Search Results

Search found 4984 results on 200 pages for 'robots txt'.

Page 70/200 | < Previous Page | 66 67 68 69 70 71 72 73 74 75 76 77  | Next Page >

  • ExtJS: Login with 'Remember me' functionality

    - by Chau
    I'm trying to create a simple login window with the very common 'Remember me' functionality. The login validation is done AJAX style, thus the browser won't remember my input. My approach is to use the built-in state functionality, but how to use it confuses me. Ext.state.Manager.setProvider(new Ext.state.CookieProvider({ expires: new Date(new Date().getTime()+(1000*60*60*24*7)), //7 days from now })); ... { xtype: 'textfield', fieldLabel: 'User name', id: 'txt-username', stateful: true, stateId: 'username' }, { xtype: 'textfield', fieldLabel: 'Password', id: 'txt-password', inputType: 'password', stateful: true, stateId: 'password' }, { xtype: 'button', text: 'Validate', stateEvents: 'click' } I know I have to implement the getState method, but on what component (my guess is on the two textfields)? Another thing I fail to realize is, how is my click event on the button connected to the state properties of my textfields?

    Read the article

  • XSPF Web Music Player and restarting music in surfing

    - by Felicita
    I asked a question in this link; Streaming music background function music(){ $txt = '<object type="application/x-shockwave-flash" data="http://***.com/slim.swf?&autoplay=true&repeat=true&shuffle=true&song_url=http: //***.com/music.mp3&" width="200" height="20"> <param name="movie" value="http://***.com/slim.swf?&autoplay=true&repeat=true&shuffle=true& song_url=http://***.com/music.mp3&" /> <img src="noflash.gif" width="0" height="0" alt="" /> </object>'; echo $txt; } I have added this player with a simple php fonction. Palyer working perfect but when page changes, the music restarts. I want that I will be continued. What is wrong in code?

    Read the article

  • Help converting java program to MapReduce job

    - by BigJoe714
    Hello, I would like to convert the following Java program to a MapReduce job. I have read about MapReduce and feel like this would be a good problem to solve using it, but I cannot figure out what to do. This basically loops through a directory of html files and parses them into a CSV file. http://www.joeharrison.com/bucket/2010/3/Main.java.txt http://www.joeharrison.com/bucket/2010/3/StringParser.java.txt Note: I am not trying to get someone else to do my work for me. I am using this as a learning experience. This will not be used for $$$profit$$$. If I have something that I created converted to a MapReduce job I feel it will provide a much easier way to learn then trying to follow an arbitrary tutorial. I posted this on Rentacoder several days ago, because I wanted to pay someone to convert it for me. But no one on rentacoder seems to know mapreudce!

    Read the article

  • Save gcc compile status to a text file for Java

    - by JohnBore
    I'm making a C Assessment Program through Java, which has a bunch of programming questions for C, and it lets the user input an answer in the form of C code, and then press a "Compile" button, which is linked to a bat file that runs the user input code through gcc. I've got the input and compiling working, but I need to get the output from the compiler and get that to print textarea within the program. I can get a simple "Hello, world" compiling, but I'm having trouble getting programs that require a user input with scanf, for example, to be printed. else if(e.getSource().equals(compile)){ if(questionNumber<1){ JOptionPane.showMessageDialog(programFrame, "Please start the assessment", "Compile Error", JOptionPane.ERROR_MESSAGE); } else{ FileOutputStream fileWrite; try { fileWrite = new FileOutputStream("demo/demo.c"); new PrintStream(fileWrite).println(input.getText());//saves what the user has entered in to a C source file fileWrite.close(); @SuppressWarnings("unused") Process process = Runtime.getRuntime().exec("cmd /c compile.bat");//runs the batch file to compile the source file compileCode(); try{ fileStream = new FileInputStream("demo/output.txt"); inputStream = new DataInputStream(fileStream); bufferRead = new BufferedReader(new InputStreamReader(inputStream)); while((stringLine = bufferRead.readLine())!=null){ compiled.append(stringLine); compiled.append("\n"); } inputStream.close(); } catch(IOException exc){ System.err.println("Unable to read file"); System.exit(-1); } } catch (IOException exc) { JOptionPane.showMessageDialog(programFrame, "Demo file not found", "File Error", JOptionPane.ERROR_MESSAGE); } } This is the actionPerformed method for the "Compile" button, the compileCode() is the JFrame that displays the output and "compiled" is the textArea for the output. My batch file is: C: cd dev-cpp\bin gcc.exe H:\workspace\QuestionProgram\demo\demo.c -o demo > H:\workspace\QuestionProgram\demo\compilestatus.txt demo > H:\workspace\QuestionProgram\demo\output.txt I'm not sure how I can do it, so the frame is created for the output of the code if the code requires a user input as the command prompt doesn't open without adding "START" to .exec(), but then the frame appears before the program has finished running. Also, how would I get the output of the compiler if the compile fails because of an error? The way I've got it in my batch file at the moment doesn't put anything in a text file if it fails.

