Search Results

Search found 24117 results on 965 pages for 'write'.

Page 689/965 | < Previous Page | 685 686 687 688 689 690 691 692 693 694 695 696  | Next Page >

• Using Large Arrays in VB.NET

  - by Tim

  I want to extract large amounts of data from Excel, manipulate it and put it back. I have found the best way to do this is to extract the data from an Excel Range in to a large array, change the contents on the array and write it back to the Excel Range. I am now rewriting the application using VB.NET 2008/2010 and wish to take advantage of any new features. Currently I have to loop through the contents of the array to find elements with certain values; also sorting large arrays is cumbersome. I am looking to use the new features, including LINQ to manipulate the data in my array. Does anybody have any advice on the easiest ways to filter / query, sort etc. data in a large array. Also what are the reasonable limits to the size of the array? ~Many Thanks

  Read the article

• RTL shows numbers at the end of lines

  - by Tiger

  Hi. Trying to display a hebrew string that starts with a number, always displays the number at the end of the string like so: 1. ??? ???? ????? but I need the number to be displayed at the right side of the text- any solution to that? It happens with UILabel & UITextField & UITextView and trying to write the number at the left side also produce the same resault. Playing with combinations of UITextAlignment will doesn't help.

  Read the article

• Boost ASIO read X bytes synchroniously into a vector

  - by xeross

  Hey, I've been attempting to write a client/server app with boost now, so far it sends and receives but I can't seem to just read X bytes into a vector. If I use the following code vector<uint8_t> buf; for (;;) { buf.resize(4); boost::system::error_code error; size_t len = socket.read_some(boost::asio::buffer(buf), error); if (error == boost::asio::error::eof) break; // Connection closed cleanly by peer. else if (error) throw boost::system::system_error(error); // Some other error. } And the packet is bigger then 4 bytes then it seems it keeps writing into those 4 bytes until the entire packet has been received, however I want it to fetch 4 bytes, then allow me to parse them, and then get the rest of the packet. Can anyone provide me with a working example, or at least a pointer on how to make it work properly ? Regards, Xeross

  Read the article

• CSV file download ignored in ie8/9

  - by JBB

  I have some code in a button click event which gets a csv string from a hidden input and writes it to the response as a CSV file. This work fine in Chrome, Firefox, ie7, ie9 in quirks mode. However it does not work in ie8 or ie9 default. Looking at this in fiddler the csv is being written to the response but the another get request is being made immediately after and the page reloads. No file saving dialog appears. protected void btnCsvHidden_Click(object sender, EventArgs e) { var csv = csvString.Value; var filename = "Reporting"; Response.Clear(); Response.ClearHeaders(); Response.AddHeader("Cache-Control", "no-store, no-cache"); Response.AddHeader("content-disposition", "attachment; filename=\"" + filename + ".csv\""); Response.ContentType = "text/csv"; Response.Write(csv); Response.End(); }

  Read the article

• How to use window.location.replace javascript?

  - by william

  My URLs http://www.mysite.com/folder1/page1.aspx http://www.mysite.com/folder1/page1.aspx?id=1 http://www.mysite.com/folder1/page1.aspx?id=1&dt=20111128 Redirecting Page http://www.mysite.com/folder1/page2.aspx I want to redirect from page1.aspx to page2.aspx How to write a javascript in page1.aspx? window.location.replace("/page2.aspx"); window.location.replace("../page2.aspx"); window.location.replace("~/page2.aspx"); First 2 gave me this. http://www.mysite.com/page2.aspx Last 1 gave me this. http://www.mysite.com/folder1/~/page2.aspx What is the correct way to use?

  Read the article

• Ruby On Rails: Ask for Confirmation When Table Entry Associated With Another Is Destroyed

  - by Train Main

  Hi all, I would like some assistance with the following problem: I have a table of groups that is self-associated with itself, so each group is (optionally) linked to another in a hierarchical fashion. I want to write some code that will somehow check before the destruction of a group entry, if it has any children, and ask the user for confirmation, or whether they wish to delete the child groups as well. I've looked at callbacks, but I don't know how to get the confirmation request to the end user in the view, and then get the response back to the model's callback. Thanks

  Read the article

• Writing an OS for Motorola 68K processor. Can I emulate it? And can I test-drive OS development?

