Search Results

Search found 59456 results on 2379 pages for 'sql string'.

Page 69/2379 | < Previous Page | 65 66 67 68 69 70 71 72 73 74 75 76  | Next Page >

  • Deny login from certain hosts if logging in with specific sql credentials

    - by Dave
    I want to stop some of our developers from connecting to the production sql server using a specific sql account. They have rights to connect through windows authentication with lower rights. They claim that changing the password will affect too many other processes running on our processing machine. So I want to deny access if they're connecting from there dev machines for now. Another way this would work is if I could just allow connections from one specific host.

    Read the article

  • Add an Excel file as a linked server in SQL 2012

    - by MgSam
    I'm trying to add a linked server to an Excel 2010 file from SQL Server 2012. Every reference I've found online for doing this is using older versions of SQL Server, and the driver that they tell you to use 'Microsoft.Jet.OLEDB.4.0', is not present in 2012 from what I can tell. Can anyone tell me which provider I need to use and what the product name, data source, and provider string should be? For reference, this is the screen I'm looking at: Thanks.

    Read the article

  • Delete data from a SQL Server database on a full partition

    - by aleroot
    I have a SQL Server 2005 Database on a dedicated partition, during the time the database grown and now it have occupied all the space on the partition, now the problem is that the only operation I can do on the database is detach, but i want to remove old data from some tables to save space ... How can I remove old data from the database if SQL Server interface doesn't allow to run queries on it ?

    Read the article

  • SQL Server Full Text Search resource consumption

    - by Sam Saffron
    When SQL Server builds a fulltext index computer resources are consumed (IO/Memory/CPU) Similarly when you perform full text searches, resources are consumed. How can I get a gauge over a 24 hour period of the exact amount of CPU and IO(reads/writes) that fulltext is responsible for, in relation to global SQL Server resource usage. Are there any perfmon counters, DMVs or profiler traces I can use to help answer this question?

    Read the article

  • SQL Server Logs: missing date ranges

    - by Jeff
    I need to be able to export SQL Server logs into CSV files, which I can easily do with the export function. However in doing so I've noticed there's a range of dates missing from the SQL Server logs in Management Studio, two months actually. I'm wondering where these logs might be found, and if it's possible to reload them so I can view and then export them. They're strictly for informational purposes, but I do need them. Thanks in advance!

    Read the article

  • Batch vs SQL statement

    - by AspOnMyNet
    a) A SQL statement is a single SQL command (for example, SELECT * FROM table1 or SET NOCOUNT ON). A batch on the other hand, is a number of SQL statements sent to the server for execution as a whole unit. The statements in the batch are compiled into a single execution plan. Batches are separated by the GO command So the only difference between SQL statement and a Batch is that each SQL statement is sent to server as a separate unit and thus is compiled separately from other SQL statements, while SQL statements in a Batch are compiled together? b) I assume one of major differences between a stored procedure and a Batch is that stored procedures are precompiled while Batches aren’t? thanx

    Read the article

  • Are there any differences between SQL Server and MySQL when it comes to preventing SQL injection?

    - by Derek Adair
    I am used to developing in PHP/MySQL and have no experience developing with SQL Server. I've skimmed over the PHP MSSQL documentation and it looks similar to MySQLi in some of the methods I read about. For example, with MySQL I utilize the function mysql_real_excape_string(). Is there a similar function with PHP/SQL Server? What steps do I need to take in order to protect against SQL injection with SQL Server? What are the differences between SQL Server and MySQL pertaining to SQL injection prevention? also - is this post accurate? is the escape string character for SQL Server a single quote?

