Search Results

Search found 20785 results on 832 pages for 'idea'.

Page 688/832 | < Previous Page | 684 685 686 687 688 689 690 691 692 693 694 695  | Next Page >

  • Problem uploading app to google app engine

    - by Oberon
    I'm having problems uploading an app to the google-app-engine from my work place. I believe the problem is related to proxy, because I do not see the same problem when following the same procedure from home. (I do not specify HTTP_PROXY from home). These are the commands I run: HTTP_PROXY=http://proxy.<thehostname>.com:8080 HTTP_PROXY=https://proxy.<thehostname>.com:8080 appcfg.py --insecure update myappfolder When running the commands I get prompted for email and password, as expected, but after that it immediately exits with this errormessage: Error 302: --- begin server output --- <HTML> <HEAD> <TITLE>Moved Temporarily</TITLE> </HEAD> <BODY BGCOLOR="#FFFFFF" TEXT="#000000"> <H1>Moved Temporarily</H1> The document has moved <A HREF="https://www.google.com/accounts/ClientLogin">here</A>. </BODY> </HTML> --- end server output --- Note: I added the --insecure option because else it gave a warning of missing ssl module. Any idea how to solve or workaround this problem?

    Read the article

  • xml schema putting both sequence and all under one complexType node

    - by exiang
    Here is the xml file: <section> <number>1</number> <title>A Title goes here...</title> <code>TheCode</code> <element></element> <element></element> </section> In section node, there are number, title and code node. Their sequence must not be fixed. Then, there are multiple element under section node as well. The idea is to use the following schema: <xs:complexType name="Type-section"> <xs:all> <xs:element name="number" minOccurs="0"></xs:element> <xs:element name="code" minOccurs="1"></xs:element> <xs:element name="title" minOccurs="1"></xs:element> </xs:all> <xs:sequence> <xs:element maxOccurs="unbounded" name="element"></xs:element> </xs:sequence> </xs:complexType> But it is invalid. I just cant put "sequence" and "all" together in the same level. How can i fix it?

    Read the article

  • How to figure out which record has been deleted in an effiecient way?

    - by janetsmith
    Hi, I am working on an in-house ETL solution, from db1 (Oracle) to db2 (Sybase). We needs to transfer data incrementally (Change Data Capture?) into db2. I have only read access to tables, so I can't create any table or trigger in Oracle db1. The challenge I am facing is, how to detect record deletion in Oracle? The solution which I can think of, is by using additional standalone/embedded db (e.g. derby, h2 etc). This db contains 2 tables, namely old_data, new_data. old_data contains primary key field from tahle of interest in Oracle. Every time ETL process runs, new_data table will be populated with primary key field from Oracle table. After that, I will run the following sql command to get the deleted rows: SELECT old_data.id FROM old_data WHERE old_data.id NOT IN (SELECT new_data.id FROM new_data) I think this will be a very expensive operation when the volume of data become very large. Do you have any better idea of doing this? Thanks.

    Read the article

  • Basic security, PHP mySQl

    - by yuudachi
    So I am making a basic log-in page. I have a good idea of what to do, but I'm still unsure of some things. I have a database full of students and a password column of course. I know I'm going to use md5 encryption in that column. The student enters their e-mail and student ID, and they get e-mailed a password if correct. But, where do I create the password? Do I have to manually add the password (which is just a randomly generated string) in mySQL to all the students? And I am suppose to send the password to the student; how will I know what to send the student if the password is encrypted? I was thinking about generating the password when the student first enters their e-mail and student ID. They get an e-mail of the random string, and at the same time, I add the same random string to the database, encrypted. Is that how it's suppose to work though? And it feels unsafe doing that all on the same page. Sorry for the long-winded, newbish question. I find this all facisnating at the same time as well (AES and RSA encryption :O)

    Read the article

  • JVM GC demote object to eden space?

