Search Results

Search found 2033 results on 82 pages for 'absolute'.

Page 70/82 | < Previous Page | 66 67 68 69 70 71 72 73 74 75 76 77  | Next Page >

  • Popup browser incompability

    - by Cornelis
    I have a popup with drop down menus on it. I've scaled it down and simplified it for test purposes, but it still doesn't work the way I want/it should. <!DOCTYPE html> <html> <head> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.4/jquery.min.js"></script> <script type="text/javascript"> jQuery(document).ready(function(){ jQuery('.trigger').click(function(){ var picker = jQuery('.popup'); jQuery('<div></div>').css({ height: screen.height, width: screen.width, position: 'absolute', 'z-index': -1, top: picker.offset().top*-1, left: picker.offset().left*-1, border: '1px solid red' }).click(function(){ picker.trigger('focusout'); jQuery(this).hide(); }).prependTo(picker); picker.css('visibility', 'visible'); }); jQuery('.popup').live("focusout", function() { jQuery('.popup').fadeTo(500, 0.0, function() { jQuery('.popup').css('visibility', 'hidden'); jQuery('.popup').css('opacity', '1.0'); }); }); }); </script> </head> <body> <p> <input type=text class=trigger /> <div id=popup-div class=popup style="visibility: hidden; border: 1px solid red"> <select> <option>option1</option> </select> <p>Popup text</p> </div> </p> </body> When you click on the input field, a 'popup' appears, if you click outside the red border it fades away. If you click on the select option it shouldn't dissappear! However on this point, Chrome doesn't work the same as IE/FF/Opera/Safari, and makes the div dissappear. (Using Chrome 4.0.295.0) Does anybody knows a work-around for Chrome? Calling event.stopPropagation() on select elements did not work so far

    Read the article

  • Help needed wit the XPath statement for Selenium test

    - by mgeorge
    I am testing a calendar component using selenium.In my test i want to click on the current date.Please help me with the XPath statement for doing that.I am adding the HTML for the calender component <input id="event_date" type="text" on="click then l:show.event.calendar" style="border: 1px solid rgb(187, 187, 187); width: 100px;" fieldset="new_event" decorator="redbox" validator="date"/> <img id="app_136" style="position: relative; top: 2px;" on="click then l:show.event.calendar" src="images/calendar.png"/> <div id="app_137" style="margin: 0pt; padding: 0pt;"> <div id="app_calendar_2" class="yui-calcontainer single withtitle" style="position: absolute; z-index: 1000;"> <div class="title">Select Event Date</div> <table id="app_calendar_2_cal" class="yui-calendar y2010" cellspacing="0"> <thead> <tr> </tr> <tr class="calweekdayrow"> <th class="calweekdaycell">Su</th> <th class="calweekdaycell">Mo</th> <th class="calweekdaycell">Tu</th> <th class="calweekdaycell">We</th> <th class="calweekdaycell">Th</th> <th class="calweekdaycell">Fr</th> <th class="calweekdaycell">Sa</th> </tr> </thead> <tbody class="m6 calbody"> <tr class="w22"> <td id="app_calendar_2_cal_cell0" class="calcell oom calcelltop calcellleft">30</td> <td id="app_calendar_2_cal_cell1" class="calcell oom calcelltop">31</td> <td id="app_calendar_2_cal_cell2" class="calcell wd2 d1 selectable calcelltop"> </td> <td id="app_calendar_2_cal_cell3" class="calcell wd3 d2 today selectable calcelltop selected"> <a class="selector" href="#">2</a> </td> I want to click the date component described in <td id="app_calendar_2_cal_cell3" class="calcell wd3 d2 today selectable calcelltop selected"> <a class="selector" href="#">2</a> </td> Thanks in advance mgeorge