    Read the article

  • Cannot call SAPI from dll

    - by Quandary
    Question: The below code works fine as long as it is in an executable. It uses the msft (text-to-)speech API (SAPI). But as soon as I put it in a dll and load it with loadlibrary from an executable, it doesn't work. I've also tried to change CoInitialize(NULL); to CoInitializeEx(NULL,COINIT_MULTITHREADED); and I tried with all possible flags ( COINIT_APARTMENTTHREADED, COINIT_MULTITHREADED, COINIT_DISABLE_OLE1DDE, COINIT_SPEED_OVER_MEMORY) But it's always stuck at hr = CoCreateInstance(__uuidof(SpVoice), NULL, CLSCTX_INPROC_SERVER, IID_ISpVoice, (void **) &pVoice); I also tried those flags here: CLSCTX_INPROC_SERVER,CLSCTX_SERVER, CLSCTX_ALL, but nothing seems to help... There are no errors, it doesn't crash, it just sleeps forever at CoCreateInstance... This is the code as single exe (working) #include <windows.h> #include <sapi.h> #include <iostream> #include <cstdlib> int main(int argc, char* argv[]) { ISpVoice * pVoice = NULL; //CoInitializeEx(NULL,COINIT_MULTITHREADED); HRESULT hr = CoInitialize(NULL); if( FAILED(hr) ) { MessageBox(NULL, TEXT("Failed To Initialize"), TEXT("Error"),0); printf("Failed!\n"); char buffer[2000] ; sprintf(buffer, "An error occured: 0x%08X.\n", hr); FILE * pFile = fopen ( "c:\\temp\\CoInitialize_exe.txt" , "w" ); fwrite (buffer , 1 , sizeof(buffer) , pFile ); fclose (pFile); } else { //CoGetClassObject(CLSID_SpVoice, CLSCTX_INPROC_SERVER, NULL, IID_IClassFactory, (void**) &pClsF); //hr = CoGetClassObject(CLSID_SpVoice, CLSCTX_INPROC_SERVER, NULL, IID_IClassFactory, (void**) &pClsF); hr = CoCreateInstance(__uuidof(SpVoice), NULL, CLSCTX_INPROC_SERVER, IID_ISpVoice, (void **) &pVoice); //HRESULT hr = CoCreateInstance(CLSID_SpVoice, NULL, CLSCTX_ALL, IID_ISpVoice, (void **) &pVoice); if( SUCCEEDED( hr ) ) { hr = pVoice->Speak(L"Test Test", 0, NULL); hr = pVoice->Speak(L"This sounds normal <pitch middle = '-10'/> but the pitch drops half way through", SPF_IS_XML, NULL ); pVoice->Release(); pVoice = NULL; } else { MessageBox(NULL, TEXT("Failed To Create a COM instance..."), TEXT("Error"),0); char buffer[2000] ; sprintf(buffer, "An error occured: 0x%08X.\n", hr); FILE * pFile = fopen ( "c:\\temp\\CoCreateInstance_exe.txt" , "w" ); fwrite (buffer , 1 , sizeof(buffer) , pFile ); fclose (pFile); } } CoUninitialize(); return EXIT_SUCCESS; } This is the exe loading the dll (stays forever at printf("trying to create instance.\n"); ) #include <windows.h> #include <sapi.h> #include <iostream> #include <cstdlib> int main(int argc, char* argv[]) { // C:\Windows\System32\Speech\Common\sapi.dll //LoadLibraryA("sapi.dll"); LoadLibraryA("Sapidll2.dll"); return EXIT_SUCCESS; // Frankly, that would be nice... } And this is Sapidll2.dll // dllmain.cpp : Defines the entry point for the DLL application. #include "stdafx.h" #include <iostream> #include <cstdlib> #include <string> #include <windows.h> #include <sapi.h> int init_engine() { ISpVoice * pVoice = NULL; //HRESULT hr = CoInitializeEx(NULL, COINIT_MULTITHREADED); HRESULT hr = CoInitialize(NULL); if(FAILED(hr) ) { MessageBox(NULL, TEXT("Failed To Initialize"), TEXT("Error"), 0); char buffer[2000] ; sprintf(buffer, "An error occured: 0x%08X.\n", hr); FILE * pFile = fopen ( "c:\\temp\\CoInitialize_dll.txt" , "w" ); fwrite (buffer , 1 , strlen(buffer) , pFile ); fclose (pFile); } else { printf("trying to create instance.\n"); //HRESULT hr = CoCreateInstance(CLSID_SpVoice, NULL, CLSCTX_ALL, IID_ISpVoice, (void **) &pVoice); //hr = CoCreateInstance(CLSID_SpVoice, NULL, CLSCTX_ALL, IID_ISpVoice, (void **) &pVoice); //HRESULT hr = CoCreateInstance(__uuidof(ISpVoice), NULL, CLSCTX_INPROC_SERVER, IID_ISpVoice, (void **) &pVoice); HRESULT hr = CoCreateInstance(__uuidof(SpVoice), NULL, CLSCTX_ALL, IID_ISpVoice, (void **) &pVoice); if( SUCCEEDED( hr ) ) { printf("Succeeded\n"); //hr = pVoice->Speak(L"The text to speech engine has been successfully initialized.", 0, NULL); } else { printf("failed\n"); MessageBox(NULL, TEXT("Failed To Create COM instance"), TEXT("Error"), 0); char buffer[2000] ; sprintf(buffer, "An error occured: 0x%08X.\n", hr); FILE * pFile = fopen ( "c:\\temp\\CoCreateInstance_dll.txt" , "w" ); fwrite (buffer , 1 , strlen(buffer) , pFile ); fclose (pFile); } } if(pVoice != NULL) { pVoice->Release(); pVoice = NULL; } CoUninitialize(); return true ; } BOOL APIENTRY DllMain( HMODULE hModule, DWORD ul_reason_for_call, LPVOID lpReserved) { switch (ul_reason_for_call) { case DLL_PROCESS_ATTACH: init_engine(); break; case DLL_THREAD_ATTACH: case DLL_THREAD_DETACH: case DLL_PROCESS_DETACH: break; } return TRUE; }

