Search Results

Search found 24117 results on 965 pages for 'write'.

Page 689/965 | < Previous Page | 685 686 687 688 689 690 691 692 693 694 695 696  | Next Page >

  • CSV file download ignored in ie8/9

    - by JBB
    I have some code in a button click event which gets a csv string from a hidden input and writes it to the response as a CSV file. This work fine in Chrome, Firefox, ie7, ie9 in quirks mode. However it does not work in ie8 or ie9 default. Looking at this in fiddler the csv is being written to the response but the another get request is being made immediately after and the page reloads. No file saving dialog appears. protected void btnCsvHidden_Click(object sender, EventArgs e) { var csv = csvString.Value; var filename = "Reporting"; Response.Clear(); Response.ClearHeaders(); Response.AddHeader("Cache-Control", "no-store, no-cache"); Response.AddHeader("content-disposition", "attachment; filename=\"" + filename + ".csv\""); Response.ContentType = "text/csv"; Response.Write(csv); Response.End(); }

    Read the article

  • Boost ASIO read X bytes synchroniously into a vector

    - by xeross
    Hey, I've been attempting to write a client/server app with boost now, so far it sends and receives but I can't seem to just read X bytes into a vector. If I use the following code vector<uint8_t> buf; for (;;) { buf.resize(4); boost::system::error_code error; size_t len = socket.read_some(boost::asio::buffer(buf), error); if (error == boost::asio::error::eof) break; // Connection closed cleanly by peer. else if (error) throw boost::system::system_error(error); // Some other error. } And the packet is bigger then 4 bytes then it seems it keeps writing into those 4 bytes until the entire packet has been received, however I want it to fetch 4 bytes, then allow me to parse them, and then get the rest of the packet. Can anyone provide me with a working example, or at least a pointer on how to make it work properly ? Regards, Xeross

    Read the article

  • Using Large Arrays in VB.NET

    - by Tim
    I want to extract large amounts of data from Excel, manipulate it and put it back. I have found the best way to do this is to extract the data from an Excel Range in to a large array, change the contents on the array and write it back to the Excel Range. I am now rewriting the application using VB.NET 2008/2010 and wish to take advantage of any new features. Currently I have to loop through the contents of the array to find elements with certain values; also sorting large arrays is cumbersome. I am looking to use the new features, including LINQ to manipulate the data in my array. Does anybody have any advice on the easiest ways to filter / query, sort etc. data in a large array. Also what are the reasonable limits to the size of the array? ~Many Thanks

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • How to set Single GtkLebel Color to while using gtkrc?

    - by PP
    How to set Single GtkLebel Color to while using gtkrc? I tried to set as follows: In rc file: style "tc-theme-label-white" { xthickness = 1 ythickness = 1 font_name = "Sans Bold 8" text[NORMAL] = "#FFFFFF" text[INSENSITIVE] = "#434346" text[PRELIGHT] = "#FFFFFF" text[SELECTED] = "#FFFFFF" text[ACTIVE] = "#FFFFFF" } widget "*.my-theme-label" style:highest "my-theme-label" //And in code i have written. Gtk *label = gtk_new_label(null); gtk_widget_set_name(label_ptr, "my-theme-label"); Is this the write way of doing it? as usual it is not working. :p Thanks, PP.

    Read the article

  • How to group rows into two groups in sql?

    - by user1055638
    Lets say I have such a table: id|time|operation 1 2 read 2 5 write 3 3 read 4 7 read 5 2 save 6 1 open and now I would like to do two things: Divide all these records into two groups: 1) all rows where operation equals to "read" 2) all other rows. Sum the time in each group. So that my query would result only into two rows. What I got so far is: select sum(time) as total_time, operation group by operation ; Although that gives me many groups, depending on the number of distinct operations. How I could group them only into two categories? Cheers!

    Read the article

  • MySQL query problem

    - by FinalDestiny
    I have 2 mysql tables 1. questions: with the following columns: id, title, answer1, answer2, answer3, answer4, answer5, nranswers. and 2. answers with the following columns: id, questionid, userid, answer Every question has maximum 5 answers( it can have between 2 and 5 answers). My problem is that I want to select from my database, for a given question, how many times was every option selected. For example, let's suppose I have the question with the id 46, with 4 answers, and 48 users voted for the option #2, 37 users for the option #1 and 39 for the option #4. I want a query that selects that and write these things: 1 37 2 48 3 0 4 39 P.S. VERY IMPORTANT! IT MUST COUNT ONLY NRANSWERS ANSWERS, AND IT MUST ECHO THE ONES THAT WEREN'T VOTED BEFORE.