    Read the article

  • content show problem

    - by nonab
    I still fight with some jquery scripts:) With my first problem Jens Fahnenbruck helped me here: http://stackoverflow.com/questions/3021476/problem-with-hide-show-in-jquery thanks:) Now i added another fancy thing - jquery tabs Made a few modifications and it works like this: When you click on tab and it loads different main image for every tab. The problem is that i used $(document).ready(function() to handle those image changes. When i click any of 2x2 box images (on any tab) it will permanently change the image on the right and when i click on tabs it won't work like it did at the beginning. online example: http://rarelips.ayz.pl/testy/2/ code: <style type="text/css"> body { font: Arial, Helvetica, sans-serif normal 10px; margin: 0; padding: 0; } * {margin: 0; padding: 0;} img {border: none;} .container { height: 500px; width: 1000px; margin: -180px 0 0 -450px; top: 50%; left: 50%; position: absolute; } ul.thumb { float: left; list-style: none; margin: 0; padding: 10px; width: 360px; } ul.thumb li { margin: 0; padding: 5px; float: left; position: relative; width: 165px; height: 165px; } ul.thumb li img { width: 150px; height: 150px; border: 1px solid #ddd; padding: 10px; background: #f0f0f0; position: absolute; left: 0; top: 0; -ms-interpolation-mode: bicubic; } ul.thumb li img.hover { background:url(thumb_bg.png) no-repeat center center; border: none; } #main_view { float: left; padding: 9px 0; margin-left: -10px; } #main_view2 { float: left; padding: 9px 0; margin-left: -10px; } #main_view3 { float: left; padding: 9px 0; margin-left: -10px; } #main_view4 { float: left; padding: 9px 0; margin-left: -10px; } #wiecej { float: right; padding: 9px 0; margin-right: 20px; } .demo-show { width: 350px; margin: 1em .5em; } .demo-show h3 { margin: 0; padding: .25em; background: #bfcd93; border-top: 1px solid #386785; border-bottom: 1px solid #386785; } .demo-show div { padding: .5em .25em; } /* styl do tabek */ ul.tabs { margin: 0; padding: 0; float: left; list-style: none; height: 32px; /*--Set height of tabs--*/ border-bottom: 1px solid #999; border-left: 1px solid #999; width: 100%; } ul.tabs li { float: left; margin: 0; padding: 0; height: 31px; /*--Subtract 1px from the height of the unordered list--*/ line-height: 31px; /*--Vertically aligns the text within the tab--*/ border: 1px solid #999; border-left: none; margin-bottom: -1px; /*--Pull the list item down 1px--*/ overflow: hidden; position: relative; background: #e0e0e0; } ul.tabs li a { text-decoration: none; color: #000; display: block; font-size: 1.2em; padding: 0 20px; border: 1px solid #fff; /*--Gives the bevel look with a 1px white border inside the list item--*/ outline: none; } ul.tabs li a:hover { background: #ccc; } html ul.tabs li.active, html ul.tabs li.active a:hover { /*--Makes sure that the active tab does not listen to the hover properties--*/ background: #fff; border-bottom: 1px solid #fff; /*--Makes the active tab look like it's connected with its content--*/ } .tab_container { border: 1px solid #999; border-top: none; overflow: hidden; clear: both; float: left; width: 100%; background: #fff; } .tab_content { padding: 20px; font-size: 1.2em; } </style> <script type="text/javascript" src="index_pliki/jquery-latest.js"></script> <script type="text/javascript"> $(document).ready(function(){ //Larger thumbnail preview $("ul.thumb li").hover(function() { $(this).css({'z-index' : '10'}); $(this).find('img').addClass("hover").stop() .animate({ marginTop: '-110px', marginLeft: '-110px', top: '50%', left: '50%', width: '200px', height: '200px', padding: '5px' }, 200); } , function() { $(this).css({'z-index' : '0'}); $(this).find('img').removeClass("hover").stop() .animate({ marginTop: '0', marginLeft: '0', top: '0', left: '0', width: '150px', height: '150px', padding: '10px' }, 400); }); //Swap Image on Click $("ul.thumb li a").click(function() { var mainImage = $(this).attr("href"); //Find Image Name $("#main_view img").attr({ src: mainImage }); $("#main_view2 img").attr({ src: mainImage }); $("#main_view3 img").attr({ src: mainImage }); $("#main_view4 img").attr({ src: mainImage }); return false; }); }); </script> <script type="text/javascript"> $(document).ready(function() { $("#main_view img").attr({ src: './index_pliki/max1.jpg' }); $("#slickbox div[data-id=" + '01' + "].slickbox").show('slow'); $('a.slick-toggle').click(function() { var dataID = $(this).attr("data-id"); $('#slickbox div.slickbox').hide(); $("#slickbox div[data-id=" + dataID + "].slickbox").show('slow'); return false; }); }); </script> <script type="text/javascript"> $(document).ready(function() { $("#main_view2 img").attr({ src: './index_pliki/max2.jpg' }); $("#slickbox2 div[data-id=" + '11' + "].slickbox2").show('slow'); $('a.slick-toggle').click(function() { var dataID = $(this).attr("data-id"); $('#slickbox2 div.slickbox2').hide(); $("#slickbox2 div[data-id=" + dataID + "].slickbox2").show('slow'); return false; }); }); </script> <script type="text/javascript"> $(document).ready(function() { $("#main_view3 img").attr({ src: './index_pliki/max3.jpg' }); $("#slickbox3 div[data-id=" + '21' + "].slickbox3").show('slow'); $('a.slick-toggle').click(function() { var dataID = $(this).attr("data-id"); $('#slickbox3 div.slickbox3').hide(); $("#slickbox3 div[data-id=" + dataID + "].slickbox3").show('slow'); return false; }); }); </script> <script type="text/javascript"> $(document).ready(function() { $("#main_view4 img").attr({ src: './index_pliki/max4.jpg' }); $("#slickbox4 div[data-id=" + '31' + "].slickbox4").show('slow'); $('a.slick-toggle').click(function() { var dataID = $(this).attr("data-id"); $('#slickbox4 div.slickbox4').hide(); $("#slickbox4 div[data-id=" + dataID + "].slickbox4").show('slow'); return false; }); }); </script> <script type ="text/javascript"> $(document).ready(function() { //When page loads... $(".tab_content").hide(); //Hide all content $("ul.tabs li:first").addClass("active").show(); //Activate first tab $(".tab_content:first").show(); //Show first tab content //On Click Event $("ul.tabs li").click(function() { $("ul.tabs li").removeClass("active"); //Remove any "active" class $(this).addClass("active"); //Add "active" class to selected tab $(".tab_content").hide(); //Hide all tab content var activeTab = $(this).find("a").attr("href"); //Find the href attribute value to identify the active tab + content $(activeTab).fadeIn(); //Fade in the active ID content return false; }); }); </script> </head> <body> <div class="container"> <ul class="tabs"> <li><a href="#tab1">1</a></li> <li><a href="#tab2">2</a></li> <li><a href="#tab3">3</a></li> <li><a href="#tab4">4</a></li> </ul> <div class="tab_container"> <div id="tab1" class="tab_content"> <!--Content--> <ul class="thumb"> <li><a class="slick-toggle" href="./index_pliki/max1.jpg" data-id="01"><img src="./index_pliki/min1.jpg" alt="" /></a></li> <li><a class="slick-toggle" href="./index_pliki/max2.jpg" data-id="02"><img src="./index_pliki/min2.jpg" alt="" /></a></li> <li><a class="slick-toggle" href="./index_pliki/max3.jpg" data-id="03"><img src="./index_pliki/min3.jpg" alt="" /></a></li> <li><a class="slick-toggle" href="./index_pliki/max4.jpg" data-id="04"><img src="./index_pliki/min4.jpg" alt="" /></a></li> </ul> <div id="main_view"> <a href="index.htm"><img src="index_pliki/max1.jpg" alt=""/></a> <small style="float: right; color: rgb(153, 153, 153);"> </small> </div> <div id="wiecej"> <div id="slickbox"> <div id="someOtherID" class="slickbox" data-id="01" style="display: none;"> 1.1 </div> <div id="someOtherID" class="slickbox" data-id="02" style="display: none;"> 1.2 </div> <div id="someOtherID" class="slickbox" data-id="03" style="display: none;"> 1.3 </div> <div id="someOtherID" class="slickbox" data-id="04" style="display: none;"> 1.4 </div> <!-- <a href="#" id="slick-show"><img src="http://www.amptech.pl/images/more.jpg" alt="Zobacz wiecej" /></a> <a href="#" id="slick-hide"><img src="http://www.amptech.pl/images/online.jpg" alt="Zobacz wiecej" /></a>&nbsp;&nbsp; --> </div> </div> </div> <!-- tutaj wklejalem reszte --> <div id="tab2" class="tab_content"> <!--Content--> <ul class="thumb"> <li><a class="slick-toggle" href="./index_pliki/max4.jpg" data-id="11"><img src="./index_pliki/min4.jpg" alt="" /></a></li> <li><a class="slick-toggle" href="./index_pliki/max3.jpg" data-id="12"><img src="./index_pliki/min3.jpg" alt="" /></a></li> <li><a class="slick-toggle" href="./index_pliki/max2.jpg" data-id="13"><img src="./index_pliki/min2.jpg" alt="" /></a></li> <li><a class="slick-toggle" href="./index_pliki/max1.jpg" data-id="14"><img src="./index_pliki/min1.jpg" alt="" /></a></li> </ul> <div id="main_view2"> <a href="index.htm"><img src="index_pliki/max1.jpg" alt=""/></a> <small style="float: right; color: rgb(153, 153, 153);"> </small> </div> <div id="wiecej"> <div id="slickbox2"> <div id="someOtherID" class="slickbox2" data-id="11" style="display: none;"> 2.1 </div> <div id="someOtherID" class="slickbox2" data-id="12" style="display: none;"> 2.2 </div> <div id="someOtherID" class="slickbox2" data-id="13" style="display: none;"> 2.3 </div> <div id="someOtherID" class="slickbox2" data-id="14" style="display: none;"> 2.4 </div> </div> </div> </div> <div id="tab3" class="tab_content"> <ul class="thumb"> <li><a class="slick-toggle" href="./index_pliki/max4.jpg" data-id="21"><img src="./index_pliki/min4.jpg" alt="" /></a></li> <li><a class="slick-toggle" href="./index_pliki/max3.jpg" data-id="22"><img src="./index_pliki/min3.jpg" alt="" /></a></li> <li><a class="slick-toggle" href="./index_pliki/max2.jpg" data-id="23"><img src="./index_pliki/min2.jpg" alt="" /></a></li> <li><a class="slick-toggle" href="./index_pliki/max1.jpg" data-id="24"><img src="./index_pliki/min1.jpg" alt="" /></a></li> </ul> <div id="main_view3"> <a href="index.htm"><img src="index_pliki/max1.jpg" alt=""/></a> <small style="float: right; color: rgb(153, 153, 153);"> </small> </div> <div id="wiecej"> <div id="slickbox3"> <div id="someOtherID" class="slickbox3" data-id="21" style="display: none;"> 3.1 </div> <div id="someOtherID" class="slickbox3" data-id="22" style="display: none;"> 3.2 </div> <div id="someOtherID" class="slickbox3" data-id="23" style="display: none;"> 3.3 </div> <div id="someOtherID" class="slickbox3" data-id="24" style="display: none;"> 3.4 </div> </div> </div> </div> <div id="tab4" class="tab_content"> <ul class="thumb"> <li><a class="slick-toggle" href="./index_pliki/max4.jpg" data-id="31"><img src="./index_pliki/min4.jpg" alt="" /></a></li> <li><a class="slick-toggle" href="./index_pliki/max3.jpg" data-id="32"><img src="./index_pliki/min3.jpg" alt="" /></a></li> <li><a class="slick-toggle" href="./index_pliki/max2.jpg" data-id="33"><img src="./index_pliki/min2.jpg" alt="" /></a></li> <li><a class="slick-toggle" href="./index_pliki/max1.jpg" data-id="34"><img src="./index_pliki/min1.jpg" alt="" /></a></li> </ul> <div id="main_view4"> <a href="index.htm"><img src="index_pliki/max1.jpg" alt=""/></a> <small style="float: right; color: rgb(153, 153, 153);"> </small> </div> <div id="wiecej"> <div id="slickbox4"> <div id="someOtherID" class="slickbox4" data-id="31" style="display: none;"> 4.1 </div> <div id="someOtherID" class="slickbox4" data-id="32" style="display: none;"> 4.2 </div> <div id="someOtherID" class="slickbox4" data-id="33" style="display: none;"> 4.3 </div> <div id="someOtherID" class="slickbox4" data-id="34" style="display: none;"> 4.4 </div> </div> </div> </div> </div> </div>