    Read the article

  • SOM Algorithm Matlab HELP

    - by Tim
    I'm trying to pass a txt file to som_read_data from a GUI......i created a function that takes a txt file from the GUI and then passes it to som_read_data..but i'm getting some errors...here are a list of some of the errors.....any one with ideas? ??? Error using ==> ftell Invalid file identifier. Use fopen to generate a valid file identifier. Error in ==> som_read_data at 169 fpos1 = ftell(fid); c1 = 0; % read first non-comment line Error in ==> prog_som at 3 sD = som_read_data(m);

    Read the article

  • perl one liner alternative to this bash "chain"?

    - by Michael Mao
    Hello everyone: I am trying to comprehend Perl following the way describe in the book "Minimal Perl". I've uploaded all source txt files onto my own server : results folder I got the output from using several bash commands in a "chain" like this: cat run*.txt | grep '^Bank[[:space:]]Balance'| cut -d ':' -f2 | grep -E '\$[0-9]+' I know this is far from the most concise and efficient, but at least it works... As our uni subject now moves onto the Perl part, I'd like to know if there is a way to get the same results in one line? I am trying something like the following code but stuck in the middle: Chenxi Mao@chenxi-a6b123bb /cygdrive/c/eMarket/output $ perl -wlne 'print; if $n=~/^Bank Balance/' syntax error at -e line 1, near "if $n" Execution of -e aborted due to compilation errors.

    Read the article

  • Disposables, Using & Try/Catch Blocks

    - by Aren B
    Having a mental block today, need a hand verifying my logic isn't fubar'ed. Traditionally I would do file i/o similar to this: FileStream fs = null; // So it's visible in the finally block try { fs = File.Open("Foo.txt", FileMode.Open); /// Do Stuff } catch(IOException) { /// Handle Stuff } finally { if (fs != null) fs.Close(); } However, this isn't very elegant. Ideally I'd like to use the using block to dispose of the filestream when I'm done, however I am unsure about the synergy between using and try/catch. This is how i'd like to implement the above: try { using(FileStream fs = File.Open("Foo.txt", FileMode.Open)) { /// Do Stuff } } catch(Exception) { /// Handle Stuff } However, I'm worried that a premature exit (via thrown exception) from within the using block may not allow the using block to complete execution and clean up it's object. Am I just paranoid, or will this actually work the way I intend it to?

    Read the article

  • Team Build MSBuild Task Does Not Update Main Build Log File

    - by NotMyself
    I have an after build event in my main TFSBuild.proj file that uses the MSBuild task to call a deployment task after a successful build. It looks like this: <ItemGroup> <DeploymentTargets Include="..\Sources\Build\SkunkWorks.Build.Deployment.targets"> <Properties></Properties> </DeploymentTargets> </ItemGroup> <Target Name="AfterBuild"> <Message Text="Executing Deployment"/> <MSBuild Projects="@(DeploymentTargets)" Properties="PickUpLocation='@(DropLocation)'" ContinueOnError="false"/> </Target> This works fine and the deployment script is called as you would expect. The problem is that any errors or messages produced by executing the MSBuild are not written to the BuildLog.txt or ErrorsAndWarnings.txt files that are placed in the drop location after a successful build. Is there an easy way to capture this information?

