Search Results

Search found 24117 results on 965 pages for 'write'.

Page 698/965 | < Previous Page | 694 695 696 697 698 699 700 701 702 703 704 705  | Next Page >

  • How to deal with the Hibernate hql multi-join query result in an Object-Oriented Way?

    - by EugeneP
    How to deal with the Hibernate hql multi-join query result in an Object-Oriented Way? As I see it returns a list of Objects. yes, it is tricky and only you who write the query know what should the query return (what objects). But are there ways to simplify things, so that it returned specific objects with no need in casting Object to a specific class according to its position in the query ? Maybe Spring can simplify things here? It has the similar functionality for JDBC, but I don't see if it can help in a similar way with Hibernate.

    Read the article

  • AS3 Random repeat x seconds function

    - by Lilk
    Hi, I have the following function: function update(e:Event):void { var val:Number = Math.random() * 120; rgb.r.x = rgb.r.y = val; rgb.b.x = rgb.b.y = -val; } And im looping it with: stage.addEventListener(Event.ENTER_FRAME, update); But what I need to do would be something like: Random number between 1 and 20 If the number is > 10 Call function Update and keep caling it for 20 seconds else do nothing for 10 seconds Repeat this block of code forever Can someone help me write this please?

    Read the article

  • Windows 8 Set User Account Image

    - by Nexion
    I'm trying to write a small CONSOLE (not metro style) app to quickly change the user account image of the current user to a select image for a setup scrip that I'm running on a bunch of laptops. They're all Windows 8 and (since it hasn't been out terribly long) I can't find a ton of info on it. I did manage to figure out that you need to use the Windows.System.UserProfile object to do so, but I can't find any documentation on how to do so in a console app. Thoughts? Suggestions?

    Read the article

  • Writing at the end of file

    - by user342534
    Hi, I'm working on a system that requires high file I/O performance (with C#). Basically, I'm filling up large files (~100MB) from the start of the file until the end of the file. Every ~5 seconds I'm adding ~5MB to the file (sequentially from the start of the file), on every bulk I'm flushing the stream. Every few minutes I need to update a structure which I write at the end of the file (some kind of metadata). When flushing each one of the bulks I have no performance issue. However, when updating the metadata at the end of the file I get really low performance. My guess is that when creating the file (which also should be done extra fast), the file doesn't really allocates the entire 100MB on the disk and when I flush the metadata it must allocates all space until the end of file. Guys/Girls, any Idea how I can overcome this problem? Thanks a lot!

    Read the article

  • In Django, using __init__() method of non-abstract parent model to record class name of child model

    - by k-g-f
    In my Django project, I have a non-abstract parent model defined as follows: class Parent(models.Model): classType = models.CharField(editable=False,max_length=50) and, say, two children models defined as follows: class ChildA(Parent): parent = models.OneToOneField(Parent,parent_link=True) class ChildB(Parent): parent = models.OneToOneField(Parent,parent_link=True) Each time I create an instance of ChildA or of ChildB, I'd like the classType attribute to be set to the strings "ChildA" or "ChildB" respectively. What I have done is added an _ _ init_ _() method to Parent as follows: class Parent(models.Model): classType = models.CharField(editable=False,max_length=50) def __init__(self,*args,**kwargs): super(Parent,self).__init__(*args,**kwargs) self.classType = self.__class__.__name__ Is there a better way to implement and achieve my desired result? One downside of this implementation is that when I have an instance of the Parent, say "parent", and I want to get the type of the child object linked with "parent", calling "parent.classType" gives me "Parent". In order to get the appropriate "ChildA" or "ChildB" value, I need to write a "_getClassType()" method to wrap a custom sql query.

    Read the article

  • JavaScript not working with Chrome & Xampp!

    - by Anonymous
    Hi, I've been trying for a couple hours now to figure out why JavaScript wouldn't work. The code works, but here it is anyway. <script type="text/javascript"> function change(text) { document.f1.ta.value="Hi!"; } </script> <form name="f1"> <input type="textarea" id="ta"/> <input type="button" action='change("Hi!")'/> </form> When I click the button, it does nothing. When I write "document.f1.ta.value="Hi!";" in the Chrome's inspector console, it works. I am using XAMPP (for Windows) 1.7.3 Windows 7 Ultimate.

