Search Results

Search found 36705 results on 1469 pages for 'update apt xapian index'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 693/1469 | < Previous Page | 689 690 691 692 693 694 695 696 697 698 699 700  | Next Page >

  • Copying a foreign Subversion repository to keep under dependencies

    - by Jonathan Sternberg
    I want to keep dependencies for my project in our own repository, that way we have consistent libraries for the entire team to work with. For example, I want our project to use the Boost libraries. I've seen this done in the past with putting dependencies under a "vendor" or "dependencies" folder. But I still want to be able to update these dependencies. If a new feature appears in a library and we need it, I want to just be able to update that repository within our own repository. I don't want to have to recopy it and put it under version control again. I'd also like for us to have the ability to change dependencies if a small change is needed without stopping us from ever updating the library. I want the ability to do something like 'svn cp', then be able to 'svn merge' in the future. I just tried this with the boost trunk, but I'm not able to get any history using 'svn log' on the copy I made. How do I do this? What is usually done for large projects with dependencies?

    Read the article

  • updating multiple nodes in xml with xquery and xdmp:node-replace

    - by morja
    Hi all, I wnat to update an XML document in my xml database (Marklogic). I have xml as input and want to replace each node that exists in the target xml. If a node does not exist it would be great if it gets added, but thats maybe another task. My XML in the database: <user> <username>username</username> <firstname>firstname</firstname> <lastname>lastname</lastname> <email>[email protected]</email> <comment>comment</comment> </user> The value of $user_xml: <user> <firstname>new firstname</firstname> <lastname>new lastname</lastname> </user> My function so far: declare function update-user ( $username as xs:string, $user_xml as node()) as empty-sequence() { let $uri := user-uri($username) return for $node in $user_xml/user return xdmp:node-replace(fn:doc($uri)/user/fn:node-name($node), $node) }; First of all I cannot iterate over $user_xml/user. If I try to iterate over $user_xml I get "arg1 is not of type node()" exception. But maybe its the wrong approach anyway? Does anybody maybe have sample code how to do this?

    Read the article

  • How to get datarow array refering to datatable 's field value with linq

    - by Michael
    I want to use linq to get datarow array from a datatable which its string type ColumnA is not null or depending on its length 0 , so I can get the row index with Indexof() method to deal with something else. ColumnA ColumnB ColumnC A0 B0 C0 Null B1 C1 A2 B2 C2 Null B3 C3 My Linq Statment: DataRow[] rows = myDataTable.Select("ColumnA is not null").Where(row=>row.Field<string>("ColumnA").Length>0); somebody who can help?

    Read the article

  • importing class and its function from another file

    - by user343934
    Hi everyone, I am having little problem with importing classes in python. My work flow goes like this index.py class Template: def header(): def body(): def form(): def footer(): display.py I want to call function header(), body() and footer () in my display.py page. Will anyone make me clear about this issue in python. Thanks for your concern.

    Read the article

  • How to add new object to an IList mapped as a one-to-many with NHibernate?

    - by Jørn Schou-Rode
    My model contains a class Section which has an ordered list of Statics that are part of this section. Leaving all the other properties out, the implementation of the model looks like this: public class Section { public virtual int Id { get; private set; } public virtual IList<Static> Statics { get; private set; } } public class Static { public virtual int Id { get; private set; } } In the database, the relationship is implemented as a one-to-many, where the table Static has a foreign key pointing to Section and an integer column Position to store its index position in the list it is part of. The mapping is done in Fluent NHibernate like this: public SectionMap() { Id(x => x.Id); HasMany(x => x.Statics).Cascade.All().LazyLoad() .AsList(x => x.WithColumn("Position")); } public StaticMap() { Id(x => x.Id); References(x => x.Section); } Now I am able to load existing Statics, and I am also able to update the details of those. However, I cannot seem to find a way to add new Statics to a Section, and have this change persisted to the database. I have tried several combinations of: mySection.Statics.Add(myStatic) session.Update(mySection) session.Save(myStatic) but the closest I have gotten (using the first two statements), is to an SQL exception reading: "Cannot insert the value NULL into column 'Position'". Clearly an INSERT is attempted here, but NHibernate does not seem to automatically append the index position to the SQL statement. What am I doing wrong? Am I missing something in my mappings? Do I need to expose the Position column as a property and assign a value to it myself? EDIT: Apparently everything works as expected, if I remove the NOT NULL constraint on the Static.Position column in the database. I guess NHibernate makes the insert and immediatly after updates the row with a Position value. While this is an anwers to the question, I am not sure if it is the best one. I would prefer the Position column to be not nullable, so I still hope there is some way to make NHibernate provide a value for that column directly in the INSERT statement. Thus, the question is still open. Any other solutions?