    - by Kevin
    I'm guessing this isn't possible...but here goes. My understanding is that eden space is cheaper to collect than old gen space, especially when you start getting into very large heaps. Large heaps tend to come up with long running applications (server apps) and server apps a lot of the time want to use some kind of caches. Caches with some kind of eviction (LRU) tend to defeat some assumptions that GC makes (temporary objects die quickly). So cache evictions end up filling up old gen faster than you'd like and you end up with a more costly old gen collection. Now, it seems like this sort of thing could be avoided if java provided a way to mark a reference as about to die (delete keyword)? The difference between this and c++ is that the use is optional. And calling delete does not actually delete the object, but rather is a hint to the GC that it should demote the object back to Eden space (where it will be more easily collected). I'm guessing this feature doesn't exist, but, why not (is there a reason it's a bad idea)?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Creating a global variable on the fly. [PHP ENCRYPTION]

    - by stormdrain
    Is there a way to dynamically create constant variables on the fly? The idea is that upon logging into the system, a user would be asked to upload a small text file that would be fread, and assigned to a var that would be accessible throughout the system. If this is possible, just to be clear, would this variable then only be accessible to that user and only while the session is alive? Security being the main concern here, would it be more practical to store the var in a session variable? The plan: Data in the db will be encrypted via mcrypt, and the key will be stored on USB thumbdrives. The user will insert the thumbdrive when going to access the system. Upon logging in, the app will prompt the user to upload the key. They will navigate to the thumbdrive and key. Via fopen and fread, the key will be assigned to a global var which will then allow access to encrypted data, and will be used to encrypt new info being entered to the db. When the user logs out, or session times out, the global var will become empty. Thanks!

    Read the article

  • Javascript Cookie Function not working for Domain

    - by danit
    Here are the functions Im using: Set Cookie: function set_cookie ( name, value, exp_y, exp_m, exp_d, path, domain, secure ) { var cookie_string = name + "=" + escape ( value ); if ( exp_y ) { var expires = new Date ( exp_y, exp_m, exp_d ); cookie_string += "; expires=" + expires.toGMTString(); } if ( path ) cookie_string += "; path=" + escape ( path ); if ( domain ) cookie_string += "; domain=" + escape ( domain ); if ( secure ) cookie_string += "; secure"; document.cookie = cookie_string; } Read Cookie: function get_cookie ( cookie_name ) { var results = document.cookie.match ( '(^|;) ?' + cookie_name + '=([^;]*)(;|$)' ); if ( results ) return ( unescape ( results[2] ) ); else return null; } Delete Cookie: function delete_cookie ( cookie_name ) { var cookie_date = new Date ( ); // current date & time cookie_date.setTime ( cookie_date.getTime() - 1 ); document.cookie = cookie_name += "=; expires=" + cookie_date.toGMTString(); } The Jquery I use to construct the cookie: if(get_cookie('visible')== 'no') { $("#wrapper").hide(); $(".help").hide(); $("#slid .show").show(); $("#slid .hide").hide(); } else { $("#slid .show").hide(); $("#slid .hide").show(); } $("#slider").click(function() { if(get_cookie('visible')== null) { set_cookie('visible','no', 2020, 01,01, '/', 'domain.com'); } else { delete_cookie('visible'); } $(".help").slideToggle(); $("#wrapper").animate({ opacity: 1.0 },200).slideToggle(200, function() { $("#slid img").toggle(); }); }); Im trying to set the cookie for all pages that exist under domain.com with the path '/'. However using these functions and jQuery it doesn't appear to be working, any anyone give me an idea of where im going wrong?

    Read the article

  • How to establish a socket connection from iPhone to a Apache server and communicate via PHP?