    Read the article

  • response.redirect to classic asp failing {Unable to evaluate expression because the code is optimize

    - by jeff
    I have the following code pasted below. For some reason, the response.redirect seems to be failing and it is maxing out the cpu on my server and just doesn't do anything. The .net code uploads the file fine, but does not redirect to the asp page to do the processing. I know this is absolute rubbish why would you have .net code redirecting to classic asp, it is a legacy app. I have tried putting false or true etc. at the end of the redirect as I have read other people have had issues with this. Please help as it's driving me insane! It's so strange, it runs locally on my machine but won't run on my server! I am getting the following error when I debugged remotely. {Unable to evaluate expression because the code is optimized or a native frame is on top of the call stack.} (UPDATED) After debugging remotely and taking the redirect out of the try catch, I have found that the redirect is trying to get to the correct location but after it leaves the redirect is just seems to get lost. (almost as if it can't navigate away from the cobra_import project) back up a level to COBRA/pages. Why is this??? This has worked previously!!! public void btnUploadTheFile_Click(object Source, EventArgs evArgs) { //need to check that the uploaded file is an xls file. string strFileNameOnServer = "PJI3.txt"; string strBaseLocation = ConfigurationSettings.AppSettings["str_file_location"]; if ("" == strFileNameOnServer) { txtOutput.InnerHtml = "Error - a file name must be specified."; return; } if (null != uplTheFile.PostedFile) { try { uplTheFile.PostedFile.SaveAs(strBaseLocation+strFileNameOnServer); txtOutput.InnerHtml = "File <b>" + strBaseLocation+strFileNameOnServer+"</b> uploaded successfully"; Response.Redirect ("/COBRA/pages/sap_import_pji3_prc.asp"); } catch (Exception e) { txtOutput.InnerHtml = "Error saving <b>" + strBaseLocation+strFileNameOnServer+"</b><br>"+ e.ToString(); } } }

    Read the article

  • Why won't this Jquery run on IE?

    - by Charles Marsh
    Hello All, I have this Jquery code (function($){ $.expr[':'].linkingToImage = function(elem, index, match){ // This will return true if the specified attribute contains a valid link to an image: return !! ($(elem).attr(match[3]) && $(elem).attr(match[3]).match(/\.(gif|jpe?g|png|bmp)$/i)); }; $.fn.imgPreview = function(userDefinedSettings){ var s = $.extend({ /* DEFAULTS */ // CSS to be applied to image: imgCSS: {}, // Distance between cursor and preview: distanceFromCursor: {top:2, left:2}, // Boolean, whether or not to preload images: preloadImages: true, // Callback: run when link is hovered: container is shown: onShow: function(){}, // Callback: container is hidden: onHide: function(){}, // Callback: Run when image within container has loaded: onLoad: function(){}, // ID to give to container (for CSS styling): containerID: 'imgPreviewContainer', // Class to be given to container while image is loading: containerLoadingClass: 'loading', // Prefix (if using thumbnails), e.g. 'thumb_' thumbPrefix: '', // Where to retrieve the image from: srcAttr: 'rel' }, userDefinedSettings), $container = $('<div/>').attr('id', s.containerID) .append('<img/>').hide() .css('position','absolute') .appendTo('body'), $img = $('img', $container).css(s.imgCSS), // Get all valid elements (linking to images / ATTR with image link): $collection = this.filter(':linkingToImage(' + s.srcAttr + ')'); // Re-usable means to add prefix (from setting): function addPrefix(src) { return src.replace(/(\/?)([^\/]+)$/,'$1' + s.thumbPrefix + '$2'); } if (s.preloadImages) { (function(i){ var tempIMG = new Image(), callee = arguments.callee; tempIMG.src = addPrefix($($collection[i]).attr(s.srcAttr)); tempIMG.onload = function(){ $collection[i + 1] && callee(i + 1); }; })(0); } $collection .mousemove(function(e){ $container.css({ top: e.pageY + s.distanceFromCursor.top + 'px', left: e.pageX + s.distanceFromCursor.left + 'px' }); }) .hover(function(){ var link = this; $container .addClass(s.containerLoadingClass) .show(); $img .load(function(){ $container.removeClass(s.containerLoadingClass); $img.show(); s.onLoad.call($img[0], link); }) .attr( 'src' , addPrefix($(link).attr(s.srcAttr)) ); s.onShow.call($container[0], link); }, function(){ $container.hide(); $img.unbind('load').attr('src','').hide(); s.onHide.call($container[0], this); }); // Return full selection, not $collection! return this; }; })(jQuery); It works perfectly in all browsers apart from IE, which it does nothing, no errors, no clues? I have a funny feeling IE doesn't support attr? Can anyone offer any advice?