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Html index page and files in that directory

    - by Frank
    On my web site, there is an index page, but if I take out that index page, users will see the files in that directory, for instance my site is : XYZ.com and I have a directory called "My_Dir", so when a user typed in "XYZ.com/My_Dir" he will see the index.html if there is one, but if it's not there, he will see a list of all my files inside "My_Dir", so is it safe to assume that with an index page in any of my sub directories, I can hide all the files in those directories from users, in other words if I have "123.txt, abc.html and index.html" in "My_Dir", users won't be able to see "123.txt, abc.html" because of the existence of "index.html" [ unless of course I mention those two files inside index.html ] ? Frank

    Read the article

  • Sparse checkout in Git 1.7.0?

    - by davr
    With the new sparse checkout feature in Git 1.7.0, is it possible to just get the contents of a subdirectory like how you can in SVN? I found this example, but it preserves the full directory structure. Imagine that I just wanted the contents of the 'perl' directory, without an actual directory named 'perl'. -- EDIT -- Example: My git repository contains the following paths repo/.git/ repo/perl/ repo/perl/script1.pl repo/perl/script2.pl repo/images/ repo/images/image1.jpg repo/images/image2.jpg repo/doc/ repo/doc/readme.txt repo/doc/help.txt What I want is to be able to produce from the above repository this layout: repo/.git/ repo/script1.pl repo/script2.pl However with the current sparse checkout feature, it seems like it is only possible to get repo/.git/ repo/perl/script1.pl repo/perl/script2.pl which is NOT what I want. Thanks.

    Read the article

  • What is purpuse of T4 Generator in T4toolbox

    - by Fred Yang
    I am using T4toolbox, I am confused what the generator is for. I can run the following public class Generator1 : Generator { protected override void RunCore() { Template1 t = new Template1(); t.Output.File = "t3.txt"; t.Render(); } } or I can run t4 script directly like the following. Template1 t = new Template1(); t.Output.File = "t3.txt"; t.Render(); But I can do the same using t4 script without generator as well. So I mean can do the same thing with two approach "script -- generator -- template" and "script -- template", am I missing something? Thanks

    Read the article

  • FileSystemWatcher Changed event is raised twice

    - by user214707
    I have an application where I am looking for a text file and if there are any changes made to the file I am using the OnChanged eventhandler to handle the event. I am using the NotifyFilters.LastWriteTime but still the event is getting fired twice. Here is the code. public void Initialize() { FileSystemWatcher _fileWatcher = new FileSystemWatcher(); _fileWatcher.Path = "C:\\Folder"; _fileWatcher.NotifyFilter = NotifyFilters.LastWrite; _fileWatcher.Filter = "Version.txt"; _fileWatcher.Changed += new FileSystemEventHandler(OnChanged); _fileWatcher.EnableRaisingEvents = true; } private void OnChanged(object source, FileSystemEventArgs e) { ....... } In my case the OnChanged is called twice, when I change the text file version.txt and save it.

    Read the article

  • C# bluetooth file send.