    - by candoyo
    Hi, I am working on an iPhone game which is depended on a LAMP server. I want to create a "event" based system where the apache server sends an event to the iphone. For this, I am thinking of using "CFStreamCreatePairWithSocketToHost" to connect to port 80 of the apache server. I am able to successfully connect to the server and open a read and write stream via the iPhone, but I am not sure how to send data to the iphone using PHP running from the LAMP server to the iPhone. I think I can use fsockopen in php to open a socket connection and write data to that socket. I tired running this code $fp = fsockopen("tcp://localhost", 80, $errno, $errstr); if (!$fp) { echo "ERROR: $errno - $errstr<br />\n"; } else { echo"writing to socket "; fwrite($fp, "wwqeqweqw eqwe qwe \n"); //echo fread($fp, 26); fclose($fp); echo "done"; } But, I dont see anything being read on the iphone.. Any idea what's going on, or how to accomplish this? Thanks!

    Read the article

  • Socket isn't listed by netstat unless using certain ports

    - by illuzive
    I'm a computer science student with a few years of programming experience. Yesterday, while working on a project (Mac OS X, BSD sockets) at school, I encountered a strange problem. I was adding several modules to a very basic "server" (mostly a bunch of functions to set up and manage an UDP socket on a certain port). While doing this, I started the server from time to time in order to see that everything worked like it should. I've been using port 32000 during the development of the server. When I start the server and run netstat, the socket is listed as expected. > netstat -p UDP | grep 32000 udp46 0 0 *.32000 *.* However, when I run the server on other ports (random (10000 - 50000)), it's not listed by netstat. My thought was that I had somehow hard coded the port somewhere in the code, but that's not the case. The thing is - I can connect to the socket on any of the tested ports, and it reads data sent to it without any problem at all. It just doesn't get listed by netstat. What I wonder, is if anyone of you have any idea of why this happens? Note: Although this is a project at school, it's not homework. This is just something I want to understand for my own benefit.

    Read the article

  • add dynamic field near his parent field?

    - by Kaps Hasija
    hi in my web page i am using Add Dynamic Field Functionality by using jquery. I am adding new div bu clicking on Existing div Like <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> by clicking on parent div i am creating new daynamic div <div class="divA">DivA2 </div> its coming end of the all div's like that <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> <div class="divA">DivA2 </div> But i need along with his parent div Like that <div class="divA">divA1 </div> <div class="divA">DivA2 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> any idea Thanks. This is My Jquery Code newTextBoxDiv = $(document.createElement('div')) .attr("id", text).attr("class", 'test0 ' + text); newTextBoxDiv.html('<div style=" width:150px; class="DivA" float: left"> </div>'); } newTextBoxDiv.appendTo("#contents"); contents is id of main div

    Read the article

  • What technology should I use to write my game?

    - by Alon
    I have a great idea for a 3D network game, and I've concluded that it is possible to write it in Java as an applet which will live under the web browser, just like a full software in C++. And it will look and feel the same. The main advantage of Java on C++ is that with Java you can play without downloading any software. I have already thought about the download of the graphics, sound, etc but I found a solution for it. RuneScape just proves that it is possible. So my first question is, should my game live on a web browser or on the operating system? I think that in a web browser it is much more portable, although you need install Java and stuff. But the fact is, that most MMO games are currently not in the web. If you suggest in a software so please suggest a language either - C++ or something more productive like Python or C#? So after choosing a language, I need a graphics solution. Should I write directly with OpenGL/DirectX or use a game engine? What game engine should I use? Ogre? jMonkeyEngine? What's your opinion? Thank you! P.S: Please don't use answers like "Use what you know".