    Read the article

  • On Mac, two jpg's whose color should match do not

    - by Tim
    So I'm designing a myspace page and I have two images, one is a repeating bg image, and another is an image which loads on a layer above it, which acts as a header/masthead. For some reason, on Macs only, and only in the browser (tested in safari and ff), the masthead renders slightly darker than the repeating bg image, creating this color inconsistency. The block that extends up behind the album artwork is a solid box made with css which blocks some of myspace's standard content. It actually renders as the proper color, blending in well with the bottom portion of this image, which is the repeating part of the background, but becomes noticeable as it extends up, over the masthead, which is darker than it should be. Both images where created in GIMP and saved as jpg's using, as far as i can tell, the same settings. Here's the pic of what is going on: Screenshot - Click Me!!! Here is the code which controls this part of the design. <div class="masthead"><span></span></div> .masthead {width: 1600px; height: 1940px; background-image:url(http://www.sourtricks.com/myspace/bdww/myspace_bg09.jpg); position: absolute; margin-left: -800px; left: 50%; top: 0px; z-index: -1; overflow-x: hidden;} body.bodyContent{ margin: 0 !important; padding: 0 !important; background-color: 000000 !important; font-size: 1px; background-image: url(http://www.sourtricks.com/myspace/bdww/bg_repeat05.jpg); background-position: center bottom; _background-position: right bottom; background-attachment: scroll; background-repeat: repeat-y; z-index: -2; overflow-x: hidden; font-family: arial, sans-serif !important; } Any help would be much, much, much appreciated. Thanks for your time, Tim

    Read the article

  • usercontrol hosted in IE renders as a textbox

    - by coxymla
    On my ongoing saga to mirror the hosting of a legacy app on a clean box, I've hit my next snag. One page relies on a big .NET UserControl that on the new machine renders only as a big, greyed out textarea (greyed out vertical scrollbar on the right hand edge. Inspecting the source shows the expected object tag.) This is particularly tricky because nobody seems to know much about hosted UserControls and all the discussions data back to 2002-2004. The page is quite simple: <%@ Page language="c#" Codebehind="DataExport.aspx.cs" AutoEventWireup="false" Inherits="yyyyy.Web.DataExport" %> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN" > <html> <head> <title>DataExport</title> <link rel="Configuration" href="/xxxxx/yyyyy/DataExport.config"> </head> <body style="margin:0px;padding:0px;overflow:hidden"> <OBJECT id="DataExport" style="WIDTH: 100%; HEIGHT: 100%; position:absolute; left: 0px; top:0px" classid="yyyyy.Common.dll#yyyyy.Controls.DataExport" VIEWASTEXT> </OBJECT> </body> </html> The config file referenced: <?xml version="1.0" encoding="utf-8" ?> <configuration> <configSections> <sectionGroup name="yyyyy"> <section name="dataExport" type="yyyyy.Controls.DataExportSectionHandler,yyyyy.Common" /> </sectionGroup> </configSections> <yyyyy> <dataExport> <layoutFile>http://vm2/xxxxx/yyyyy/layout.xml</layoutFile> <webServiceUrl>http://vm2/xxxxx/yyyyy/services/yyyyy.asmx</webServiceUrl> </dataExport> </yyyyy> </configuration> What I've checked: Security permissions should be OK, the site is trusted and adding a URL exception to grant FullTrust doesn't change anything. Config file is acessible over the web, layout.xml is accessible, ASMX shows the expected command list Machine.config grants GET permission for the usercontrol.config file. What perhaps looks fishy to me: The DataExport UserControl references Aspose.Excel to generate the spreadsheets it exports. When I navigate to the page and get a blank textbox, then run gacutil /ldl, nothing is in the local download cache. On the working machine, running the same command after viewing the page shows a laundry list of DLLs including the control DLL and the Aspose DLL.

    Read the article

  • show-hide image onmouseover

    - by butters
    I have 3 images on top of each other. The first one is a normal .jpg image, the second a greyscale version and the 3rd is some kind of effect i add with a transparent .png Now what i want is that, if i move the mouse over those images, the greyscale image is hidden or replaced by another image and afterwards visible again. The problem here is that i am a js noob, so it's kind of hard for me to find a solution ^^ my code looks something like this: <html> <head> <style type="text/css"> <!-- ul li{ display: inline-table; } .frame{ position: relative; height: 110px; width: 110px; } .frame div{ position: absolute; top:0px; left:0px; } .effect{ background:url(images/effect.png) no-repeat; height:110px; width: 110px; } .image{ height:100px; width:100px; border: 1px solid red; margin:4px; } .greyscale{ height:100px; width:100px; border: 1px solid red; margin:4px; } --> </style> </head> <body> <ul> <li> <div class="frame"> <div class="image"><img src="images/pic1.jpg" height="100" width="100"></div> <div class="greyscale"><img src="images/grey1.jpg" height="100" width="100"></div> <div class="effect">qwert</div> </div> </li> <li> <div class="frame"> <div class="image"><img src="images/pic2.jpg" height="100" width="100"></div> <div class="greyscale"><img src="images/grey2.jpg" height="100" width="100"></div> <div class="effect">qewrt</div> </div> </li> </ul> </body> </html> </code></pre> would be super-awesome if someone can help me out :)

    Read the article

  • IE6 CSS tooltip not appearing

    - by Lauren
    I'm using a tooltip that works in FF, Chrome, and IE7-8, but in IE6 it doesn't appear. You can go to this page http://www.avaline.com/ Bags/ Eco-Friendly-Bags/R1500 and login with [email protected] password:test02, then hit the "add to cart" button and hover over the question marks to see (or not see) the tooltips. This is the relevant HTML and CSS: <DIV class=oewBox id=oewImpLocDiv style="BACKGROUND-IMAGE: url(/images/img/org4.gif)"> <A class=tooltip href="#"><SPAN class=""><STRONG>More than 2 imprint locations?</STRONG> Test </SPAN></A> </DIV> <style> /* Rule from element "style" attribute */ element.style { BACKGROUND-IMAGE: url(/images/img/org4.gif) } /* Rule N°8 from inline stylesheet */ .oewBox { PADDING-RIGHT: 8px; PADDING-LEFT: 40px; PADDING-BOTTOM: 16px; MARGIN: 0px 0px 6px; PADDING-TOP: 6px; BORDER-BOTTOM: #ff7c14 3px solid } /* Rule N°7 from inline stylesheet */ .oewBox { BACKGROUND-POSITION: 0px 0px; BACKGROUND-IMAGE: none; BACKGROUND-REPEAT: no-repeat } /* Rule N°11 from /site/av-files/mainstyles.css */ A:active { COLOR: #3b88c4; TEXT-DECORATION: none } /* Rule N°10 from /site/av-files/mainstyles.css */ A:hover { COLOR: #000; TEXT-DECORATION: none } /* Rule N°9 from /site/av-files/mainstyles.css */ A:visited { COLOR: #3b88c4; TEXT-DECORATION: underline } /* Rule N°8 from /site/av-files/mainstyles.css */ A:link { COLOR: #3b88c4; TEXT-DECORATION: underline } /* Rule N°7 from /site/av-files/mainstyles.css */ A { COLOR: #3b88c4; TEXT-DECORATION: underline } /* Rule N°52 from inline stylesheet */ A.tooltip { BACKGROUND: url(/images/img/question.gif) no-repeat; FLOAT: right; WIDTH: 19px; HEIGHT: 20px } /* Rule N°54 from inline stylesheet */ A.tooltip:hover SPAN { BORDER-RIGHT: #ff7c14 1px solid; BORDER-TOP: #ff7c14 1px solid; DISPLAY: inline; BACKGROUND: #ffffff; BORDER-LEFT: #ff7c14 1px solid; COLOR: #000; BORDER-BOTTOM: #ff7c14 1px solid; POSITION: absolute } /* Rule N°53 from inline stylesheet */ A.tooltip SPAN { PADDING-RIGHT: 3px; DISPLAY: none; PADDING-LEFT: 3px; FONT-WEIGHT: normal; FONT-SIZE: 11px; PADDING-BOTTOM: 2px; MARGIN-LEFT: -245px; WIDTH: 230px; PADDING-TOP: 2px } </style>