    Read the article

  • Calling inheriting class methods via interface.

    - by Stacey
    Given the scenario... interface IBase{ void Process(int value); } abstract class Base : IBase { public virtual void Process(int value){ throw new NotImplementedException(); } } class Implemented: Base, IBase { public void Process(int value) { // .. some code here.. } } I'm trying to write a loop similar to the following. foreach( Base b in CollectionOfImplemented ) { b.Process( // something will go here // ); } Trying this, it keeps calling Base.Process, instead of Implemented.Process; but the type in the collection is Implemented, not Base. Boxing it seems to work, but I was hoping to see if I could find a more intelligent approach to it, since the Collection will contain other types of objects that also inherit from Base.

    Read the article

  • Running Test framework as part of application

    - by VP
    Hi, I would like to know if it is possible in rails to run some test cases through my application. I mean, i want show the test results to users. So i was thinking to be able to call my tests through a controller and put the tests output in a dialog. Imagine that i'm doing an application where before to apply a rule, i want to run some validation tests. I could write methods in my rule model to do it, but i would like to use something like shoulda or any other kind of DSL where the "fixture" would be a record itself. Any tip or idea?

    Read the article

  • How to check an exectuable's path is correct in PHP?

    - by nickf
    I'm writing a setup/installer script for my application, basically just a nice front end to the configuration file. One of the configuration variables is the executable path for mysql. After the user has typed it in (for example: /path/to/mysql-5.0/bin/mysql or just mysql if it is in their system PATH), I want to verify that it is correct. My initial reaction would be to try running it with "--version" to see what comes back. However, I quickly realised this would lead to me writing this line of code: shell_exec($somethingAUserHasEntered . " --version"); ...which is obviously a Very Bad Thing. Now, this is a setup script which is designed for trusted users only, and ones which probably already have relatively high level access to the system, but still I don't think the above solution is something I want to write. Is there a better way to verify the executable path? Perhaps one which doesn't expose a massive security hole?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • In Ruby, how do I make a hash from an array?

    - by Wizzlewott
    I have a simple array: arr = ["apples", "bananas", "coconuts", "watermelons"] I also have a function f that will perform an operation on a single string input and return a value. This operation is very expensive, so I would like to memoize the results in the hash. I know I can make the desired hash with something like this: h = {} arr.each { |a| h[a] = f(a) } What I'd like to do is not have to initialize h, so that I can just write something like this: h = arr.(???) { |a| a => f(a) } Can that be done?

    Read the article

  • How to schedule hundreds of thousands of tasks?

    - by wehriam
    We have hundreds of thousands of tasks that need to be run at a variety of arbitrary intervals, some every hour, some every day, and so on. The tasks are resource intensive and need to be distributed across many machines. Right now tasks are stored in a database with an "execute at this time" timestamp. To find tasks that need to be executed, we query the database for jobs that are due to be executed, then update the timestamps when the task is complete. Naturally this leads to a substantial write load on the database. As far as I can tell, we are looking for something to release tasks into a queue at a set interval. (Workers could then request tasks from that queue.) What is the best way to schedule recurring tasks at scale? For what it's worth we're largely using Python, although we have no problems using components (RabbitMQ?) written in other languages.

    Read the article

  • INSERT INTO othertbl SELECT * tbl

    - by Harry
    Current situation: INSERT INTO othertbl SELECT * FROM tbl WHERE id = '1' So i want to copy a record from tbl to othertbl. Both tables have an autoincremented unique index. Now the new record should have a new index, rather then the value of the index of the originating record else copying results in a index not unique error. A solution would be to not use the * but since these tables have quite some columns i really think it's getting ugly. So,.. is there a better way to copy a record which results in a new record in othertbl which has a new autoincremented index without having to write out all columns in the query and using a NULL value for the index. -hope it makes sense....-

    Read the article

  • PotgreSQL 2D array to rows

    - by PostGreSQL newbie
    Hello, I am new to PostgreSQL array's. I am trying to a write a procedure to convert array-into-rows, and wanted following output: alphabet | number ---------+---------- A | 10 B | 10 C | 6 D | 9 E | 3 from following: id | alphabet_series -------+-------------------------------------------------------------------------------------------------- 1 | {{A,10},{B,10},{C,6},{D,9},{E,3},{F,9},{I,10},{J,17},{K,16},{L,17},{M,20},{N,13},{O,19}} I have searched for array-to-rows functions, but they all seems to accept 1-d array. but in this case, it is 2-d array. Any pointers will be appreciated. Many thanks.