    - by cheesebunz
    i'm new to bluetooth development and i found the 32netfeet . Right now i'm able to search for bluetooth devices nearby and connect to them but how do i send a file e.g SendTest.txt? I tried buttonclick event using the OBEX but i don't understand this is my example code: using InTheHand.Net; using InTheHand.Net.Sockets; using InTheHand.Net.Bluetooth; namespace BluetoothIntheHand { public partial class Form2 : Form { private Guid service = BluetoothService.DialupNetworking; private BluetoothClient bluetoothClient; public Form2() { InitializeComponent(); } private void btnSearch_Click(object sender, EventArgs e) { BluetoothRadio.PrimaryRadio.Mode = RadioMode.Discoverable; BluetoothRadio myRadio = BluetoothRadio.PrimaryRadio; lblSearch.Text = "" + myRadio.LocalAddress.ToString(); bluetoothClient = new BluetoothClient(); Cursor.Current = Cursors.WaitCursor; BluetoothDeviceInfo[] bluetoothDeviceInfo = { }; bluetoothDeviceInfo = bluetoothClient.DiscoverDevices(10); comboBox1.DataSource = bluetoothDeviceInfo; comboBox1.DisplayMember = "DeviceName"; comboBox1.ValueMember = "DeviceAddress"; comboBox1.Focus(); Cursor.Current = Cursors.Default; } private void btnConnect_Click(object sender, EventArgs e) { if (comboBox1.SelectedValue != null) { try { bluetoothClient.Connect(new BluetoothEndPoint((BluetoothAddress)comboBox1.SelectedValue, service)); MessageBox.Show("Connected"); } catch (Exception ex) { MessageBox.Show(ex.Message); } } } private void btnSend_Click(object sender, EventArgs e) { bluetoothClient.Connect(new BluetoothEndPoint((BluetoothAddress)comboBox1.SelectedValue, service)); String addr = "112233445566"; Uri uri = new Uri("obex://"+@"SendTest.txt"); ObexWebRequest req= new ObexWebRequest(uri); ObexWebResponse rsp; } I found the guide but don't really knw hw to convert to C# ' The host part of the URI is the device address, e.g. IrDAAddress.ToString(), ' and the file part is the OBEX object name. Dim addr As String = "112233445566" Dim uri As New Uri("obex://" & addr & "/HelloWorld2.txt") Dim req As New ObexWebRequest(uri) Using content As Stream = req.GetRequestStream() ' Using a StreamWriter to write text to the stream... Using wtr As New StreamWriter(content) wtr.WriteLine("Hello World GetRequestStream") wtr.WriteLine("Hello World GetRequestStream 2") wtr.Flush() ' Set the Length header value req.ContentLength = content.Length End Using ' In this case closing the StreamWriter also closed the Stream, but ... End Using Dim rsp As ObexWebResponse = CType(req.GetResponse(),ObexWebResponse) Console.WriteLine("Response Code: {0} (0x{0:X})", rsp.StatusCode)

    Read the article

  • How to create a folder for each item in a directory?

    - by Adrian Andronic
    I'm having trouble making folders that I create go where I want them to go. For each file in a given folder, I want to create a new folder, then put that file in the new folder. My problem is that the new folders I create are being put in the parent directory, not the one I want. My example: def createFolder(): dir_name = 'C:\\Users\\Adrian\\Entertainment\\Coding\\Test Folder' files = os.listdir(dir_name) for i in files: os.mkdir(i) Let's say that my files in that directory are Hello.txt and Goodbye.txt. When I run the script, it makes new folders for these files, but puts them one level above, in 'C:\Users\Adrian\Entertainment\Coding. How do I make it so they are created in the same place as the files, AKA 'C:\Users\Adrian\Entertainment\Coding\Test Folder'?