    Read the article

  • How can I show a div, then hide the other divs when a link is clicked?

    - by Abriel
    I am right now trying to hide six divs while showing only one of the divs. I've tried JavaScript and in jQuery, but nothing seems to work! Click here to get to the website. I would like to know if it has to do with my CSS, jQuery, or the HTML. Or is there an easier way of doing this? HTML: <div id="resourceLinks"> <a href="#" name="resource" id="resource1">General&nbsp;Information</a><br /> <a href="#" name="resource" id="resource2">Automatic&nbsp;401(k)</a><br /> <a href="#" name="resource" id="resource3">Consumer&nbsp;Fraud</a><br /> <a href="#" name="resource" id="resource4">Direct&nbsp;Deposit</a><br /> <a href="#" name="resource" id="resource5">Diversity</a><br /> <a href="#" name="resource" id="resource6">Women</a><br /> <a href="#" name="resource" id="resource7">Young&nbsp;Adults&nbsp;(20s&nbsp;-&nbsp;40s)</a> </div> <div id="resource1></div> <div id="resource2></div> <div id="resource3></div> <div id="resource4></div> <div id="resource5></div> <div id="resource6></div> <div id="resource7></div> CSS: #resource1, #resource2, #resource3, #resource4, #resource5, #resource6, #resource7 { position: absolute; margin-left: 400px; margin-top: -10px; width: 300px; padding-bottom: 120px; } #resourceLinks { position: fixed; margin-left: -450px; z-index: 3; margin-top: 180px; font-size: 16px; } jQuery: $(document).ready(function(){ $('#resourceLinks a').click(function (selected) { var getName = $(this).attr("id"); var projectImages = $(this).attr("name"); $(function() { $(".resource").hide().removeClass("current"); $("#" + projectImages ).show("normal").addClass("current"); }); }); });

    Read the article

  • How do I use data from the main window in a sub-window?

    - by eagle
    I've just started working on a photo viewer type desktop AIR app with Flex. From the main window I can launch sub-windows, but in these sub-windows I can't seem to access the data I collected in the main window. How can I access this data? Or, how can I send this data to the sub-window on creation? It doesn't need to be dynamically linked. myMain.mxml <?xml version="1.0" encoding="utf-8"?> <s:WindowedApplication xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:mx="library://ns.adobe.com/flex/mx" width="260" height="200" title="myMain"> <fx:Declarations> </fx:Declarations> <fx:Script> <![CDATA[ public function openWin():void { new myWindow().open(); } public var myData:Array = new Array('The Eiffel Tower','Paris','John Doe'); ]]> </fx:Script> <s:Button x="10" y="10" width="240" label="open a sub-window" click="openWin();"/> </s:WindowedApplication> myWindow.mxml <?xml version="1.0" encoding="utf-8"?> <mx:Window name="myWindow" title="myWindow" xmlns:mx="http://www.adobe.com/2006/mxml" layout="absolute" width="640" height="360"> <mx:Script> <![CDATA[ ]]> </mx:Script> <mx:Label id="comment" x="10" y="10" text=""/> <mx:Label id="location" x="10" y="30" text=""/> <mx:Label id="author" x="10" y="50" text=""/> </mx:Window> I realize this might be a very easy question but I have searched the web, read and watched tutorials on random AIR subjects for a few days and couldn't find it. The risk of looking like a fool is worth it now, I want to get on with my first app!

    Read the article

  • Make Div overlay ENTIRE page (not just viewport)??

    - by Polaris878
    Hello, So I have a problem that I think is quite common but I have yet to find a good solution for. I want to make an overlay div cover the ENTIRE page... NOT just the viewport. I don't understand why this is so hard to do... I've tried setting body, html heights to 100% etc but that isn't working. Here is what I have so far: <html> <head> <style type="text/css"> .OverLay { position: absolute; z-index: 3; opacity: 0.5; filter: alpha(opacity = 50); top: 0; bottom: 0; left: 0; right: 0; width: 100%; height: 100%; background-color: Black; color: White;} body { height: 100%; } html { height: 100%; } </style> </head> <body> <div style="height: 100%; width: 100%; position: relative;"> <div style="height: 100px; width: 300px; background-color: Red;"> </div> <div style="height: 230px; width: 9000px; background-color: Green;"> </div> <div style="height: 900px; width: 200px; background-color: Blue;"></div> <div class="OverLay">TestTest!</div> </div> </body> </html> I'd also be open to a solution in JavaScript if one exists, but I'd much rather just be using some simple CSS.

    Read the article

  • JSON or YAML encoding in GWT/Java on both client and server

    - by KennethJ
    I'm looking for a super simple JSON or YAML library (not particularly bothered which one) written in Java, and can be used in both GWT on the client, and in its original Java form on the server. What I'm trying to do is this: I have my models, which are shared between the client and the server, and these are the primary source of data interchange. I want to design the web service in between to be as simple as possible, and decided to take the RESTful approach. My problem is that I know our application will grow substantially in the future, and writing all the getters, setters, serialization, factories, etc. by hand fills me with absolute dread. So in order to avoid it, I decided to implement annotations to keep track of attributes on the models. The reason I can't just serialize everything directly, using GWT's own one, or one which works through reflection, is because we need a certain amount of logic going on in the serialization process. I.e. whether references to other models get serialized during the serialization of the original model, or whether an ID is just passed, and general simple things like that. I've then written an annotation processor to preprocess my shared models and generate an implementing class with all the getters, setters, serialization, lazy-loading, etc. To make a long story short, I need some type of simple YAML or JSON library, which allows me to encode and decode manually, so I can generate this code through my annotation processor. I have had a look around the interwebs, but every single one I ran into supported some reflection which, while all fine and dandy, make it pretty much useless for GWT. And in the case of GWT's own JSON library, it uses JSNI for speed purposes, making it useless server side. One solution I did think about involved writing writing two sets of serialization methods on the models, one for the client and one for the server, but I'd rather not do that. Also, I'm pretty new to GWT, and even though I have done a lot of Java, it was back in the 1.2 days, so it's a bit rusty. So if you think I'm going about this problem completely the wrong way, I'm open to suggestions.