    Read the article

  • Advice on a simple Windows Form

    - by Austin Hyde
    I have a VERY simple windows form that the user uses to manage "Stores". Each store has a name and number, and is kept in a corresponding DB table. The form has a listbox of stores, an add button that creates a new store, a delete button, and an edit button. Beside those I have text boxes for the name and number, and save/cancel buttons. When the user chooses a store from the list box, and clicks 'edit', the textboxes become populated and save/cancel become active. When the user clicks 'add', I create a new Store, add it to the listbox, activate the textboxes and save/cancel buttons, then commit it to the database when the user clicks 'save', or discards it when the user clicks 'cancel'. Right now, my event system looks like this (in psuedo-code. It's just shorter that way.) add->click: store = new Store() listbox.add(store) populateAndEdit(store) delete->click: store = listbox.selectedItem db.deleteOnSubmit(store) listbox.remove(store) db.submit() edit->click: populateAndEdit(listbox.selectedItem) save->click: parseAndSave(listbox.selectedItem) db.submit() disableTexts() cancel->click: disableTexts() The problem is in how I determine if we are inserting a new Store, or updating an existing one. The obvious solution to me would be to make it a "modal" process - that is, when I click edit, I go into edit mode, and the save button does things differently than if I were in add mode. I know I could make this more MVC-like, but I don't really think this simple form merits the added complexity. I'm not very experienced with winforms, so I'm not sure if I even have the right idea for how to tackle this. Is there a better way to do this? I would like to keep it simple, but usable.

    Read the article

  • Handling user interface in a multi-threaded application (or being forced to have a UI-only main thre

    - by Patrick
    In my application, I have a 'logging' window, which shows all the logging, warnings, errors of the application. Last year my application was still single-threaded so this worked [quite] good. Now I am introducing multithreading. I quickly noticed that it's not a good idea to update the logging window from different threads. Reading some articles on keeping the UI in the main thread, I made a communication buffer, in which the other threads are adding their logging messages, and from which the main thread takes the messages and shows them in the logging window (this is done in the message loop). Now, in a part of my application, the memory usage increases dramatically, because the separate threads are generating lots of logging messages, and the main thread cannot empty the communication buffer quickly enough. After the while the memory decreases again (if the other threads have finished their work and the main thread gradually empties the communication buffer). I solved this problem by having a maximum size on the communication buffer, but then I run into a problem in the following situation: the main thread has to perform a complex action the main thread takes some parts of the action and let's separate threads execute this while the seperate threads are executing their logic, the main thread processes the results from the other threads and continues with its work if the other threads are finished Problem is that in this situation, if the other threads perform logging, there is no UI-message loop, and so the communication buffer is filled, but not emptied. I see two solutions in solving this problem: require the main thread to do regular polling of the communication buffer only performing user interface logic in the main thread (no other logic) I think the second solution seems the best, but this may not that easy to introduce in a big application (in my case it performs mathematical simulations). Are there any other solutions or tips? Or is one of the two proposed the best, easiest, most-pragmatic solution? Thanks, Patrick

    Read the article

  • Extjs - Loading Grid when call

    - by Oxi
    I have form and grid. the user must enter data in form fields then display related records in the grid. I want to implement a search form, e.g: user will type the name and gender of the student, then will get a grid of all students have the same name and gender. So, I use ajax to send form fields value to PHP and then creat a json_encode wich will be used in grid store. I am really not sure if my idea is good. But I haven't found another way to do that. The problem is when I set autoLoad to true in the store, the grid automatically filled with all data - not just what I asked for - So, I understand that I have to set autoLoad to false, but then the result not shown in the grid even it returned successfully in the firebug! I don't know what to do. My View: { xtype: 'panel', layout: "fit", id: 'searchResult', flex: 7, title: '<div style="text-align:center;"/>SearchResultGrid</div>', items: [ { xtype: 'gridpanel', store: 'advSearchStore', id: 'AdvSearch-grid', columns: [ { xtype: 'gridcolumn', dataIndex: 'name', align: 'right', text: 'name' }, { xtype: 'gridcolumn', dataIndex: 'gender', align: 'right', text: 'gender' } ], viewConfig: { id : 'Arr' ,emptyText: 'noResult' }, requires: ['MyApp.PrintSave_toolbar'], dockedItems: [ { xtype: 'PrintSave_tb', dock: 'bottom', } ] } ] }, My Store and Model: Ext.define('AdvSearchPost', { extend: 'Ext.data.Model', proxy: { type: 'ajax', url: 'AdvSearch.php', reader: { type: 'json', root: 'Arr', totalProperty: 'totalCount' } }, fields: [ { name: 'name'}, { name: 'type_and_cargo'} ] }); Ext.create('Ext.data.Store', { pageSize: 10, autoLoad: false, model: 'AdvSearchPost', storeId: 'AdvSearchPost' });