  - by ulver

  Next term, I'll need to write a basic operating system for Motorola 68K processor as part of a course lab material. Is there a Linux emulator of a basic hardware setup with that processor? So my partners and I can debug quicker on our computers instead of physically restarting the board and stuff. Is it possible to apply test-driven development technique to OS development? Code will be mostly assembly and C. What will be the main difficulties with trying to test-drive this? Any advice on how to do it?

  Read the article

• How to set Single GtkLebel Color to while using gtkrc?

  - by PP

  How to set Single GtkLebel Color to while using gtkrc? I tried to set as follows: In rc file: style "tc-theme-label-white" { xthickness = 1 ythickness = 1 font_name = "Sans Bold 8" text[NORMAL] = "#FFFFFF" text[INSENSITIVE] = "#434346" text[PRELIGHT] = "#FFFFFF" text[SELECTED] = "#FFFFFF" text[ACTIVE] = "#FFFFFF" } widget "*.my-theme-label" style:highest "my-theme-label" //And in code i have written. Gtk *label = gtk_new_label(null); gtk_widget_set_name(label_ptr, "my-theme-label"); Is this the write way of doing it? as usual it is not working. :p Thanks, PP.

  Read the article

• Asp.net mvc html melper

  - by tom

  Hi there Ive got this function as a html helper which should write a javascript function onto the page, I then call this in the masterpage like this <%Html.RenderBaseUrlScript(); % My problem is that the script never seems to be written to the page, I search in the source and cannot see it anywhere, I have tried moving this around from the head to the body of the html masterpage, Im really confused as to why this is not workung, please help public static string RenderBaseUrlScript(this HtmlHelper helper) { return string.Format("<script type='text/javascript'> $.url=function(url){{return '{0}'+url;}}", GetBaseUri()); }

  Read the article

• Objective-C: how to splt a string constant across multiple lines

  - by Ilya

  Hi, I have a pretty long sqlite query: const char *sql_query = "SELECT statuses.word_id FROM lang1_words, statuses WHERE statuses.word_id = lang1_words.word_id ORDER BY lang1_words.word ASC"; How can I break it in a number of lines to make it easier to read? If I do the following: const char *sql_query = "SELECT word_id FROM table1, table2 WHERE table2.word_id = table1.word_id ORDER BY table1.word ASC"; I am getting a error. Is there a way to write queries in multiple lines? Thank you.

  Read the article

• Where Not In OR Except simulation of SQL in LINQ to Object(C#)

  - by Thinking

  Suppose I have two lists that holds the list of source file names and destination file names respectively. The Sourcefilenamelist has files as 1.txt, 2.txt,3.txt, 4.txt while the Destinaitonlist has 1.txt,2.txt. I ned to write a linq query to find out which files are in SourceList that are absent in DestinationFile list. e.g. here the out put will be 3.txt and 4.txt. I have done this by a foreach statement.. but now I want to do the same by using LINQ(C#). Help needed. Thanks

  Read the article

• Invalid parameter used when trying to save a graphic image of mms.

  - by Sheery

  Hi, I have an application build in C# using PC Suite API, when i am trying to copy mms image to my PC it gives me an error of invalid parameters, can any one help me in this matter ...my code is dataVersit = (CAContentAccess.CADataDefinitions.CA_DATA_VERSIT)Marshal.PtrToStructure(bufData, typeof(CAContentAccess.CADataDefinitions.CA_DATA_VERSIT)); byte[] bVersitObject = new byte[dataVersit.iDataLength]; Marshal.Copy(dataVersit.pbVersitObject, bVersitObject, 0 , dataVersit.iDataLength); System.IO.Stream ios = System.IO.File.Open(fileDlg.FileName, System.IO.FileMode.Create); ios.Write(bVersitObject, bVersitObject.GetLowerBound(0), dataVersit.iDataLength); ios.Flush(); ios.Close();