    Read the article

  • Debugging SQL in PGAdmin3 when sql contains variables

    - by Mr Shoubs
    In SQL Server I could copy sql code out of an application and paste it into SSMS, declare & assign vars that exist in the sql and run.. yay great debugging scenario. e.g. (please note I am rust and syntax may be incorrect) declare @x as varchar(10) set @x = 'abc' select * from sometable where somefield = @x I want to do something simular with postgres in pgadmin3 (or another postgres tool, anyy reccomendations?) I realise you can create pgscript, but it doesn't appear to be very good, for example, if I do the equlivent of above, it doesn't put the single quotes around the value in @x, nor does it let me by doubling them up and you don't get a table out after - only text... Currently I have a peice of sql someone has written that has 3 unique varibles in it which are used around 6 times each... So the question is how do other people debug sql this sql EFFICIENTLY, preferably in a simular fashion to my sql server days.

    Read the article

  • Finding multiple values in a string Jquery / Javascript

    - by user257503
    I have a three strings of categories "SharePoint,Azure,IT"; "BizTalk,Finance"; "SharePoint,Finance"; I need to find a way to check if a string contains for example "SharePoint" and "IT", or "BizTalk" and "Finance". The tests are individual strings themselces. How would i loop through all the category strings (1 - 3) and only return the ones which have ALL instances of the souce. i have tried the following function doesExist(source, filterArray) { var substr = filterArray.split(" "); jQuery.each(substr, function() { var filterTest = this; if(source.indexOf(filterTest) != -1 ) { alert("true"); return true; }else { alert("false"); return false; } }); } with little success...the code above checks one at a time rather than both so the results returned are incorrect. Any help would be great. Thanks Chris UPDATE: here is a link to a work in progress version..http://www.invisiblewebdesign.co.uk/temp/filter/#

    Read the article

  • Is it possible to make a MS-SQL Scalar function do this?

    - by Hokken
    I have a 3rd party application that can call a MS-SQL scalar function to return some summary information from a table. I was able to return the summary values with a table-valued function, but the application won't utilize table-valued functions, so I'm kind of stuck. Here's a sample from the table: trackingNumber, projTaskAward, expenditureType, amount 1122, 12345-67-89, Supplies, 100 1122, 12345-67-89, Supplies, 150 1122, 12345-67-89, Supplies, 250 1122, 12345-67-89, Misc, 50 1122, 12345-67-89, Misc, 100 1122, 98765-43-21, General, 200 1122, 98765-43-21, Conference, 500 1122, 98765-43-21, Misc, 300 1122, 98765-43-21, Misc, 100 1122, 98765-43-21, Misc, 100 I want to summarize the amounts by projTaskAward & expenditureType, based on the trackingNumber. Here is the output I'm looking for: Proj/Task/Award: 12345-67-89 Expenditure Type: Supplies Total: 500 Proj/Task/Award: 12345-67-89 Expenditure Type: Misc Total: 150 Proj/Task/Award: 98765-43-21 Expenditure Type: General Total: 200 Proj/Task/Award: 98765-43-21 Expenditure Type: Conference Total: 500 Proj/Task/Award: 98765-43-21 Expenditure Type: Misc Total: 500 I'd appreciate any help anyone can give in steering me in the right direction.

    Read the article

  • Simple solution now to a problem from 8 years ago. Use SQL windowing function

    - by Kevin Shyr
    Originally posted on: http://geekswithblogs.net/LifeLongTechie/archive/2014/06/10/simple-solution-now-to-a-problem-from-8-years-ago.aspxI remember having this problem 8 years ago. We had to find the top 5 donor per month and send out some awards. The SQL we came up with was clunky and had lots of limitation (can only do one year at a time), then switch the where clause and go again. Fast forward 8 years, I got a similar problem where we had to find the top 3 combination of 2 fields for every single day. And the solution is this elegant: SELECT CAST(eff_dt AS DATE) AS "RecordDate" , status_cd , nbr , COUNT(*) AS occurance , ROW_NUMBER() OVER (PARTITION BY CAST(eff_dt AS DATE) ORDER BY COUNT(*) DESC) RowNum FROM table1 WHERE RowNum < 4 GROUP BY CAST(eff_dt AS DATE) , status_cd , nbr If only I had this 8 years ago. :) Life is good now!