    Read the article

  • MySQL SELECT combining 3 SELECTs INTO 1

    - by Martin Tóth
    Consider following tables in MySQL database: entries: creator_id INT entry TEXT is_expired BOOL other: creator_id INT entry TEXT userdata: creator_id INT name VARCHAR etc... In entries and other, there can be multiple entries by 1 creator. userdata table is read only for me (placed in other database). I'd like to achieve a following SELECT result: +------------+---------+---------+-------+ | creator_id | entries | expired | other | +------------+---------+---------+-------+ | 10951 | 59 | 55 | 39 | | 70887 | 41 | 34 | 108 | | 88309 | 38 | 20 | 102 | | 94732 | 0 | 0 | 86 | ... where entries is equal to SELECT COUNT(entry) FROM entries GROUP BY creator_id, expired is equal to SELECT COUNT(entry) FROM entries WHERE is_expired = 0 GROUP BY creator_id and other is equal to SELECT COUNT(entry) FROM other GROUP BY creator_id. I need this structure because after doing this SELECT, I need to look for user data in the "userdata" table, which I planned to do with INNER JOIN and select desired columns. I solved this problem with selecting "NULL" into column which does not apply for given SELECT: SELECT creator_id, COUNT(any_entry) as entries, COUNT(expired_entry) as expired, COUNT(other_entry) as other FROM ( SELECT creator_id, entry AS any_entry, NULL AS expired_entry, NULL AS other_enry FROM entries UNION SELECT creator_id, NULL AS any_entry, entry AS expired_entry, NULL AS other_enry FROM entries WHERE is_expired = 1 UNION SELECT creator_id, NULL AS any_entry, NULL AS expired_entry, entry AS other_enry FROM other ) AS tTemp GROUP BY creator_id ORDER BY entries DESC, expired DESC, other DESC ; I've left out the INNER JOIN and selecting other columns from userdata table on purpose (my question being about combining 3 SELECTs into 1). Is my idea valid? = Am I trying to use the right "construction" for this? Are these kind of SELECTs possible without creating an "empty" column? (some kind of JOIN) Should I do it "outside the DB": make 3 SELECTs, make some order in it (let's say python lists/dicts) and then do the additional SELECTs for userdata? Solution for a similar question does not return rows where entries and expired are 0. Thank you for your time.

    Read the article

  • 60K+ Sprites on the 360?

    - by Jeffrey Kern
    Hey everyone, Just wondering - throwing ideas in my head - about starting a new XNA project for the 360. I would like it to be retro-old school, and emulating scanlines and color palettes and such. As part of this idea, what I would ideally like to do is manually draw each and every pixel of the screen. So, worst-case scenario I would have to draw about 60K sprites on a 252x240 resolution (I think thats correct). 60K sprites on the screen at a time. So, before I even attempt to code this - would the XBOX 360 be able to keep up with this even? That is a lot of sprites, but they aren't big sprites, and the texture data needed would be non-existant. However, I guess how this project would be implemented would make it or break it, but all I was thinking was coming up with a 2D array and mapping which color value would need to be drawn at that point. Of course, this is watered down talk right now. But what you all suggest? EDIT: Each sprite would represent one pixel. E.g., a sprite at 0,0. Another at 0,1. etc.