    Read the article

  • JSF 2.0: Preserving component state across multiple views

    - by tlind
    The web application I am developing using MyFaces 2.0.3 / PrimeFaces 2.2RC2 is divided into a content and a navigation area. In the navigation area, which is included into multiple pages using templating (i.e. <ui:define>), there are some widgets (e.g. a navigation tree, collapsible panels etc.) of which I want to preserve the component state across views. For example, let's say I am on the home page. When I navigate to a product details page by clicking on a product in the navigation tree, my Java code triggers a redirect using navigationHandler.handleNavigation(context, null, "/detailspage.jsf?faces-redirect=true") Another way of getting to that details page would be by directly clicking on a product teaser that is shown on the home page. The corresponding <h:link> would lead us to the details page. In both cases, the expansion state of my navigation tree (a PrimeFaces tree component) and my collapsible panels is lost. I understand this is because the redirect / h:link results in the creation of a new view. What is the best way of dealing with this? I am already using MyFaces Orchestra in my project along with its conversation scope, but I am not sure if this is of any help here (since I'd have to bind the expansion/collapsed state of the widgets to a backing bean... but as far as I know, this is not possible). Is there a way of telling JSF which component states to propagate to the next view, assuming that the same component exists in that view? I guess I could need a pointer into the right direction here. Thanks! Update 1: I just tried binding the panels and the tree to a session-scoped bean, but this seems to have no effect. Also, I guess I would have to bind all child components (if any) manually, so this doesn't seem like the way to go. Update 2: Binding UI components to non-request scoped beans is not a good idea (see link I posted in a comment below). If there is no easier approach, I might have to proceed as follows: When a panel is collapsed or the tree is expanded, save the current state in a session-scoped backing bean (!= the UI component itself) The components' states are stored in a map. The map key is the component's (hopefully) unique, relative ID. I cannot use the whole absolute component path here, since the IDs of the parent naming containers might change if the view changes, assuming these IDs are generated programmatically. As soon as a new view gets constructed, retrieve the components' states from the map and apply them to the components. For example, in case of the panels, I can set the collapsed attribute to a value retrieved from my session-scoped backing bean.

    Read the article

  • Classes to Entities; Like-class inheritence problems

    - by Stacey
    Beyond work, some friends and I are trying to build a game of sorts; The way we structure some of it works pretty well for a normal object oriented approach, but as most developers will attest this does not always translate itself well into a database persistent approach. This is not the absolute layout of what we have, it is just a sample model given for sake of representation. The whole project is being done in C# 4.0, and we have every intention of using Entity Framework 4.0 (unless Fluent nHibernate can really offer us something we outright cannot do in EF). One of the problems we keep running across is inheriting things in database models. Using the Entity Framework designer, I can draw the same code I have below; but I'm sure it is pretty obvious that it doesn't work like it is expected to. To clarify a little bit; 'Items' have bonuses, which can be of anything. Therefore, every part of the game must derive from something similar so that no matter what is 'changed' it is all at a basic enough level to be hooked into. Sounds fairly simple and straightforward, right? So then, we inherit everything that pertains to the game from 'Unit'. Weights, Measures, Random (think like dice, maybe?), and there will be other such entities. Some of them are similar, but in code they will each react differently. We're having a really big problem with abstracting this kind of thing into a database model. Without 'Enum' support, it is proving difficult to translate into multiple tables that still share a common listing. One solution we've depicted is to use a 'key ring' type approach, where everything that attaches to a character is stored on a 'Ring' with a 'Key', where each Key has a Value that represents a type. This works functionally but we've discovered it becomes very sluggish and performs poorly. We also dislike this approach because it begins to feel as if everything is 'dumped' into one class; which makes management and logical structure difficult to adhere to. I was hoping someone else might have some ideas on what I could do with this problem. It's really driving me up the wall; To summarize; the goal is to build a type (Unit) that can be used as a base type (Table per Type) for generic reference across a relatively global scope, without having to dump everything into a single collection. I can use an Interface to determine actual behavior so that isn't too big of an issue. This is 'roughly' the same idea expressed in the Entity Framework.

    Read the article

  • How to preserve sibling element position when one sibling is absolutely positioned?

    - by Casey
    In the snippet below, the child div is normally positioned until it is :hovered , when it becomes absolutely positioned. The reasoning behind this markup is to simulate a popup style in a limited environment where I can't use a <select> (among other limitations). When child is hovered, the sibling elements jump around, which is expected, as the contents of the block have changed. But how can I preserve their positioning? That is, what CSS can I add to prevent the siblings from jumping around when child is hovered. Javascript is also not allowed, so please no answers using JS. HTML: <div class="container"> <div class="child"> <span class="d4"></span> <label><input type="radio" name="radio" value="1"/>One</label> <label><input type="radio" name="radio" value="2"/>Two</label> </div> <input type="text" name="sibling"/> <button name="sibling2">Button</button> </div> CSS: .container, .child, button { display:inline-block; } .child { vertical-align: middle; width: 35px; height: 35px; } .child:hover { background: gray; position:absolute; width: 100px; height: auto; } .child:hover > .d4 { display: none; } .child label { display:none; } .child:hover label { display: inline-block; } .d4 { background-position: -411px -1px; width: 35px; height: 35px; background-image: url("https://i.imgur.com/zkgyBOi.png"); background-repeat: no-repeat; color: transparent; display: inline-block; } Here's a fiddle: http://jsfiddle.net/cpctZ/1/

    Read the article

  • jquery xml slideshow using ajax

    - by Codemaster Snake
    Hi all, I am trying to create a JQuery based slider using ajax to load images url from a xml file and then creating a html li list dynamically. Till now I am able to append and create DOM structure using Jquery. But I am not able to access the dynamically created list. I have also tried custom events using bind but not able to successfully implement it. Following is my jquery plugin code: (function($){ $.fn.genie = function(options) { var genie_dom = "<div class='genie_wrapper'><ul class='genie'></ul></div>"; var o, base; var genie_styles = "<style>.genie_wrapper{overflow:hidden}.genie{position: relative;margin:0;padding:0}.genie li {position: absolute;margin:0;padding:0}</style>"; var defaults = { width : '960px', height : '300px', background_color : '#000000', xml : 'genie.xml', speed : 1000, pause: 1000 }; base = $(this); o = $.extend(defaults, options); return this.each(function() { create_elements(); }); function create_elements() { $(base).html(genie_dom); $('head').append(genie_styles); $('.genie_wrapper').css({'background-color' : o.background_color, width : o.width, height: '300px', overflow: ''}); $.ajax({ type: "GET", url: o.xml, dataType: "xml", success: function(xml) { var slides = $(xml).find('slide'); var count = 0; $(slides).each(function(){ $('.genie').append('<li class="slide" id="slide'+count+'"><img src="' + $(this).text() + '" /></li>'); $('.genie li:last').css({'z-index' : count}); count++; }); } }); } } })(jQuery); In my html file: There is only one empty div to which I am calling my plugin like $(document).ready(function() { $('.slideshow').genie(); }); I have also tried using following everywhere in JS: $(".slide").bind("start_animation", function(e){ $(this).fadeOut(1000); alert($(this).html()); }); $(".slide").trigger("start_animation"); I want to animate li list using animate function, Can anyone please tell me how to implement it... It would be of great help... Regards, Neeraj Kumar EDIT: Can Anyone help me out please????