    Read the article

  • Linked server problem on SQL Server 2005

    - by BradyKelly
    I have a weird issue and I hope someone can steer me in the right direction for resolving this please. When I execute the following query against a linked server, I get the following error. I can connect to the server in SSMS as a separate server, and execute a similar query against its Deposits table. The nn.nn is my own replacement to avoid broadcasting our server addresses. The query: select td.Batch , td.DateTimeDeposited from Deposits cd left join [172.nn.nn.32\sqlexpress].Terminal.dbo.Deposits td on cd.DateTimeDeposited = td.DateTimeDeposited The error: OLE DB provider "SQLNCLI" for linked server "172.nn.nn.11\sqlexpress" returned message "Login timeout expired". OLE DB provider "SQLNCLI" for linked server "172.nn.nn.11\sqlexpress" returned message "An error has occurred while establishing a connection to the server. When connecting to SQL Server 2005, this failure may be caused by the fact that under the default settings SQL Server does not allow remote connections.". Msg 65535, Level 16, State 1, Line 0 SQL Network Interfaces: Error Locating Server/Instance Specified [xFFFFFFFF]. Notice how the error is about server 172.nn.nn.11 and not 172.nn.nn.32. SOLVED (STUPID ME): Somebody had added an extra bit to my query that was scrolled off-screen and was querying the 17.nn.nn.11 server.

    Read the article

  • SQL Server Management Studio not scripting all objects

    - by Ian Boyd
    i've been attempting to script a database using SQL Server 2005 Management Studio. i cannot get it to script some objects. It scripts others, but skips some. i can provide detailed screen shots the options being selected including all tables the folder where the script files will go the folder being empty before scripting the scripting process saying Sucess when scripting a table the destination folder no longer empty, with a hundred or so script files the script of some tables not being in the folder. And earlier SSMS would not script some views. Is this a known thing that the the Generate Scripts task does not generate scripts? Update Known issue on Microsoft Connect, but Microsoft couldn't repro the steps, so they closed closed the ticket. Fails on SQL Server 2005, also fails on SQL Server 2008. Update Two Some basic questions: 1.What version of SQL Server? Microsoft SQL Server 2000 - 8.00.194 (Intel X86) Microsoft SQL Server 2005 - 9.00.3042.00 (Intel X86) Microsoft SQL Server 2008 - 10.0.2531.0 (Intel X86) Microsoft SQL Server 2005 Management Studio: 9.00.4035.00 Microsoft SQL Server 2008 Management Studio: 10.0.1600.22 2.What O/S are you running on? Windows Server 2000 Windows Server 2003 Windows Server 2008 3.How are you logging in to SQL server? sa/password Trusted authentication 4.Have you verified your account has full access to all objects? Yes, i have access to all objects. 5.Can you use the objects that fail to script? (eg: select top(10) * from nonScriptingTable) Yes, all objects work fine. SQL Server Enterprise Manager can script the objects fine. Update Three They fail no matter what version of SQL Server you script against. It wasn't a problem in Enterprise Manager: Client Tools SQL Server 2000 SQL Server 2005 SQL Server 2008 ============ =============== =============== =============== 2000 Yes n/a n/a 2005 No No No 2008 No No No Update Four No errors found in the database using: DBCC CHECKDB go DBCC CHECKCONSTRAINTS go DBCC CHECKFILEGROUP go DBCC CHECKIDENT go DBCC CHECKCATALOG go EXECUTE sp_msforeachtable 'DBCC CHECKTABLE (''?'')' Honk if you hate SSMS.