    Read the article

  • Problem with Boost::Asio for C++

    - by Martin Lauridsen
    Hi there, For my bachelors thesis, I am implementing a distributed version of an algorithm for factoring large integers (finding the prime factorisation). This has applications in e.g. security of the RSA cryptosystem. My vision is, that clients (linux or windows) will download an application and compute some numbers (these are independant, thus suited for parallelization). The numbers (not found very often), will be sent to a master server, to collect these numbers. Once enough numbers have been collected by the master server, it will do the rest of the computation, which cannot be easily parallelized. Anyhow, to the technicalities. I was thinking to use Boost::Asio to do a socket client/server implementation, for the clients communication with the master server. Since I want to compile for both linux and windows, I thought windows would be as good a place to start as any. So I downloaded the Boost library and compiled it, as it said on the Boost Getting Started page: bootstrap .\bjam It all compiled just fine. Then I try to compile one of the tutorial examples, client.cpp, from Asio, found (here.. edit: cant post link because of restrictions). I am using the Visual C++ compiler from Microsoft Visual Studio 2008, like this: cl /EHsc /I D:\Downloads\boost_1_42_0 client.cpp But I get this error: /out:client.exe client.obj LINK : fatal error LNK1104: cannot open file 'libboost_system-vc90-mt-s-1_42.lib' Anyone have any idea what could be wrong, or how I could move forward? I have been trying pretty much all week, to get a simple client/server socket program for c++ working, but with no luck. Serious frustration kicking in. Thank you in advance.

    Read the article

  • SQL Server problems reading columns with a foreign key

    - by illdev
    I have a weird situation, where simple queries seem to never finish for instance SELECT top 100 ArticleID FROM Article WHERE ProductGroupID=379114 returns immediately SELECT top 1000 ArticleID FROM Article WHERE ProductGroupID=379114 never returns SELECT ArticleID FROM Article WHERE ProductGroupID=379114 never returns SELECT top 1000 ArticleID FROM Article returns immediately By 'returning' I mean 'in query analyzer the green check mark appears and it says "Query executed successfully"'. I sometimes get the rows painted to the grid in qa, but still the query goes on waiting for my client to time out - 'sometimes': SELECT ProductGroupID AS Product23_1_, ArticleID AS ArticleID1_, ArticleID AS ArticleID18_0_, Inventory_Name AS Inventory3_18_0_, Inventory_UnitOfMeasure AS Inventory4_18_0_, BusinessKey AS Business5_18_0_, Name AS Name18_0_, ServesPeople AS ServesPe7_18_0_, InStock AS InStock18_0_, Description AS Descript9_18_0_, Description2 AS Descrip10_18_0_, TechnicalData AS Technic11_18_0_, IsDiscontinued AS IsDisco12_18_0_, Release AS Release18_0_, Classifications AS Classif14_18_0_, DistributorName AS Distrib15_18_0_, DistributorProductCode AS Distrib16_18_0_, Options AS Options18_0_, IsPromoted AS IsPromoted18_0_, IsBulkyFreight AS IsBulky19_18_0_, IsBackOrderOnly AS IsBackO20_18_0_, Price AS Price18_0_, Weight AS Weight18_0_, ProductGroupID AS Product23_18_0_, ConversationID AS Convers24_18_0_, DistributorID AS Distrib25_18_0_, type AS Type18_0_ FROM Article AS articles0_ WHERE (IsDiscontinued = '0') AND (ProductGroupID = 379121) shows this behavior. I have no idea what is going on. Probably select is broken ;) I got a foreign key on ProductGroups ALTER TABLE [dbo].[Article] WITH CHECK ADD CONSTRAINT [FK_ProductGroup_Articles] FOREIGN KEY([ProductGroupID]) REFERENCES [dbo].[ProductGroup] ([ProductGroupID]) GO ALTER TABLE [dbo].[Article] CHECK CONSTRAINT [FK_ProductGroup_Articles] there are some 6000 rows and IsDiscontinued is a bit, not null, but leaving this condition out does not change the outcome. Anyone can tell me how to handle such a situation? More info, anyone? Additional Info: this does not seem to be restricted to this Foreign Key, but all/some referencing this entity.