    Read the article

  • ByteArrayOutputStream to PrintWriter (Java Servlet)

    - by Thomas
    Writing generated PDF (ByteArrayOutputStream) in a Servlet to PrintWriter. I am desperately looking for a way to write a generated PDF file to the response PrintWriter. Since a Filter up the hierarchy chain has already called response.getWriter() I can't get response.getOutputStream(). I do have a ByteArrayOutputStream where I generated the PDF into. Now all I need is a way to output the content of this ByteArrayOutputStream to the PrintWriter. If anyone could give me a helping hand would be very much appreciated!

    Read the article

  • Why does the compiler complain "while expected" when I try to add more code?

    - by user1893578
    Write a program with a word containing @ character as an input. If the word doesn't contain @, it should prompt the user for a word with @. Once a word with @ is read, it should output the word then terminate. This is what I have done so far: public class find { public static void main(String[] args) { System.out.println(" Please enter a word with @ "); Scanner scan = new Scanner(System.in); String bad = "@"; String word = scan.next(); do if (!word.contains(bad)) System.out.println(" Please try again "); else System.out.println(" " + word); while (!word.contains(bad)); } } I can get it to terminate after a word containing "@" is given as input, but if I try to add a Scanner to the line after "please try again", it says while expected.

    Read the article

  • A simple log file format

    - by hgulyan
    Hi, I'm not sure if it was asked, but I couldn't find anything like this. My program uses a simple .txt file for log purposes, It just creates/opens a file and appends lines. After some time, I started to log quite a lot of activities, so the file became too large and hardly readable. I know, that it's not write way to do this, but I simply need to have a readable file. So I thought maybe there's a simple file format for log files and a soft to view it or if you'd have any other suggestions on this question? Thanks for help in advance.

    Read the article

  • "IOError [Errno 13] Permisson denied" when copy a file on Windows

    - by wong2
    Hi, I wrote a program that will copy a file called a.exe to C:/Windows/, then I pack it to exe with PyInstaller, and rename the exe file to a.exe. When I run the exe file, it output IOError [Errno 13] Permisson denied: 'C:/Windows/a.exe', but the file a.exe was copied to the directory C:/Windows. Then I ran it as the Administrator, it happened again... At first, I copy the file with shututil.copy, then I wrote a function myself(open a.exe, create a.exe under C:/Windows, read a.exe 's content and write to C:/Windows/a.exe, close all), but it doesn't help...Any ideas?

    Read the article

  • SQL grouping query question; evaluating a group of rows based on the value of one field.

    - by user324575
    I've got table vendorparts that lists all my parts and their vendor(s). Parts with multiple vendors have multiple records in this table. I'm trying to write a query that only returns the partid, and vendor of parts that do not have a default vendor assigned. Partid Vendor Defaultflag 1 A 1 2 B 0 2 C 0 3 D 0 3 E 0 3 F 1 4 G 0 I would like to return the following: Partid Vendor 2 A 2 B 4 G I'm obviously having issues with partid 3 and getting the query to see it as having a default vendor assigned.