  Read the article

• Multiple column Union Query without duplicates

  - by Adam Halegua

  I'm trying to write a Union Query with multiple columns from two different talbes (duh), but for some reason the second column of the second Select statement isn't showing up in the output. I don't know if that painted the picture properly but here is my code: Select empno, job From EMP Where job = 'MANAGER' Union Select empno, empstate From EMPADDRESS Where empstate = 'NY' Order By empno The output looks like: EMPNO JOB 4600 NY 5300 MANAGER 5300 NY 7566 MANAGER 7698 MANAGER 7782 MANAGER 7782 NY 7934 NY 9873 NY Instead of 5300 and 7782 appearing twice, I thought empstate would appear next to job in the output. For all other empno's I thought the values in the fields would be (null). Am I not understanding Unions correctly, or is this how they are supposed to work? Thanks for any help in advance.

  Read the article

• Class decorator to declare static member (e.g., for log4net)?

  - by Ken

  I'm using log4net, and we have a lot of this in our code: public class Foo { private static readonly ILog log = LogManager.GetLogger(typeof(Foo)); .... } One downside is that it means we're pasting this 10-word section all over, and every now and then somebody forgets to change the class name. The log4net FAQ also mentions this alternative possibility, which is even more verbose: public class Foo { private static readonly ILog log = LogManager.GetLogger(System.Reflection.MethodBase.GetCurrentMethod().DeclaringType); ... } Is it possible to write a decorator to define this? I'd really like to say simply: [LogMe] // or perhaps: [LogMe("log")] public class Foo { ... } I've done similar things in other languages, but never a statically-compiled language like C#. Can I define class members from a decorator?

  Read the article

• Macro to create macros?

  - by JMarsch

  Over the years, I've built up a number of macros that I like to have available in visual studio. It's always a pain to reload them and rebind them to the keyboard when I go to a different machine/rebuild/use a VM/etc. Someone mentioned to me once that there is a way that you can write a macro that will recreate your macros and bind them to keys automatically. Anyone know how to do that? Is there another way to easily export/import macros (nonsensically, VS has an "export macro" function, but no import).

  Read the article

• finding the numbers in a given range?

  - by Jamis

  Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

  Read the article

• Extension methods on a static object

  - by Max Malygin

  I know (or so I hear) that writing extension methods for a single stand alone .net class (not an implementation of IEnumerable) is potential code smell. However, for the sake of making the life easier I need to attach a method to the ConfigurationManager class in asp.net. It's a static object so this won't work: public static List<string> GetSupportedDomains(this ConfigurationManager manager) { //the manager needs to be static. } So the question is - is it possible to write an extension method for a static class in .net?

  Read the article

• Xpath help function

  - by NA

  Hi i have a document from which i am trying to extract a date. But the problem is within the node along with the date their is some text too. Something like <div class="postHeader"> Posted on July 20, 2009 9:22 PM PDT </div> From this tag i just want the date item not the Posted on text. something like ./xhtml:div[@class = 'postHeader'] is getting everything. and to be precise, the document i have is basically a nodelist of this elements for eg i will get 10 nodes of these elements with different date values but to be worse the problem is sometime inside these tags some random other tags also pops us like anchors etc. Can i write a universal expath which will just get the date out of the div tag?

  Read the article

• VSS Analyze - Access to file [filename] is denied

  - by AJ

  Our VSS database appears to be horribly out of shape. I've been trying to archive and run "analyze" and keep getting "Access to file [filename] is denied. The file may be read-only, may be in use, or you may not have permission to write to the file. Correct this problem and run analyze again." No one is logged into SourceSafe (including myself) and I'm running the analyze utility from the VS command prompt as follows: analyze -v -f -bbackuppath databasepath I get similar errors if I try and create project archives from the ssadmin tool. The database is on a network share, and we're running VSS 2005 v8.0.50727.42. I'd love to be able to do this, as it would be a first step in a move away from VSS. Thanks in advance. More Info Every time I run analyze, the file that spawns the access denied message changes. It's almost as if running analyze unlocks that file so that the next time I get through to the next one.