    Read the article

  • Ruby On Rails: Ask for Confirmation When Table Entry Associated With Another Is Destroyed

    - by Train Main
    Hi all, I would like some assistance with the following problem: I have a table of groups that is self-associated with itself, so each group is (optionally) linked to another in a hierarchical fashion. I want to write some code that will somehow check before the destruction of a group entry, if it has any children, and ask the user for confirmation, or whether they wish to delete the child groups as well. I've looked at callbacks, but I don't know how to get the confirmation request to the end user in the view, and then get the response back to the model's callback. Thanks

    Read the article

  • How to use window.location.replace javascript?

    - by william
    My URLs http://www.mysite.com/folder1/page1.aspx http://www.mysite.com/folder1/page1.aspx?id=1 http://www.mysite.com/folder1/page1.aspx?id=1&dt=20111128 Redirecting Page http://www.mysite.com/folder1/page2.aspx I want to redirect from page1.aspx to page2.aspx How to write a javascript in page1.aspx? window.location.replace("/page2.aspx"); window.location.replace("../page2.aspx"); window.location.replace("~/page2.aspx"); First 2 gave me this. http://www.mysite.com/page2.aspx Last 1 gave me this. http://www.mysite.com/folder1/~/page2.aspx What is the correct way to use?

    Read the article

  • Invalid parameter used when trying to save a graphic image of mms.

    - by Sheery
    Hi, I have an application build in C# using PC Suite API, when i am trying to copy mms image to my PC it gives me an error of invalid parameters, can any one help me in this matter ...my code is dataVersit = (CAContentAccess.CADataDefinitions.CA_DATA_VERSIT)Marshal.PtrToStructure(bufData, typeof(CAContentAccess.CADataDefinitions.CA_DATA_VERSIT)); byte[] bVersitObject = new byte[dataVersit.iDataLength]; Marshal.Copy(dataVersit.pbVersitObject, bVersitObject, 0 , dataVersit.iDataLength); System.IO.Stream ios = System.IO.File.Open(fileDlg.FileName, System.IO.FileMode.Create); ios.Write(bVersitObject, bVersitObject.GetLowerBound(0), dataVersit.iDataLength); ios.Flush(); ios.Close();

    Read the article

  • Xpath help function

    - by NA
    Hi i have a document from which i am trying to extract a date. But the problem is within the node along with the date their is some text too. Something like <div class="postHeader"> Posted on July 20, 2009 9:22 PM PDT </div> From this tag i just want the date item not the Posted on text. something like ./xhtml:div[@class = 'postHeader'] is getting everything. and to be precise, the document i have is basically a nodelist of this elements for eg i will get 10 nodes of these elements with different date values but to be worse the problem is sometime inside these tags some random other tags also pops us like anchors etc. Can i write a universal expath which will just get the date out of the div tag?

    Read the article

  • VSS Analyze - Access to file [filename] is denied

    - by AJ
    Our VSS database appears to be horribly out of shape. I've been trying to archive and run "analyze" and keep getting "Access to file [filename] is denied. The file may be read-only, may be in use, or you may not have permission to write to the file. Correct this problem and run analyze again." No one is logged into SourceSafe (including myself) and I'm running the analyze utility from the VS command prompt as follows: analyze -v -f -bbackuppath databasepath I get similar errors if I try and create project archives from the ssadmin tool. The database is on a network share, and we're running VSS 2005 v8.0.50727.42. I'd love to be able to do this, as it would be a first step in a move away from VSS. Thanks in advance. More Info Every time I run analyze, the file that spawns the access denied message changes. It's almost as if running analyze unlocks that file so that the next time I get through to the next one.

    Read the article

  • Bash - replacing targeted files with a specific file, whitespace in directory names

    - by Dispelwolf
    I have a large directory tree of files, and am using the following script to list and replace a searched-for name with a specific file. Problem is, I don't know how to write the createList() for-loop correctly to account for whitespace in a directory name. If all directories don't have spaces, it works fine. The output is a list of files, and then a list of "cp" commands, but reports directories with spaces in them as individual dirs. aindex=1 files=( null ) [ $# -eq 0 ] && { echo "Usage: $0 filename" ; exit 500; } createList(){ f=$(find . -iname "search.file" -print) for i in $f do files[$aindex]=$(echo "${i}") aindex=$( expr $aindex + 1 ) done } writeList() { for (( i=1; i<$aindex; i++ )) do echo "#$i : ${files[$i]}" done for (( i=1; i<$aindex; i++ )) do echo "/usr/bin/cp /cygdrive/c/testscript/TheCorrectFile.file ${files[$filenumber]}" done } createList writeList