    Read the article

  • jQuery/ajax working on IIS5.1 but not IIS6

    - by Mikejh99
    I'm running a weird issue here. I have code that makes jquery ajax calls to a web service and dynamically adds controls using jquery. Everything works fine on my dev machine running IIS 5.1, but not when deployed to IIS 6. I'm using VS2010/ASP.Net 4.0, C#, jQuery 1.4.2 and jQuery UI 1.8.1. I'm using the same browser for each. It partially works though. The code will add the controls to the page, but they aren't visible until I click them (they aren't visible though). I thought this was a css issue, but the styles are there too. The ajax calls look like this: $.ajax({ url: "/WebServices/AssetManager.asmx/Assets", type: "POST", datatype: "json", async: false, data: "{'q':'" + req.term + "', 'type':'Condition'}", contentType: "application/javascript; charset=utf-8", success: function (data) { res($.map(data.d, function (item) { return { label: item.Name, value: item.Name, id: item.Id, datatype: item.DataType } })) } }) Changing the content-type makes the autocomplete fail. I've quadruple checked and all the paths are correct, there is no document footer enabled in IIS, and I'm not using IIS compression. Any idea why the page will display and work properly in IIS 5 but only partially in IIS 6? (If it failed completely, that'd make more sense!). Is it a jQuery or CSS issue?

    Read the article

  • Creating a ComboBox with one or more separator items?

    - by Steve
    I'm using Delphi7 and I'd like to have a ComboBox with separator items (Just like in popup menus). I've seen this beautifully implemented in Mozilla Sunbird (I know, it's not Delphi...) the following way: The separator item is a simple gray line drawn in the center of the item If you hover over the separator with the mouse, the selection doesn't appear If the user clicks the separator, it's not selected either AND the combobox doesn't closeup. No. 1 could be implemented using DrawItem. I could live without No. 2 because I have no idea about that. For No. 3 I'm asking for your help. I've figured out that straight after closing up a CBN_CLOSEUP message is sent to the combobox. I thought about hooking the window proc and if CBN_CLOSEUP is sent to a certain combobox then countering it. But I'm unsure if this is the best solution, or maybe there are other, more elegant ways? Whatever the solution is, I'd like to have a standard ComboBox which supports WinXP/Vista/7 theming properly. Thanks! Edit: For a working component please see this thread: Can you help translating this very small C++ component to Delphi?

    Read the article

  • Need to reload current_cart to get the test passed

    - by leomayleomay
    I'm testing my online store app with RSpec, here's what I'm doing: # spec/controllers/line_items_controller_spec.rb require 'spec_helper' describe LineItemsController do describe "POST 'create'" do before do @current_cart = Factory(:cart) controller.stub!(:current_cart).and_return(@current_cart) end it 'should merge two same line_items into one' do @product = Factory(:product, :name => "Tee") post 'create', {:product_id => @product.id} post 'create', {:product_id => @product.id} assert LineItem.count.should == 1 assert LineItem.first.quantity.should == 2 end end end # app/controllers/line_items_controller.rb class LineItemsController < ApplicationController def create current_cart.line_items.each do |line_item| if line_item.product_id == params[:product_id] line_item.quantity += 1 if line_item.save render :text => "success" else render :text => "failed" end return end end @line_item = current_cart.line_items.new(:product_id => params[:product_id]) if @line_item.save render :text => "success" else render :text => "failed" end end end The problem right now is it never added up two line_items having the same product into one, because the second time I entered into the line_items_controller#create, the current_cart.line_items is [], I have run current_cart.reload to get the test passed, any idea what's going wrong?

