQuery via something like live() as the content is updated live and do not wish to constantly rebind manually. EDIT: I forgot to mention that this has to work in IE6 :/

    Read the article

  • trying to understand some codes related to window.onload in js

    - by user2507818
    <body> <script language="javascript"> window.tdiff = []; fred = function(a,b){return a-b;}; window.onload = function(e){ console.log("window.onload", e, Date.now() ,window.tdiff, (window.tdiff[1] = Date.now()) && window.tdiff.reduce(fred) ); } </script> </body> Above code is taken from a site. In firefox-console, it shows: window.onload load 1372646227664 [undefined, 1372646227664] 1372646227664 Question: For window.tdiff->[undefined, 1372646227664], why not:[], because when runs to code:window.tdiff, it is still an empty array? For window.tdiff.reduce(fred)->1372646227664, window.tdiff = [undefined, 1372646227664], undefined - 1372646227664, should be NaN, why it shows 1372646227664?

    Read the article

  • How can I get the Forever to write to a different log file every day?

    - by user1438940
    I have a cluster of production servers running a Node.JS app via Forever. As far as I can tell, my options for log files are as follows: Let Forever do it on its own, in which case it will log to ~/.forever/XXXX.log Specify one specific log file for the entire life of the process What I'd like to do, however, is have it log to a different file every day. eg. 20121027.log, 20121028.log, etc. Is this possible? If so, how can it be done?

    Read the article

  • JS regular expression to find a substring surrounded by double quotes

    - by 2619
    I need to find a substring surrounded by double quotes, for example, like "test", "te\"st" or "", but not """ neither "\". To achieve this, which is the best way to go for it in the following 1) /".*"/g 2) /"[^"\\]*(?:\\[\S\s][^"\\]*)*"/g 3) /"(?:\\?[\S\s])*?"/g 4) /"([^"\\]*("|\\[\S\s]))+/g I was asked this question yesterday during an interview, and would like to know the answer for future reference.

    Read the article

  • URL detection with JavaScript

    - by josh
    Hi! I'm using the following script to force a specific page - when loaded for the first time - into a (third-party) iFrame. <script type="text/javascript"> if(window.top==window) { location.reload() } else { } </script> (For clarification: This 'embedding' is done automatically by the third-party system but only if the page is refreshed once - for styling and some other reasons I want it there from the beginning.) Right now, I'm wondering if this script could be enhanced in ways that it's able to detect the current URL of its 'parent' document to trigger a specific action? Let's say the URL of the third-party site is 'http://cgi.site.com/hp/...' and the URL of the iFrame 'http://co.siteeps.com/hp/...'. Is it possible to realize sth. like this with JS: <script type="text/javascript"> if(URL is 'http://cgi.site.com/hp/...') { location.reload() } if(URL is 'http://co.siteeps.com/hp/...') { location.do-not.reload() resp. location.do-nothing() } </script> TIA josh

    Read the article

  • Trouble using ‘this.files’ in GruntJS Tasks

    - by whomba
    Background: So I’m new to writing grunt tasks, so hopefully this isn’t a stupid question. Purpose of my grunt task: Given a file (html / jsp / php / etc) search all the link / script tags, compare the href / src to a key, and replace with the contents of the file. Proposed task configuration: myTask:{ index:{ files:{src:"test/testcode/index.html", dest:"test/testcode/index.html"}, css:[ { file: "/css/some/css/file.css", fileToReplace:"/target/css/file.css" }, { file: "/css/some/css/file2.css", fileToReplace:"/target/css/file2.css" } ], js:[ { file: "/css/some/css/file.css", fileToReplace:”/target/css/file.css" }, { file: "/css/some/css/file2.css", fileToReplace:"/target/css/file2.css" } ] } } Problem: Now, per my understanding, when dealing with files, you should reference the ‘this.files’ object because it handles a bunch of nice things for you, correct? Using intelliJ and the debugger, I see the following when i watch the ‘this.files’ object: http://i.imgur.com/Gj6iANo.png What I would expect to see is src and dest to be the same, not dest ===‘src’ and src === undefined. So, What is it that I am missing? Is there some documentation on ‘this.files’ I can read about? I’ve tried setting the files attribute in the target to a number of other formats per grunts spec, none seem to work (for this script, ideally the src / dest would be the same, so the user would just have to enter it once, but i’m not even getting in to that right now.) Thanks for the help

    Read the article

  • Multiple mesh with one geometry and diferent textures. Error

    - by user1821834
    I have a loop where I create a multiple Mesh with different geometry, because each mesh has one texture: .... var geoCube = new THREE.CubeGeometry(voxelSize, voxelSize, voxelSize); var geometry = new THREE.Geometry(); for( var i = 0; i < voxels.length; i++ ){ var voxel = voxels[i]; var object; color = voxel.color; texture = almacen.textPlaneTexture(voxel.texto,color,voxelSize); //Return the texture with a color and a text for each face of the geometry material = new THREE.MeshBasicMaterial({ map: texture }); object = new THREE.Mesh(geoCube, material); THREE.GeometryUtils.merge( geometry, object ); } //Add geometry merged at scene mesh = new THREE.Mesh( geometry, new THREE.MeshFaceMaterial() ); mesh.geometry.computeFaceNormals(); mesh.geometry.computeVertexNormals(); mesh.geometry.computeTangents(); scene.add( mesh ); .... But now I have this error in the javascript code Three.js Uncaught TypeError: Cannot read property 'map' of undefined In the funcion: function bufferGuessUVType ( material ) { .... } Update: Finally I have removed the merged solution and I can use an unnique geometry for the all voxels. Altough I think that If I use merge meshes the app would have a better performance...

    Read the article

< Previous Page | 64 65 66 67 68 69 70 71 72 73 74 75  | Next Page >