    Read the article

  • strange problem when placing UILabels on UITableView and calling reloadData

    - by user262325
    Hello everyone I hope to list all files in a directory to an UITableView atableview There are files in Document directory a.txt b.txt F (folder) c.txt in folder F, there are 2 files M.exe N.exe When I change to folder F, it should display on atableview M.exe N.exe but Result is in F, it displayed b.txt F the codes are shown as below -(void) removeACell:(NSInteger)row; { NSUInteger _lastSection = 0;//[self numberOfSectionsInTableView:atableview]; NSUInteger _lastRow =row;// [atableview numberOfRowsInSection:_lastSection] - 1; NSUInteger _path[2] = {_lastSection, _lastRow}; NSIndexPath *_indexPath = [[NSIndexPath alloc] initWithIndexes:_path length:2]; NSArray *_indexPaths = [[NSArray alloc] initWithObjects:_indexPath, nil]; [_indexPath release]; [atableview deleteRowsAtIndexPaths:_indexPaths withRowAnimation:UITableViewRowAnimationBottom]; [_indexPaths release]; } -(void) reloadDirectory { if([fileArray count]>0) { NSInteger n=fileArray.count; for(int i=n-1;i>=0;i--) { [fileArray removeObjectAtIndex: i]; [self removeACell:i]; } } NSFileManager *manager = [NSFileManager defaultManager]; NSLog(@"*******************" ); NSLog(@"ffff%@",[self appDelegate].gCurrentPath_AppDelegate); for(NSString *path in [manager contentsOfDirectoryAtPath:[self appDelegate].gCurrentPath_AppDelegate error:nil]) { NSDictionary *modData= [manager attributesOfItemAtPath: [appDelegate.gCurrentPath_AppDelegate //directory of files stringByAppendingPathComponent:path ] error:nil ]; NSDate * dateModified=(NSDate *) [modData objectForKey:NSFileModificationDate]; NSNumber *fileSize=[modData objectForKey:NSFileSize] ; if(dateModified) { FileObj *newobj=[[FileObj alloc] init ]; [ newobj seta:1]; NSString *ss=[[NSString alloc] initWithFormat:@"%@",path] ; [newobj setfileName:ss]; NSLog(@"---------------%@",ss); BOOL isDir; [manager fileExistsAtPath:[appDelegate.gCurrentPath_AppDelegate stringByAppendingPathComponent:path ] isDirectory:&isDir]; [newobj setisDirectory: isDir ]; [newobj setfilePath:@"1"]; NSDateFormatter *formatter = [[NSDateFormatter alloc] init]; [formatter setDateFormat:@"EEE MMM dd HH:mm:ss zzz yyyy"]; NSString *stringFromDate =[[NSString alloc] initWithString: [formatter stringFromDate:dateModified]]; [newobj setfileDate:stringFromDate]; [formatter release]; NSString * fileSize1= [[NSString alloc] initWithFormat:@"%d",[fileSize integerValue] ]; [newobj setfileSize: fileSize1]; [ fileArray addObject:newobj]; [newobj release]; }; [atableview reloadData]; } - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { NSInteger row=[indexPath row]; NSInteger section=[indexPath section]; static NSString *SimpleTableIdentifier1 = @"CellTableIdentifier"; UITableViewCell *cell=[tableView dequeueReusableCellWithIdentifier: SimpleTableIdentifier1 ]; int newRow = [indexPath row]; selectIndex=newRow; if(cell==nil) { //**breakpoint AAA here** CGRect cellframe=CGRectMake(0, 0, 300, 60); cell=[[[UITableViewCell alloc] initWithFrame:cellframe reuseIdentifier:SimpleTableIdentifier1] autorelease]; if ([[fileArray objectAtIndex:row] getisDirectory]) { UIImage *image = [UIImage imageNamed:@"folder.png"]; cell.imageView.image = image; } else { UIImage *image = [UIImage imageNamed:@"files.png"]; cell.imageView.image = image; } cell.accessoryType=UITableViewCellAccessoryDetailDisclosureButton; ///-------------------------------------------------------- UILabel *b1 =[ [UILabel alloc]init]; b1.frame = CGRectMake(40.9f,8.0f,250.0f,20.0f) ; [b1 setBackgroundColor:[UIColor clearColor]]; [b1 setTag:(row+15000)]; //------------------------------------------------------- UILabel *b2 =[ [UILabel alloc]init]; b2.frame = CGRectMake(40.9f,30.0f,250.0f,13.0f) ; [b2 setBackgroundColor:[UIColor clearColor]]; [b2 setTag:row+16000]; [b2 setFont:[UIFont systemFontOfSize:10.0]]; //------------------------------------------------ UILabel *b3 =[ [UILabel alloc]init]; b3.frame = CGRectMake(40.9f,45.0f,250.0f,13.0f) ; [b3 setBackgroundColor:[UIColor clearColor]]; [b3 setFont:[UIFont systemFontOfSize:10.0]]; [b3 setTag:row+17000]; [cell.contentView addSubview:b1]; [cell.contentView addSubview:b2]; [cell.contentView addSubview:b3]; [b1 release]; [b2 release]; [b3 release]; }; if([fileArray count]>0) //check if fileArray is correct { NSLog(@"___________________" ); for (int i=0;i<[fileArray count];i++) { NSLog(@"->%@",[[fileArray objectAtIndex:i] getfileName] ); } } UILabel *tem1UILabel=(UILabel*)[cell.contentView viewWithTag:row+15000]; NSString *s1=[[NSString alloc] initWithFormat: [[fileArray objectAtIndex:row] getfileName] ]; NSLog(@"--->%@",s1 ); tem1UILabel.text=s1; [s1 release]; UILabel *tem2UILabel=(UILabel*)[cell.contentView viewWithTag:row+16000]; NSString *s2=[[NSString alloc] initWithFormat: [[fileArray objectAtIndex:row] getfileDate] ]; tem2UILabel.text=s2; [s2 release]; UILabel *tem3UILabel=(UILabel*)[cell.contentView viewWithTag:row+17000]; NSString *s3=[[NSString alloc] initWithFormat: [[fileArray objectAtIndex:row] getfileSize]]; tem3UILabel.text=s3; [s3 release]; return cell; } I set the breakpoint at AAA and found that when I loaded folder F, my application did stop at the breakpoint. But I have removed all cells in atableview before call 'reloadData'. I checked the content of fileArray which is the data source of atableview and found that everything is correct except the display on atableview. Welcome any comment. Thanks interdev