    Read the article

  • Getting Error in installing signed plugin in different machine?

    - by Rahul
    Hi, I have developed a signed plugin for eclipse. I have refered this document http://www.ibm.com/developerworks/opensource/library/os-eclipse-plugin-sigs/index.html When i am installing that plugin in my system it is ok. and asking for certificate verification .But when i am installing that plugin in other system's eclipse it is giving error. Signed plugin is not getting install in other machine except mine.Why it is like that how to solve that problem please tell???

    Read the article

  • jQuery multiple selectors into dynamic attribute

    - by Jason Fletcher
    I am trying to attach an event to a separate onhover trigger. But I am having problems using multiple selectors since its dynamic. Need help ::: Upon hovering on the yellow box named 'Rings', this should trigger the animated slide event for the green box above it. http://home.jasonfletcher.info/all/alliteration/index.html $('.boxgrid1').hover(function(){ $(".cover", this).stop().animate({top:'0px'},{queue:false,duration:300}); }, function() { $(".cover", this).stop().animate({top:'247px'},{queue:false,duration:300}); });

    Read the article

  • IE layers issue when dtd with doctype tag is not added

    - by keshav.veerapaneni
    Hello colleagues, I am facing a very strange issue because of which when i do not add the below line to the html the layers(z-index) is not working. <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"; "_http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> Please let me know if you are aware of the issue and how to get layers working without adding this tag. Best Regards, Keshav

    Read the article

  • Seam @Factory in abstract base class?

    - by Shadowman
    I've got a series of web actions I'm implementing in Seam to perform create, read, update, etc. operations. For my read/update/delete actions, I'd like to have individual action classes that all extend an abstract base class. I'd like to put the @Factory method in the abstract base class to retrieve the item that is to be acted upon. For example, I have this as the base class: public abstract class BaseAction { @In(required=false)@Out(required=false) private MyItem item=null; public MyItem getItem(){...} public void setItem(...){...} @Factory("item") public void initItem(){...} } My subclasses would extend BaseAction, so that I don't have to repeat the logic to load the item that is to be viewed, deleted, updated, etc. However, when I start my application, Seam throws errors saying I have declared multiple @Factory's for the same object. Is there any way around this? Is there any way to provide the @Factory in the base class without encoutnering these errors?

    Read the article

  • php,unix command ,imagick not working

    - by user345804
    Hi, i am trying to bend text using imagemagik in PHP. but the commands shown in the website are not working. http://www.fmwconcepts.com/imagemagick/texteffect/index.php how can i run these scripts in PHP ? somebody please help me.. NB :-t \'SOME ARCHBOTTOM TEXT\' -s outline -e arch-bottom -d 1.0 -f Arial -p 48 -c skyblue -b white -o black -l 1 -u lightpink

    Read the article

  • xml append issue in ie,chrome

    - by 3gwebtrain
    Hi, I am creating a html page, using xml data. in which i am using the following function. It works fine with firefox,opera,safari. but in case of ie7,ie8, and chrome the data what i am getting from xml, is not appending properly. any one help me to solve this issue? in case any special thing need to concentrate on append funcation as well let me know.. $(function(){ var thisPage; var parentPage; $('ul.left-navi li a').each(function(){ $('ul.left-navi li a').removeClass('current'); var pathname = (window.location.pathname.match(/[^\/]+$/)[0]); var currentPage = $(this).attr('href'); var pathArr = new Array(); pathArr = pathname.split("."); var file = pathArr[pathArr.length - 2]; thisPage = file; if(currentPage==pathname){ $(this).addClass("active"); } }) $.get('career-utility.xml',function(myData){ var myXml = $(myData).find(thisPage); parentPage = thisPage; var overviewTitle = myXml.find('overview').attr('title'); var description = myXml.find('discription').text(); var mainsublinkTitle = myXml.find('mainsublink').attr('title'); var thisTitle = myXml.find("intro").attr('title'); var thisIntro = myXml.find("introinfo").text(); $('<h3>'+overviewTitle+'</h3>').appendTo('.overViewInfo'); $('<p>'+description+'</p>').appendTo('.overViewInfo'); var sublinks = myXml.find('mainsublink').children('sublink'); $('#intro h3').append(thisTitle); $('#intro').append(thisIntro); sublinks.each(function(numsub){ var newSubLink = $(this); var sublinkPage = $(this).attr('pageto'); var linkInfo = $(this).text(); $('ul.career-link').append('<li><a href="'+sublinkPage+'">'+linkInfo+'</a></li>'); }) $(myXml).find('listgroup').each(function(index){ var count = index; var listGroup = $(this); var listGroupTitle = $(this).attr('title'); var shortNote = $(this).attr('shortnote'); var subLink = $(this).find('sublist'); var firstList = $(this).find('list'); $('.grouplist').append('<div class="list-group"><h3>'+listGroupTitle+'</h3><ul class="level-one level' + count + '"></ul></div>'); firstList.each(function(listnum) { $(this).wrapInner('<li>') .find('sublistgroup').wrapInner('<ul>').children().unwrap() .find('sublist').wrapInner('<li>').children().unwrap(); $('ul.level'+count).append($(this).children()); }); }); }); }) Thanks for advance..