    Read the article

  • Objective-C: how to splt a string constant across multiple lines

    - by Ilya
    Hi, I have a pretty long sqlite query: const char *sql_query = "SELECT statuses.word_id FROM lang1_words, statuses WHERE statuses.word_id = lang1_words.word_id ORDER BY lang1_words.word ASC"; How can I break it in a number of lines to make it easier to read? If I do the following: const char *sql_query = "SELECT word_id FROM table1, table2 WHERE table2.word_id = table1.word_id ORDER BY table1.word ASC"; I am getting a error. Is there a way to write queries in multiple lines? Thank you.

    Read the article

  • Class decorator to declare static member (e.g., for log4net)?

    - by Ken
    I'm using log4net, and we have a lot of this in our code: public class Foo { private static readonly ILog log = LogManager.GetLogger(typeof(Foo)); .... } One downside is that it means we're pasting this 10-word section all over, and every now and then somebody forgets to change the class name. The log4net FAQ also mentions this alternative possibility, which is even more verbose: public class Foo { private static readonly ILog log = LogManager.GetLogger(System.Reflection.MethodBase.GetCurrentMethod().DeclaringType); ... } Is it possible to write a decorator to define this? I'd really like to say simply: [LogMe] // or perhaps: [LogMe("log")] public class Foo { ... } I've done similar things in other languages, but never a statically-compiled language like C#. Can I define class members from a decorator?

    Read the article

  • Asp.net mvc html melper

    - by tom
    Hi there Ive got this function as a html helper which should write a javascript function onto the page, I then call this in the masterpage like this <%Html.RenderBaseUrlScript(); % My problem is that the script never seems to be written to the page, I search in the source and cannot see it anywhere, I have tried moving this around from the head to the body of the html masterpage, Im really confused as to why this is not workung, please help public static string RenderBaseUrlScript(this HtmlHelper helper) { return string.Format("<script type='text/javascript'> $.url=function(url){{return '{0}'+url;}}", GetBaseUri()); }

    Read the article

  • Iterating through facebook comments JSON object failing

    - by user1594304
    I tried the option of students.item["http://www.myurl.com"].comments.data.length. However, the item["http://www.myurl.com"] call is not working. If I take out the URL from JSON object and write the iterator with students.comments.data, it works. Here is my code, any help highly appreciated. var students = { "http://www.myurl.com":{ "comments":{ "data" : [ { "id": "123456778", "from": { "name": "XYZ", "id": "1000005" }, "message": "Hey", "can_remove": false, "created_time": "2012-09-03T03:16:01+0000", "like_count": 0, "user_likes": false } ] } } } var i=0 var arrayObject = new Array(); alert("Parsing 2: "+students.item["http://www.myurl.com"].comments.data.length); for(i=0;i<students.item["http://www.myurl.com"].comments.data.length;i++) { alert("Parsing 1: "+i); arrayObject.push(students.item["http://www.myurl.com"].comments.data[i].id); arrayObject.push(students.item["http://www.myurl.com"].comments.data[i].message); arrayObject.push(students.item["http://www.myurl.com"].comments.data[i].created_time); }

    Read the article

  • Where Not In OR Except simulation of SQL in LINQ to Object(C#)

    - by Thinking
    Suppose I have two lists that holds the list of source file names and destination file names respectively. The Sourcefilenamelist has files as 1.txt, 2.txt,3.txt, 4.txt while the Destinaitonlist has 1.txt,2.txt. I ned to write a linq query to find out which files are in SourceList that are absent in DestinationFile list. e.g. here the out put will be 3.txt and 4.txt. I have done this by a foreach statement.. but now I want to do the same by using LINQ(C#). Help needed. Thanks

    Read the article

  • Multiple column Union Query without duplicates

    - by Adam Halegua
    I'm trying to write a Union Query with multiple columns from two different talbes (duh), but for some reason the second column of the second Select statement isn't showing up in the output. I don't know if that painted the picture properly but here is my code: Select empno, job From EMP Where job = 'MANAGER' Union Select empno, empstate From EMPADDRESS Where empstate = 'NY' Order By empno The output looks like: EMPNO JOB 4600 NY 5300 MANAGER 5300 NY 7566 MANAGER 7698 MANAGER 7782 MANAGER 7782 NY 7934 NY 9873 NY Instead of 5300 and 7782 appearing twice, I thought empstate would appear next to job in the output. For all other empno's I thought the values in the fields would be (null). Am I not understanding Unions correctly, or is this how they are supposed to work? Thanks for any help in advance.