    Read the article

  • Sorting a file with 55K rows and varying Columns

    - by Prasad
    Hi I want to find a programmatic solution using C++. I have a 900 files each of 27MB size. (just to inform about the enormity ). Each file has 55K rows and Varying columns. But the header indicates the columns I want to sort the rows in an order w.r.t to a Column Value. I wrote the sorting algorithm for this (definitely my newbie attempts, you may say). This algorithm is working for few numbers, but fails for larger numbers. Here is the code for the same: basic functions I defined to use inside the main code: int getNumberOfColumns(const string& aline) { int ncols=0; istringstream ss(aline); string s1; while(ss>>s1) ncols++; return ncols; } vector<string> getWordsFromSentence(const string& aline) { vector<string>words; istringstream ss(aline); string tstr; while(ss>>tstr) words.push_back(tstr); return words; } bool findColumnName(vector<string> vs, const string& colName) { vector<string>::iterator it = find(vs.begin(), vs.end(), colName); if ( it != vs.end()) return true; else return false; } int getIndexForColumnName(vector<string> vs, const string& colName) { if ( !findColumnName(vs,colName) ) return -1; else { vector<string>::iterator it = find(vs.begin(), vs.end(), colName); return it - vs.begin(); } } ////////// I like the Recurssive functions - I tried to create a recursive function ///here. This worked for small values , say 20 rows. But for 55K - core dumps void sort2D(vector<string>vn, vector<string> &srt, int columnIndex) { vector<double> pVals; for ( int i = 0; i < vn.size(); i++) { vector<string>meancols = getWordsFromSentence(vn[i]); pVals.push_back(stringToDouble(meancols[columnIndex])); } srt.push_back(vn[max_element(pVals.begin(), pVals.end())-pVals.begin()]); if (vn.size() > 1 ) { vn.erase(vn.begin()+(max_element(pVals.begin(), pVals.end())-pVals.begin()) ); vector<string> vn2 = vn; //cout<<srt[srt.size() -1 ]<<endl; sort2D(vn2 , srt, columnIndex); } } Now the main code: for ( int i = 0; i < TissueNames.size() -1; i++) { for ( int j = i+1; j < TissueNames.size(); j++) { //string fname = path+"/gse7307_Female_rma"+TissueNames[i]+"_"+TissueNames[j]+".txt"; //string fname2 = sortpath2+"/gse7307_Female_rma"+TissueNames[i]+"_"+TissueNames[j]+"Sorted.txt"; string fname = path+"/gse7307_Male_rma"+TissueNames[i]+"_"+TissueNames[j]+".txt"; string fname2 = sortpath2+"/gse7307_Male_rma"+TissueNames[i]+"_"+TissueNames[j]+"4Columns.txt"; //vector<string>AllLinesInFile; BioInputStream fin(fname); string aline; getline(fin,aline); replace (aline.begin(), aline.end(), '"',' '); string headerline = aline; vector<string> header = getWordsFromSentence(aline); int pindex = getIndexForColumnName(header,"p-raw"); int xcindex = getIndexForColumnName(header,"xC"); int xeindex = getIndexForColumnName(header,"xE"); int prbindex = getIndexForColumnName(header,"X"); string newheaderline = "X\txC\txE\tp-raw"; BioOutputStream fsrt(fname2); fsrt<<newheaderline<<endl; int newpindex=3; while ( getline(fin, aline) ){ replace (aline.begin(), aline.end(), '"',' '); istringstream ss2(aline); string tstr; ss2>>tstr; tstr = ss2.str().substr(tstr.length()+1); vector<string> words = getWordsFromSentence(tstr); string values = words[prbindex]+"\t"+words[xcindex]+"\t"+words[xeindex]+"\t"+words[pindex]; AllLinesInFile.push_back(values); } vector<string>SortedLines; sort2D(AllLinesInFile, SortedLines,newpindex); for ( int si = 0; si < SortedLines.size(); si++) fsrt<<SortedLines[si]<<endl; cout<<"["<<i<<","<<j<<"] = "<<SortedLines.size()<<endl; } } can some one suggest me a better way of doing this? why it is failing for larger values. ? The primary function of interest for this query is Sort2D function. thanks for the time and patience. prasad.

    Read the article

  • File counter adds 2 instead of 1

    - by Derk
    I made a simple counter, but it increments by 2 instead of 1. $handle = fopen('progress.txt', 'r'); $pro = fgets($handle); print $pro; // incremented by 2, WTF? fclose($handle); $handle = fopen('progress.txt', 'w'); fwrite($handle, $pro); fclose($handle); Everytime I read the file it has been incremented by 2, instead of 1.

    Read the article

  • Match multiline regex in file object

    - by williamx
    How can I extract the groups from this regex from a file object (data.txt)? import numpy as np import re import os ifile = open("data.txt",'r') # Regex pattern pattern = re.compile(r""" ^Time:(\d{2}:\d{2}:\d{2}) # Time: 12:34:56 at beginning of line \r{2} # Two carriage return \D+ # 1 or more non-digits storeU=(\d+\.\d+) \s uIx=(\d+) \s storeI=(-?\d+.\d+) \s iIx=(\d+) \s avgCI=(-?\d+.\d+) """, re.VERBOSE | re.MULTILINE) time = []; for line in ifile: match = re.search(pattern, line) if match: time.append(match.group(1)) The problem in the last part of the code, is that I iterate line by line, which obviously doesn't work with multiline regex. I have tried to use pattern.finditer(ifile) like this: for match in pattern.finditer(ifile): print match ... just to see if it works, but the finditer method requires a string or buffer. I have also tried this method, but can't get it to work matches = [m.groups() for m in pattern.finditer(ifile)] Any idea?