    Read the article

  • XNA Vector2 Rotation Question

    - by Tom Allen
    I'm messing about with some stuff in XNA and am trying to move an object around asteroids-style in that you press left and right to rotate and up/down to go forwards and backwards in the direction you are pointing. I've got the rotation of the sprite done, but i can't get the object to move in the direction you've pointed it, it always moves up and down on the x = 0 axis. I'm guessing this is straight forward but I just can't figure it out. My "ship" class has the following properties which are note worthy here: Vector2 Position float Rotation The "ship" class has an update method is where the input is handled and so far I've got the following: public void Update(GameTime gameTime) { KeyboardState keyboard = Keyboard.GetState(); GamePadState gamePad = GamePad.GetState(PlayerIndex.One); float x = Position.X; float y = Position.Y; if (keyboard.IsKeyDown(Keys.Left)) Rotation -= 0.1f; if (keyboard.IsKeyDown(Keys.Right)) Rotation += 0.1f; if (keyboard.IsKeyDown(Keys.Up)) y -= ??; if (keyboard.IsKeyDown(Keys.Down)) y += ??; this.Position = new Vector2(x, y); } Any help would be most appreciated!

    Read the article

  • Help me write my LISP :) LISP environments, Ruby Hashes...

    - by MikeC8
    I'm implementing a rudimentary version of LISP in Ruby just in order to familiarize myself with some concepts. I'm basing my implementation off of Peter Norvig's Lispy (http://norvig.com/lispy.html). There's something I'm missing here though, and I'd appreciate some help... He subclasses Python's dict as follows: class Env(dict): "An environment: a dict of {'var':val} pairs, with an outer Env." def __init__(self, parms=(), args=(), outer=None): self.update(zip(parms,args)) self.outer = outer def find(self, var): "Find the innermost Env where var appears." return self if var in self else self.outer.find(var) He then goes on to explain why he does this rather than just using a dict. However, for some reason, his explanation keeps passing in through my eyes and out through the back of my head. Why not use a dict, and then inside the eval function, when a new "sub-environment" needs to be created, just take the existing dict and update the key/value pairs that need to be updated, and pass that new dict into the next eval? Won't the Python interpreter keep track of the previous "outer" envs? And won't the nature of the recursion ensure that the values are pulled out from "inner" to "outer"? I'm using Ruby, and I tried to implement things this way. Something's not working though, and it might be because of this, or perhaps not. Here's my eval function, env being a regular Hash: def eval(x, env = $global_env) ........ elsif x[0] == "lambda" then ->(*args) { eval(x[2], env.merge(Hash[*x[1].zip(args).flatten(1)])) } ........ end The line that matters of course is the "lambda" one. If there is a difference, what's importantly different between what I'm doing here and what Norvig did with his Env class? If there's no difference, then perhaps someone can enlighten me as to why Norvig uses the Env class. Thanks :)

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • SQL Duplicates Issue SQL SERVER 2000