    Read the article

  • GUI Agent accepts statuses from Daemon and shows it using progress indicator

    - by Pavel
    Hi to all! My application is a GUI agent, which communicate with daemon through the unix domain socket, wrapped in CFSocket.... So there are main loop and added CFRunLoop source. Daemon sends statuses and agent shows it with a progress indicator. When there are any data on socket, callback function begin to work and at this time I have to immediately show the new window with progress indicator and increase counter. //this function initiate the runloop for listening socket - (int) AcceptDaemonConnection:(ConnectionRef)conn { int err = 0; conn->fSockCF = CFSocketCreateWithNative(NULL, (CFSocketNativeHandle) conn->fSockFD, kCFSocketAcceptCallBack, ConnectionGotData, NULL); if (conn->fSockCF == NULL) err = EINVAL; if (err == 0) { conn->fRunLoopSource = CFSocketCreateRunLoopSource(NULL, conn->fSockCF, 0); if (conn->fRunLoopSource == NULL) err = EINVAL; else CFRunLoopAddSource(CFRunLoopGetCurrent(), conn->fRunLoopSource, kCFRunLoopDefaultMode); CFRelease(conn->fRunLoopSource); } return err; } // callback function void ConnectionGotData(CFSocketRef s, CFSocketCallBackType type, CFDataRef address, const void * data, void * info) { #pragma unused(s) #pragma unused(address) #pragma unused(info) assert(type == kCFSocketAcceptCallBack); assert( (int *) data != NULL ); assert( (*(int *) data) != -1 ); TStatusUpdate status; int nativeSocket = *(int *) data; status = [agg AcceptPacket:nativeSocket]; // [stWindow InitNewWindow] inside [agg SendUpdateStatus:status.percent]; } AcceptPacket function receives packet from the socket and trying to show new window with progress indicator. Corresponding function is called, but nothing happens... I think, that I have to make work the main application loop with interrupting CFSocket loop... Or send a notification? No idea....

    Read the article

  • ASP Function that returns result from stored procedures

    - by Brad
    I am working on a project that requires me to hop into to separate DB's. So I have figured that I need to have multiple functions inside of my VB page. The only problem I am having,is I am not to sure how to get this all accomplished. So far I have figured out the overall structure, just need help implementing that structure. Here is my idea: The main Function would call two other functions. We can Call them Sub Function 1 and Sub Function 2. So, the main Function takes the saved sessions information for the E-mail address and dumps in into Sub Function 1. It needs to open up a new connection to the db/stored procedure and RUN the following procedure and then return the result. Here is the stored procedure and what i think is correct. CREATE PROCEDURE WEB_User ( @EMAIL_ADDRESS varchar(80) = [EMAIL_ADDRESS] ) AS SELECT MEMBER_NUMBER FROM WEB_LOGIN WHERE EMAIL_ADDRESS = @EMAIL_ADDRESS So my question is, what is the function suppose to look like? how do I send the session information to the procedure? and finally, how do I return the stored procedure results and push back into the main function so it can be carried into sub function 2? Thank you in advance for your help... I really appreciate it!

    Read the article

  • pthread_exit and/or pthread_join causing Abort and SegFaults.

    - by MJewkes
    The following code is a simple thread game, that switches between threads causing the timer to decrease. It works fine for 3 threads, causes and Abort(core dumped) for 4 threads, and causes a seg fault for 5 or more threads. Anyone have any idea why this might be happening? #include <stdio.h> #include <stdlib.h> #include <pthread.h> #include <errno.h> #include <assert.h> int volatile num_of_threads; int volatile time_per_round; int volatile time_left; int volatile turn_id; int volatile thread_running; int volatile can_check; void * player (void * id_in){ int id= (int)id_in; while(1){ if(can_check){ if (time_left<=0){ break; } can_check=0; if(thread_running){ if(turn_id==id-1){ turn_id=random()%num_of_threads; time_left--; } } can_check=1; } } pthread_exit(NULL); } int main(int argc, char *args[]){ int i; int buffer; pthread_t * threads =(pthread_t *)malloc(num_of_threads*sizeof(pthread_t)); thread_running=0; num_of_threads=atoi(args[1]); can_check=0; time_per_round = atoi(args[2]); time_left=time_per_round; srandom(time(NULL)); //Create Threads for (i=0;i<num_of_threads;i++){ do{ buffer=pthread_create(&threads[i],NULL,player,(void *)(i+1)); }while(buffer == EAGAIN); } can_check=1; time_left=time_per_round; turn_id=random()%num_of_threads; thread_running=1; for (i=0;i<num_of_threads;i++){ assert(!pthread_join(threads[i], NULL)); } return 0; }

    Read the article

< Previous Page | 684 685 686 687 688 689 690 691 692 693 694 695  | Next Page >