    Read the article

  • SQL Server Management Studio not scripting all objects

    - by Ian Boyd
    i've been attempting to script a database using SQL Server 2005 Management Studio. i cannot get it to script some objects. It scripts others, but skips some. i can provide detailed screen shots the options being selected including all tables the folder where the script files will go the folder being empty before scripting the scripting process saying Sucess when scripting a table the destination folder no longer empty, with a hundred or so script files the script of some tables not being in the folder. And earlier SSMS would not script some views. Is this a known thing that the the Generate Scripts task does not generate scripts? Update Known issue on Microsoft Connect, but Microsoft couldn't repro the steps, so they closed closed the ticket. Fails on SQL Server 2005, also fails on SQL Server 2008. Update Two Some basic questions: 1.What version of SQL Server? Microsoft SQL Server 2000 - 8.00.194 (Intel X86) Microsoft SQL Server 2005 - 9.00.3042.00 (Intel X86) Microsoft SQL Server 2008 - 10.0.2531.0 (Intel X86) Microsoft SQL Server 2005 Management Studio: 9.00.4035.00 Microsoft SQL Server 2008 Management Studio: 10.0.1600.22 2.What O/S are you running on? Windows Server 2000 Windows Server 2003 Windows Server 2008 3.How are you logging in to SQL server? sa/password Trusted authentication 4.Have you verified your account has full access to all objects? Yes, i have access to all objects. 5.Can you use the objects that fail to script? (eg: select top(10) * from nonScriptingTable) Yes, all objects work fine. SQL Server Enterprise Manager can script the objects fine. Update Three They fail no matter what version of SQL Server you script against. It wasn't a problem in Enterprise Manager: Client Tools SQL Server 2000 SQL Server 2005 SQL Server 2008 ============ =============== =============== =============== 2000 Yes n/a n/a 2005 No No No 2008 No No No Update Four No errors found in the database using: DBCC CHECKDB go DBCC CHECKCONSTRAINTS go DBCC CHECKFILEGROUP go DBCC CHECKIDENT go DBCC CHECKCATALOG go EXECUTE sp_msforeachtable 'DBCC CHECKTABLE (''?'')' Honk if you hate SSMS.

    Read the article

  • SQL Server 2005 SP3 on Windows 7 - No Management Studio

    - by Mike Thomas
    I've been trying for a day and a half now to get SQL Server 2005, DEV edition, to work on Windows 7, 64 bit prof. I install from the disk, then run SP 3. I get a failure on the Client Components section of the Installation Progress along with this vague message - Product : Client Components Product Version (Previous): 1399 Product Version (Final) : Status : Failure Log File : C:\Program Files\Microsoft SQL Server\90\Setup Bootstrap\LOG\Hotfix\SQLTools9_Hotfix_KB955706_sqlrun_tools.msp.log Error Number : 1712 Error Description : MSP Error: 1712 One or more of the files required to restore your computer to its previous state could not be found. Restoration will not be possible. I've uninstalled all Visual Studio and tried to make this as clean as possible, and have read a lot of the blog posts, but am really at my wits end about this. I am not a DBA, but I use SQL Server all the time when coding and testing apps. Does anyone have any ideas as to where I can get this sorted out? I've been ati this for a long time and have never encountered an installation as bad as this one. Thanks Mike Thomas

    Read the article

  • MS SQL Server Firewall Ports

    - by mmacaulay
    Hi, I've recently found myself in the position of quickly deploying a production app on SQL Server 2008 (EXPRESS), and I've been having some issues with configuring firewall rules between our web server running the ASP.NET app and our database server. Everything that I can find on the internet claims that I should only need to have TCP ports 1433/1434 and UDP port 1434 accessible on the database server. However, we were unable to get connectivity going between the web app and the database with just those ports. With the help of one of the guys in our datacentre, we discovered that there was traffic also going to TCP port 2242 on the database server. After opening this port, everything worked, but we're not sure why. Later on, I had to reinstall SQL Server due to some disk space issues, and found that the problem had resurfaced - after another session with the packet sniffer, we discovered that this time traffic was going to TCP port 4541 on the database server. My question is, is there some configuration option that I'm missing in SQL server that's making it choose random ports? I'd like to have our firewall rules locked down as much as possible, and of course we'd like to avoid any future mysterious connectivity issues, especially once the app is live. Both servers are running Windows 2003 R2 X64.