    Read the article

  • how to get mxml file in ActionScript class

    - by nemade-vipin
    hello friend I want to refer my mxml file into Actionscript class.My code is :- Mxml file is :- var User:Authentication; User = new Authentication(); User.authentication(); } ]] <mx:Panel width="100%" height="100%" layout="absolute"> <mx:TabNavigator width="100%" height="100%" id="viewstack2"> <mx:Form label="Login Form" id="loginform"> <mx:FormItem label="Mobile no:" creationPolicy="all"> <mx:TextInput id="mobileno"/> </mx:FormItem> <mx:FormItem label="Password:" creationPolicy="all"> <mx:TextInput displayAsPassword="true" id="password" /> </mx:FormItem> <mx:FormItem> <mx:Button label="Login" click="authentication()"/> </mx:FormItem> </mx:Form> <mx:Form label="Child List"> <mx:Label width="100%" color="blue" text="Select Child."/> </mx:Form> </mx:TabNavigator> </mx:Panel> Action script class is package SBTSBusineesObject { import generated.webservices.*; import mx.collections.ArrayCollection; import mx.controls.Alert; import mx.rpc.events.FaultEvent; public class Authentication { [Bindable] private var childName:ArrayCollection; [Bindable] private var childId:ArrayCollection; private var photoFeed:ArrayCollection; private var arrayOfchild:Array; private var newEntry:GetSBTSMobileAuthentication; public var user:SBTSWebService; public var mxmlobj:SBTS =null; public function authentication():void { user = new SBTSWebService(); mxmlobj = new SBTS(); if(user!=null) { user.addSBTSWebServiceFaultEventListener(handleFaults); user.addgetSBTSMobileAuthenticationEventListener(authenticationResult); newEntry = new GetSBTSMobileAuthentication(); if(newEntry!=null) { if(mxmlobj != null) { newEntry.mobile = mxmlobj.mobileno.text ; newEntry.password=mxmlobj.password.text; } user.getSBTSMobileAuthentication(newEntry); } } } public function handleFaults(event:FaultEvent):void { Alert.show("A fault occured contacting the server. Fault message is: " + event.fault.faultString); } public function authenticationResult(event:GetSBTSMobileAuthenticationResultEvent):void { if(event.result != null && event.result._return>0) { if(event.result._return > 0) { var UserId:int = event.result._return; if(mxmlobj != null) { mxmlobj.loginform.enabled = false; mxmlobj.viewstack2.selectedIndex=1; } } else { Alert.show("Authentication fail"); } } } } }

    Read the article

  • CSS overflow character not pushing down <div>

    - by Uncle Toby
    I have a <div> called bigbox which contain a <div>called wrapper . The wrapper contain 2 <div> called textbox and checkbox. If the characters inside textbox overflow , it doesn't push the other wrapper below . How can I make the below wrapper go down ? here is the jsfiddle : http://jsfiddle.net/WA63P/ <html> <head> <title>Page</title> <script type="text/javascript" src="jquery-1.9.1.min.js"></script> <style type="text/css"> .bigbox { background-color: #F5E49C; color: #000; padding: 0 5px; width:280px; height:500px; position: absolute; text-align: center;content: "";display: block;clear: both; } .box { background-color: #272822; color: #9C5A3C; height:100px; width:260px; margin-bottom: 10px; position: relative; top:10px; } .textbox { background-color: #FFFFFF; color: #272822; height:100px; width:160px;float:left;text-align: left } .checkbox { background-color: #FFFFFF; height:50px; width:50px; float:right; d } </style> <div class="bigbox"> <div class="box"> <div class="textbox">background background background background background background background background background background background background background background background background background background background background background background </div> <div class="checkbox"> </div> </div> <div class="box"> <div class="textbox"> </div> <div class="checkbox"> </div> </div> </body> </html>

    Read the article

  • addchild not displaying content

    - by Rajeev
    In the following code i dont have any error but why is that the addchild(video); i.e, the the video captured by webcam is not displayed <?xml version="1.0" encoding="utf-8"?> <mx:Application xmlns:mx="http://www.adobe.com/2006/mxml" layout="absolute"> <mx:Script> <![CDATA[ import org.com.figurew; import mx.controls.Button; import mx.controls.Alert; import flash.display.InteractiveObject; import flash.display.Sprite; import flash.media.*; import flash.net.*; public function addBody():void { var ret:Number = figurew.getInstance().getparam(); if( ret == 1) { Alert.show("Camera detected"); } if(ret == 0) { Alert.show("No camera detected"); } var cam:Camera = Camera.getCamera(); if(cam != null) { cam.setMode(640, 480, 30); var video:Video = new Video(30, 40); video.attachCamera(cam); addChild(video); } else { trace("No Camera Detected"); } } ]]> </mx:Script> <mx:Button label="Test camera" click="addBody();" x="99" y="116"/> </mx:Application > figurew.as package org.com { import flash.display.InteractiveObject; import flash.display.Sprite; import flash.media.*; import flash.net.*; public class figurew extends Sprite { public function figurew() { //getparam(); var cam:Camera = Camera.getCamera(); if(cam != null) { cam.setMode(640, 480, 30); var video:Video = new Video(300, 450); video.attachCamera(cam); addChild(video); } else { trace("No Camera Detected"); } } public function getparam():Number { var cam:Camera = Camera.getCamera(); if(cam != null) { cam.setMode(640, 480, 30); var video:Video = new Video(300, 450); video.attachCamera(cam); addChild(video); return 1; } else { return 0; trace("No Camera Detected"); } } private static var _instance:figurew = null; public static function getInstance():cldAS { if(_instance == null) { trace("No instance found"); _instance = new cldAS(); } return _instance; } } }