  Read the article

• Iterating through facebook comments JSON object failing

  - by user1594304

  I tried the option of students.item["http://www.myurl.com"].comments.data.length. However, the item["http://www.myurl.com"] call is not working. If I take out the URL from JSON object and write the iterator with students.comments.data, it works. Here is my code, any help highly appreciated. var students = { "http://www.myurl.com":{ "comments":{ "data" : [ { "id": "123456778", "from": { "name": "XYZ", "id": "1000005" }, "message": "Hey", "can_remove": false, "created_time": "2012-09-03T03:16:01+0000", "like_count": 0, "user_likes": false } ] } } } var i=0 var arrayObject = new Array(); alert("Parsing 2: "+students.item["http://www.myurl.com"].comments.data.length); for(i=0;i<students.item["http://www.myurl.com"].comments.data.length;i++) { alert("Parsing 1: "+i); arrayObject.push(students.item["http://www.myurl.com"].comments.data[i].id); arrayObject.push(students.item["http://www.myurl.com"].comments.data[i].message); arrayObject.push(students.item["http://www.myurl.com"].comments.data[i].created_time); }

  Read the article

• Error messages in ASP.NET with jQuery UI

  - by eugeneK

  I've been using my own Error reporting module which was combination of simple c# and jQueryUI Dialog. Problem is that once error or success occurs i do write it's value to session. It does work pretty good on pages with Responce.Redirect on error but not on pages where i catch an error and then return to same form. My question is why does session which added pre-postback fails to load in pages where i have return statement on some condition. And if there another way to save errors and success message except in session ? Maybe global variables or something like that ...

  Read the article

• Idea for doing almost same work in both catch & finally(C#3.0)

  - by Newbie

  I have a requirement. I am processing some files and after the processing are done I am archiving those files into an archive folder with timestamp appended. The file archiving and putting time stamp portion I am doing in the Finally block. Now a new requirement has come where I need to mail if something wrong goes in the original files and then I need to archive the same. Now this piece of code I need to handle in the catch block. But if I write the code entirely in the catch block, then it will fire only if there is an exception; otherwise not. So basically I am writing the same pice of code in both the catch and finally block. What is the standard and recommended approach you people think will be better in this case? I am using C#3.0 Thanks.

  Read the article

• Send data over telnet without pressing enter

  - by Matt

  I've recently started messing around with Java sockets and telnet... I want the user to be able to connect to the server, just type a letter and have it sent to the server, without pressing enter to send it. I'm sure there's no way for the server to set this up, but maybe telnet has a parameter or something which could allow this? Maybe if I got the user to type stty cbreak or stty raw before running telnet, this would work? (UNIX only, I know!) If I can get telnet to do this then it saves me having to write a special client just for this feature...

  Read the article

• Perl : How to print all cp1252 characters on by one ?

  - by Vinay

  Hi,i am not able to write a script to print all the latin -1 characters one by one.Can anybody help me in solving the problem? I am using the below code but it is not giving me expected result. foreach $char(0..255) { $hexval = sprintf("%x",$char); $charval = sprintf("%c",%hexval); print "$charval"; } output should be like :- 0065 - e 0066 - f ... ... 007F - character at the step For all the codepoints after 007F,it is not giving me expected results. Please help me out with this

  Read the article

• Bash - replacing targeted files with a specific file, whitespace in directory names

  - by Dispelwolf

  I have a large directory tree of files, and am using the following script to list and replace a searched-for name with a specific file. Problem is, I don't know how to write the createList() for-loop correctly to account for whitespace in a directory name. If all directories don't have spaces, it works fine. The output is a list of files, and then a list of "cp" commands, but reports directories with spaces in them as individual dirs. aindex=1 files=( null ) [ $# -eq 0 ] && { echo "Usage: $0 filename" ; exit 500; } createList(){ f=$(find . -iname "search.file" -print) for i in $f do files[$aindex]=$(echo "${i}") aindex=$( expr $aindex + 1 ) done } writeList() { for (( i=1; i<$aindex; i++ )) do echo "#$i : ${files[$i]}" done for (( i=1; i<$aindex; i++ )) do echo "/usr/bin/cp /cygdrive/c/testscript/TheCorrectFile.file ${files[$filenumber]}" done } createList writeList

  Read the article

< Previous Page | 685 686 687 688 689 690 691 692 693 694 695 696  | Next Page >