    Read the article

  • Can't Connect w/ SQL Management Studio After Domain Change

    - by Sam
    Our old Small Business Server 2003 (acting as our domain controller) was on the fritz, so we replaced it with a new Windows Server 2008 box and set the server up as our new domain controller. In hindsight, it may have been a mistake, but we set up the new server as a replacement and tried to keep as much the same as possible, including the DOMAIN name. The problem was, that even though the domain name was the same, the guest computers somehow still realized it was not the exact same domain. We had to unjoin and rejoin the domain and port over everyone's documents and settings. This morning, when I attempted to connect to my local SQL Server Instance, it was saying that my login failed. When I tried to use the SQL Management Studio, it throws the error "Package 'Microsoft SQL Management Studio Package' failed to load" on startup, then exits without giving me a chance to change the login. I am using Mixed Authentication and have an administrative account as a backup. Ideas? If there is a more appropriate stack, please let me know where to put it.

    Read the article

  • Orphaned SQL Recordsets/Connections with IIS

    - by Damian
    I have an IIS 6 site running on Windows 2003 Server x86 with MS SQL2005 Enterprise edition running ASP Classic (no choice). The site runs very fast with about 8000 page views per hour. All of my SQL tables are indexed and I have used the profiler to check my queries, the slowest of which is only about 10-15ms. I have autoshrink disabled, autogrow is set to 250mb, database is 2gb with 800mb of free space. My problem is that every now and then the site will slow to a crawl for no reason. Pages that just have a simple 'connect to databse and increment a hit counter' work ok, but more SQL intensive pages that normally execute in about 60ms take 25,000ms to run. This happens for about 30 seconds and then goes away. I was having an issue with orphan recordsets and connections due to the way I was releasing them. I have fixed this up and the issue is much better, but I am still getting them. Is there a way with permon, etc. to track when SQL Server or Windows closes these Orphan connections? At least if I can monitor the issue I will know if I am making progress or if I am even looking at the right things. Is there anything else I might be missing? Thank you!

    Read the article

  • SQL Server log backups “stalling”

    - by MattK
    I have interited a box running SQL Server 2008 and Windows 2003, and have had a few events where largeish (35GB) log backups "stall", both before and after the installation of SQL 2008 SP1. The server log ships to a standby, so regular log backups are taken at 15 minute intervals. However, after an index reorg causes the log to grow to about 35GB (on a DB with about 17GB of data), the next log backup runs to ~95% completion, then seems to stop. The process shows as suspended, with a wait state of BACKUPIO. CPU, read, and write activity on the SPID also does not change, and the process stays in this state for hours, when normally a backup of this size should complete in about 20 minutes. This server has a single RAID-1 volume, thus the source database files and destination backup files are on the same volume. However, I cannot determine if another process is blocking the backup. The backup SPID cannot be killed, and the only way to terminate the log backup and clear the lock on the backup file is to cycle the SQL Server service. There was one event where the backup terminated completely, with an error that another process had locked the backup file, but no details about what that process was. Can anyone suggest a cause or diagnostic process to this situation?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Tables are not visible in SQL Server Management Studio but they are in Visual Studio using same acco

    - by Germ
    I'm experiencing a weird problem with a particular SQL login. When I connect to the server in Microsoft SQL Server Management Studio (2008) using this account, I cannot see any of the tables, stored procedures etc. that this account should have access to. When I connect to the same server within Visual Studio (2008) with the same account everything is there. I've also had a co-worker connect to the server using the same login and he's able to view everything as well. The strange thing is if I switch logins, I'm able to view objects that the other account has access to which indicates that there isn't a problem with MSSMS on my PC. Does anyone have any suggestions on how I can diagnose this problem? I've check to make sure I don't have any Table filters etc.

    Read the article

< Previous Page | 65 66 67 68 69 70 71 72 73 74 75 76  | Next Page >