    Read the article

  • Hierarchy inheritance

    - by reito
    I had faced the problem. In my C++ hierarchy tree I have two branches for entities of difference nature, but same behavior - same interface. I created such hierarchy trees (first in image below). And now I want to work with Item or Base classes independetly of their nature (first or second). Then I create one abstract branch for this use. My mind build (second in image below). But it not working. Working scheme seems (third in image below). It's bad logic, I think... Do anybody have some ideas about such hierarchy inheritance? How make it more logical? More simple for understanding? Image Sorry for my english - russian internet didn't help:) Update: You ask me to be more explicit, and I will be. In my project (plugins for Adobe Framemaker) I need to work with dialogs and GUI controls. In some places I working with WinAPI controls, and some other places with FDK (internal Framemaker) controls, but I want to work throw same interface. I can't use one base class and inherite others from it, because all needed controls - is a hierarchy tree (not one class). So I have one hierarchy tree for WinAPI controls, one for FDK and one abstract tree to use anyone control. For example, there is an Edit control (WinEdit and FdkEdit realization), a Button control (WinButton and FdkButton realization) and base entity - Control (WinControl and FdkControl realization). For now I can link my classes in realization trees (Win and Fdk) with inheritence between each of them (WinControl is base class for WinButton and WinEdit; FdkControl is base class for FdkButton and FdkEdit). And I can link to abstract classes (Control is base class for WinControl and FdkControl; Edit is base class for WinEdit and FdkEdit; Button is base class for WinButton and FdkButton). But I can't link my abstract tree - compiler swears. In fact I have two hierarchy trees, that I want to inherite from another one. Update: I have done this quest! :) I used the virtual inheritence and get such scheme (http://img12.imageshack.us/img12/7782/99614779.png). Abstract tree has only absolute abstract methods. All inheritence in abstract tree are virtual. Link from realization tree to abstract are virtual. On image shown only one realization tree for simplicity. Thanks for help!

    Read the article

  • How to replicate this button in CSS

    - by jasondavis
    I am trying to create a CSS theme switcher button like below. The top image shows what I have so far and the bottom image shows what I am trying to create. I am not the best at this stuff I am more of a back-end coder. I could really use some help. I have a live demo of the code here http://dabblet.com/gist/2230656 Just looking at what I have and the goal image, some differences. I need to add a gradient The border is not right on mine Radius is a little off Possibly some other stuff? Also here is the code...it can be changed anyway to improve this, the naming and stuff could be improved I am sure but I can use any help I can get. HTML <div class="switch-wrapper"> <div class="switcher left selected"> <span id="left">....</span> </div> <div class="switcher right"> <span id="right">....</span> </div> </div> CSS /* begin button styles */ .switch-wrapper{ width:400px; margin:220px; } .switcher { background:#507190; display: inline-block; max-width: 100%; box-shadow: 1px 1px 1px rgba(0,0,0,.3); position:relative; } #left, #right{ width:17px; height:11px; overflow:hidden; position:absolute; top:50%; left:50%; margin-top:-5px; margin-left:-8px; font: 0/0 a; } #left{ background-image: url(http://www.codedevelopr.com/assets/images/switcher.png); background-position: 0px px; } #right{ background-image: url(http://www.codedevelopr.com/assets/images/switcher.png); background-position: -0px -19px; } .left, .right{ width: 30px; height: 25px; border: 1px solid #3C5D7E; } .left{ border-radius: 6px 0px 0px 6px; } .right{ border-radius: 0 6px 6px 0; margin: 0 0 0 -6px } .switcher:hover, .selected { background: #27394b; box-shadow: -1px 1px 0px rgba(255,255,255,.4), inset 0 4px 5px rgba(0,0,0,.6), inset 0 1px 2px rgba(0,0,0,.6); }

    Read the article

  • Ie7 float problems and hiperlinks not clickable

    - by Uffo
    Markup <ul class="navigation clearfix"> <li class="navigation-top"></li> <div class="first-holder" style="height:153px;"> <dl class="hold-items clearfix"> <dd class="clearfix with"><a href="http://site.com" title="Protokoll">Protokoll</a></dd> <dd class="with-hover"><a href="http://site.com" title="Mein/e Unternehmen">Mein/e Unternehmen</a></dd> <dd class="with"><a class="face-me" href="http://site.com" title="Erweiterte Suche">Erweiterte Suche</a></dd> <dd class="with"><a href="http://site.com" title="Abmelden">Abmelden</a></dd> </dl> </div><!--[end] /.first-holder--> <li class="navigation-bottom"></li> </ul><!--[end] /.navigation--> Css: .first-holder{height:304px;position:relative;width:178px;overflow:hidden;margin-bottom:0px;padding-bottom: 0px;} .hold-items{top:0px;position:absolute;} .navigation dd.with{line-height:38px;background:url('/images/sprite.png') no-repeat -334px -46px;width:162px;height:38px;padding-bottom:0px;overflow: hidden;} .navigation dd.with a{position:relative;outline:0;display:block;font-weight:bold;color:#3f78c0;padding-left:10px;line-height:38px;} .with-hover{background:url('/images/sprite.png') no-repeat -505px -47px;width:178px;height:38px;line-height:38px;overflow:none;} .with-hover a{position:relative;display:block;font-weight:bold;color:#fff;padding-left:10px} .navigation-top{background:url('/images/sprite.png') no-repeat -694px -46px;width:160px;height:36px;} .navigation-top a{display:block;outline:0;height:20px;padding-top:18px;padding-left:138px;} .navigation-top a span{display:block;background:url('/images/sprite.png') no-repeat -212px -65px;width:8px;height:6px;} .navigation-bottom{background:url('/images/sprite.png') no-repeat -784px -402px;width:160px;height:37px;} .navigation-bottom a{display:block;outline:0;height:20px;padding-top:18px;padding-left:138px;} .navigation-bottom a span{display:block;background:url('/images/sprite.png') no-repeat -212px -74px;width:8px;height:6px;} Also the links, are not clickable, if I click on a link in IE7 it doesn't do the action..it doesn't redirect me to the location. This is how it looks in IE7: http://screencast.com/t/MGY4NjljZjc This is how it look in IE8,Firefox,Chrome and so on http://screencast.com/t/MzhhMDQ1M What I'm doing wrong PS: .navigation-top a span and .navigation-bottom a span I'm using some where else, but that it's ok it works fine.

    Read the article

  • Keep div:hover open when changing nested select box

    - by JMC Creative
    This is an IE-only problem. .toolTip becomes visible when it's parent element is :hovered over. Inside of .toolTip is a select box. When the user opens the select box to make a selection, the parent element is being "un-hovered", if you will. To put it another way, when I try to select something from the dropdown, the whole thing hides itself again. I'm sure it has something to do with the way IE interprets the stylesheet, but I don't know what or where. Here is some relevant code (edited for clarity): #toolBar .toolTip { position: absolute; display:none; background: #fff; line-height: 1em; font-size: .8em; min-width: 300px; bottom: 47px; left: -5px; padding: 0 ; } #toolBar div:hover .toolTip { display:block; } and <div id="toolBar"> <div class="socialIcon"> <a href=""><img src="/im/social/nytimes.png" alt="NY Times Bestsellers" /></a> <span class="toolTip"> <h1>NY Times Bestsellers Lists</h1> <div id="nyTimesBestsellers"> <?php include('/ny-times-bestseller-feed.php') ?> </div> <p><img src="/im/social/nytimes.png" alt="NY Times Bestseller Lists" /> Change List <select id="nyTimesChangeCurrentList" name="nyTimesChangeCurrentList"> <option value="hardcover-fiction">Hardcover Fiction</option> <option value="hardcover-nonfiction">Hardcover Nonfiction</option> <option value="hardcover-advice">Hardcover Advice</option> </select> </p> </span> </div> </div>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 66 67 68 69 70 71 72 73 74 75 76 77  | Next Page >