    - by jeff
    I have two tables : Product and ProductRateDetail. The parent table is Product. I have duplicate records in the product table which need to be unique. There are entries in the ProductRateDetail table which correspond to duplicate records in the product table. Somehow I need to update the ProductRateDetail table to match the original (older) ID from the Product table and then remove the duplicates from the product table. I would do this manually but there are 100's of records. i.e. something like UPDATE tbl_productRateDetail SET productID = (originalID from tbl_product) then something like DELETE from tbl_product WHERE duplicate ID and only delete the recently added ID data example: (sorry can't work out this formatting thing) tbl_Product select * from dbo.Product where ProductCode = '10003' ProductID ProductTypeID ProductDescription ProductCode ProductSize 365 1 BEND DOUBLE FLANGED 10003 80mmX90deg 1354 1 BEND DOUBLE FLANGED 10003 80mmX90deg tbl_ProductRateDetail SELECT * FROM [MSTS2].[dbo].[ProductRateDetail] WHERE ProductID in (365,1354) ProductRateDetailID ProductRateID ProductID UnitRate 365 1 365 16.87 1032 5 365 16.87 2187 10 365 16.87 2689 11 365 16.87 3191 12 365 16.87 7354 21 1354 21.30 7917 22 1354 21.30 8480 23 1354 21.30 9328 25 1354 21.30 9890 26 1354 21.30 10452 27 1354 21.30 Please help!

    Read the article

  • stored values within a custom function

    - by romunov
    My program takes a data.frame and crunches the numbers. At one point, values from j-th column are multiplied by a predefined values that depends on the column name (species name, actually - it's en ecological index). So far, I've been providing these values via a second data.frame by matching column names. What would be an efficient way of integrating fixed variable values within a function? I would like my program to be as portable as possible, without the need for a second data.frame file.

    Read the article

  • Visual studio erroneous errors when building a website?

    - by Curtis White
    Visual Studio 2008 shows a lot of erroneous errors when building a website (not a web project) in the errors list. These errors are usually corrected (removed) when I rebuild the site a couple times but they cost me wasted time. Is there anyway to hide the erroneous errors? Update: I've decided to look into this to see if I could reproduce it. This is the exact behavior I am seeing, using the website model, I type some invalid syntax on a page. The errors list fills up with errors. I correct the error and the errors list does not update. I build the project and the errors list still shows the errors but the build shows as build completed. I build the project a second time and the errors list is cleared. My question is there anyway to make the errors list clear on the first build? I thought it might have something to do with page build vs website build but it seems to make no difference. I am not using any third party dlls on this website.

    Read the article

  • How to replace the deprecated csc ant task

    - by GrGr
    I have a mixed Java / C# project and use an ant script that contains a csc task to compile the dll. This works, but I get a warning [csc] This task is deprecated and will be removed in a future version [csc] of Ant. It is now part of the .NET Antlib: [csc] http://ant.apache.org/antlibs/dotnet/index.html How can I replace the csc task? I can surely create an exec task calling nant with a project.build file, but that feels completely wrong.

    Read the article

  • JavaEE: Question about design

    - by Harry Pham
    I have a JSF page that will create a new Comment. I have the managed bean of that page to be RequestScoped managed bean. @ManagedBean(name="PostComment") @RequestScoped public class PostComment { private Comment comment = null; @ManagedProperty(value="#{A}") private A a; //A is a ViewScoped Bean @ManagedProperty(value="#{B}") private B b; //B is a ViewScoped Bean @PostConstruct public void init(){ comment = new Comment(); } // setters and getters for comment and all the managed property variable public void postComment(String location){ //persist the new comment ... if(location.equals("A")){ //update the comment list on page A }else if(location.equals("B")){ //update the comment list on page B } } } As you can see from the code above, 2 ViewScoped bean A and B will both use method postComment(), and getter getComment() from bean PostComment. The problem I am having right now is that, if I am on A, constructor of A will load, but it will also load constructor of bean B. This make my page load twice as slow. What would be the best way to solve this problem?

    Read the article

  • Entity Framework 4 + POCO with custom classes and WCF contracts (serialization problem)

    - by eman
    Yesterday I worked on a project where I upgraded to Entity Framework 4 with the Repository pattern. In one post, I have read that it is necessary to turn off the custom tool generator classes and then write classes (same like entites) by hand. That I can do it, I used the POCO Entity Generator and then deleted the new generated files .tt and all subordinate .cs classes. Then I wrote the "entity classes" by myself. I added the repository pattern and implemented it in the business layer and then implemented a WCF layer, which should call the methods from the business layer. By calling an Insert (Add) method from the presentation layer and everything is OK. But if I call any method that should return some class, then I get an error like (the connection was interrupted by the server). I suppose there is a problem with the serialization or am I wrong? How can by this problem solved? I'm using Visual Studio S2010, Entity Framework 4, C#. UPDATE: I have uploaded the project and hope somebody can help me! link text UPDATE 2: My questions: Why is POCO good (pros/cons)? When should POCO be used? Is POCO + the repository pattern a good choice? Should POCO classes by written by myself or could I use auto generated POCO classes?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 689 690 691 692 693 694 695 696 697 698 699 700  | Next Page >