    Read the article

  • Placing the where condition

    - by user182944
    I came up with the below query: SELECT ROOMNO,BUILDINGNO FROM MRM_ROOM_DETAILS WHERE ROOMID IN ( SELECT distinct roomid FROM MRM_BOOKING_DETAILS WHERE (CHECKIN NOT BETWEEN '2012-04-13 09:50:00' AND '2012-04-13 10:20:00') AND (CHECKOUT NOT BETWEEN '2012-04-13 09:50:00' AND '2012-04-13 10:20:00')) AND CAPACITY > 15 AND PROJECTIONSTATUS = 'NO'; I need to place this query in the method SQLiteDatabase.query() and fetch the rows accordingly. I am not able to understand how to place this big where condition (which contains a sub-query as well) in place of the "String selection" i.e. 3rd parameter of the method. Shall i simple write the entire where part(including the sub-query) as a string in the 3rd parameter or else there is some other better way for doing the same? Please suggest me the best way to do the same. Regards,

    Read the article

  • Stackoverflow interesting tags

    - by Tom
    So, that's how works Interesting Tags: I add into them my interested tags like php, mysql, jquery and so on. Then, if any of questions has the same tags as mine it makes background orange. I understand how to use jquery to do that (there were related questions to that), but without mysql it can't be done. Now, here is a question. How is it done? I imagine like that: There is a row in mysql for every member, let's call it "interested_tags". After I write and submit my tag through input, it is being written in a row "interested_tags". Then, the main page has a query which shows all answers and it always checks answer's with mine tags with strpos like this if(strpos($question_tags, $my_tags) === true) {        //and here will be made background orange } Am I thinking right or is there any way to do it?

    Read the article

  • Extension methods on a static object

    - by Max Malygin
    I know (or so I hear) that writing extension methods for a single stand alone .net class (not an implementation of IEnumerable) is potential code smell. However, for the sake of making the life easier I need to attach a method to the ConfigurationManager class in asp.net. It's a static object so this won't work: public static List<string> GetSupportedDomains(this ConfigurationManager manager) { //the manager needs to be static. } So the question is - is it possible to write an extension method for a static class in .net?

    Read the article

  • Macro to create macros?

    - by JMarsch
    Over the years, I've built up a number of macros that I like to have available in visual studio. It's always a pain to reload them and rebind them to the keyboard when I go to a different machine/rebuild/use a VM/etc. Someone mentioned to me once that there is a way that you can write a macro that will recreate your macros and bind them to keys automatically. Anyone know how to do that? Is there another way to easily export/import macros (nonsensically, VS has an "export macro" function, but no import).

    Read the article

  • Serialze an Object to a String

    - by Vaccano
    I have the following method to save an Object to a file: // Save an object out to the disk public static void SerializeObject<T>(this T toSerialize, String filename) { XmlSerializer xmlSerializer = new XmlSerializer(toSerialize.GetType()); TextWriter textWriter = new StreamWriter(filename); xmlSerializer.Serialize(textWriter, toSerialize); textWriter.Close(); } I confess I did not write it (I only converted it to a extension method that took a type parameter). Now I need it to give the xml back to me as a string (rather than save it to a file). I am looking into it, but I have not figured it out yet. I thought this might be really easy for someone familiar with these objects. If not I will figure it out eventually.

    Read the article

  • In PHP can I check a boolean on a function call?

    - by Chris
    I have a function which checks the passed value and returns false or true, if false I want it to add something to an array. The code I've written is below. if(!check_input($_POST['username'])){ $errors[] = "Username"; } Right now it adds to my array anyway, regardless of what is entered in the form. Is the way I've written that the correct way to check if the return from check_input() is false? I've checked the function's logic by altering the returns to echoes and it's returning the correct value, I'm just not sure if I'm checking it wrong. I'd previously attempted to write it as $X=check_input etc, and then if(check_value == false) but that doesn't seem to give me the desired result either. Hmmm a quick pointer please!

    Read the article

< Previous Page | 685 686 687 688 689 690 691 692 693 694 695 696  | Next Page >