    Read the article

  • c# getting value from other form

    - by djuzla123
    Situation i have: textbox(to input your name) on form1. From that form1 on button click i go to form2. From form2 button click to form3. On form3 on button click i need to writte me in empty textbox value from textbox on form1 that user wrote down. example: on form1 in textbox1 i write my name "Djuzla". When i go to form3 and click button to see what name i wrote in form1 it should show in empty textbox3 form3 "Djuzla". I'm stuck with this few hours now, and it stupid problem but i have no idea what to do next.. tried all from zillion theards on net :p

    Read the article

  • how to compress a PNG image using Java

    - by 116213060698242344024
    Hi I would like to know if there is any way in Java to reduce the size of an image (use any kind of compression) that was loaded as a BufferedImage and is going to be saved as an PNG. Maybe some sort of png imagewriteparam? I didnt find anything helpful so im stuck. heres a sample how the image is loaded and saved public static BufferedImage load(String imageUrl) { Image image = new ImageIcon(imageUrl).getImage(); bufferedImage = new BufferedImage(image.getWidth(null), image.getHeight(null), BufferedImage.TYPE_INT_ARGB); Graphics2D g2D = bufferedImage.createGraphics(); g2D.drawImage(image, 0, 0, null); return bufferedImage; } public static void storeImageAsPng(BufferedImage image, String imageUrl) throws IOException { ImageIO.write(image, "png", new File(imageUrl)); }

    Read the article

  • How come the [L] flag isn't working in my .htaccess file?

    - by George Edison
    Here are the rules: <IfModule mod_rewrite.c> RewriteEngine on RewriteRule ^$ index.php?action=home [L] RewriteRule ^[\w\W]*$ error.php [L] When a page matches the first one, it is supposed to ignore any other further rules. Yet accessing / results in error.php being invoked. Commenting out the second rule works as intended - the page redirects to index.php. What am I doing wrong? Also: is there a better way to write the last line? It's basically a catch-all.

    Read the article

  • cvRetrieveFrame crahses

    - by pooh_bear
    I'm trying to write a simple openCV code that create a capture and retrieves the first frame from it. **CvCapture *m_pCapfile = cvCreateFileCapture(m_aviFileName.c_str()); if (m_pCapfile) m_frames = cvRound(cvGetCaptureProperty(m_pCapfile, CV_CAP_PROP_FRAME_COUNT)); cvSetCaptureProperty(m_pCapfile, CV_CAP_PROP_POS_FRAMES, 0); int ret = cvGrabFrame( m_pCapfile); IplImage *cap = cvRetrieveFrame( m_pCapfile);** In m_frames is have 153, which is the correct number of frames as far as I know. cvGrabFrame returns 1 to ret however cvRetrieveFrame crashes. I tries using cvCaptureFromFile and cvCaptureFromAVI instead of cvCreateFileCapture In both cases cvRetrieveFrame method crashes. Any ideas? Thanks

    Read the article

  • (WinForm/.net) Databind List Of Classes To A DataGridView. But Not Show Certain Public Properties

    - by Pyronaut
    I'm not even sure if i'm doing this correctly. But basically I have a list of objects that are built out of a class. From there, I am binding the list to a datagrid view that is on a Windows Form (C#) From there, it shows all the public properties of the object, in the datagrid view. However there is some properties that i still need accessible from other parts of my application, but aren't really required to be visible in the DataGridView. So is there an attribute or something similar that I can write above the property to exclude it from being shown. P.S. Im binding at runtime. So i cannot edit the columns via the designer. P.P.S. Please no answers of just making public variables (Although if that is the only way, let me know :)).

    Read the article

  • between syntax, are there any equal function

    - by gcc
    /* char **mainp=malloc(sizeof(char *)*2); mainp[0]=malloc(sizeof(char)*300); mainp[1]=malloc(sizeof(char )*300); */ *I have some input about propositional calculus *After calculating some math funtion-removing paranthesis-changing"&" with ","-replacing "|" with"," I have >> (1) P,-Q,Q,-R is stored in mainp[0] R,A,P,B,F is stored in mainp[1] *My question is: Between comma , I have want to compare two pointer array. If there is any equal two or more functions(Q,-R is function representation) ,function which you will show me how to write must return int. According to example (1),function will return 1 (I expect like that) /*I have som thought://which function should I have use:*/ in for loop if( strspn(mainp[0][i])==1 ) increment d; continue; or in for loop srtcmp(mainp[0][i],mainp[1]);

    Read the article

< Previous Page | 694 695 696 697 698 699 700 701 702 703 704 705  | Next Page >