    Read the article

  • Creating <li> with JavaScript in an XUL Application

    - by echox
    Hi! I try to create some li elements in my XUL Application. Theres only the text of the elements shown, but no list typical bullets and linebreaks. Example: text text text text text text text Heres the JS Code I use to create the list: var li = document.createElement('html:li'); var txt = document.createTextNode("only shown as simple text"); li.appendChild(txt); document.getElementById('someList').appendChild(li); HTML: <html:ul id="someList"> <html:li>this is shown in correct list style</html:li> </html:ul> I tried 'html:li' and also 'li' but nothing worked. Any suggestions?

    Read the article

  • Cant find the android keytool

    - by Tim
    Hi all I am trying to follow the Android mapping tutorial and got to this part where I had to get an API key http://code.google.com/android/add-ons/google-apis/mapkey.html#getdebugfingerprint I have found my debug.keystore but there does not appear to be a keytool application in the directory: C:\Documents and Settings\tward\.androidls adb_usb.ini avd debug.keystore repositories.cfg androidtool.cfg ddms.cfg default.keyset There is also no keytool in this directory: C:\Android\android-sdk-windows\toolsls AdbWinApi.dll apkbuilder.bat etc1tool.exe mksdcard.exe AdbWinUsbApi.dll ddms.bat fastboot.exe source.properties Jet dmtracedump.exe hierarchyviewer.bat sqlite3.exe NOTICE.txt draw9patch.bat hprof-conv.exe traceview.bat adb.exe emulator.exe layoutopt.bat zipalign.exe android.bat emulator_NOTICE.txt lib I am using eclipse as my editor and believe that I have downloaded all the latest SDK What am I doing wrong? Thanks for your time Tim

    Read the article

  • bluetooth file send.

    - by cheesebunz
    i'm new to bluetooth development and i found the 32netfeet . Right now i'm able to search for bluetooth devices nearby and connect to them but how do i send a file e.g SendTest.txt? I tried buttonclick event using the OBEX but i don't understand this is my example code: using InTheHand.Net; using InTheHand.Net.Sockets; using InTheHand.Net.Bluetooth; namespace BluetoothIntheHand { public partial class Form2 : Form { private Guid service = BluetoothService.DialupNetworking; private BluetoothClient bluetoothClient; public Form2() { InitializeComponent(); } private void btnSearch_Click(object sender, EventArgs e) { BluetoothRadio.PrimaryRadio.Mode = RadioMode.Discoverable; BluetoothRadio myRadio = BluetoothRadio.PrimaryRadio; lblSearch.Text = "" + myRadio.LocalAddress.ToString(); bluetoothClient = new BluetoothClient(); Cursor.Current = Cursors.WaitCursor; BluetoothDeviceInfo[] bluetoothDeviceInfo = { }; bluetoothDeviceInfo = bluetoothClient.DiscoverDevices(10); comboBox1.DataSource = bluetoothDeviceInfo; comboBox1.DisplayMember = "DeviceName"; comboBox1.ValueMember = "DeviceAddress"; comboBox1.Focus(); Cursor.Current = Cursors.Default; } private void btnConnect_Click(object sender, EventArgs e) { if (comboBox1.SelectedValue != null) { try { bluetoothClient.Connect(new BluetoothEndPoint((BluetoothAddress)comboBox1.SelectedValue, service)); MessageBox.Show("Connected"); } catch (Exception ex) { MessageBox.Show(ex.Message); } } } private void btnSend_Click(object sender, EventArgs e) { bluetoothClient.Connect(new BluetoothEndPoint((BluetoothAddress)comboBox1.SelectedValue, service)); String addr = "112233445566"; Uri uri = new Uri("obex://"+@"SendTest.txt"); ObexWebRequest req= new ObexWebRequest(uri); ObexWebResponse rsp; } I found the guide but don't really know how to convert to C# ' The host part of the URI is the device address, e.g. IrDAAddress.ToString(), ' and the file part is the OBEX object name. Dim addr As String = "112233445566" Dim uri As New Uri("obex://" & addr & "/HelloWorld2.txt") Dim req As New ObexWebRequest(uri) Using content As Stream = req.GetRequestStream() ' Using a StreamWriter to write text to the stream... Using wtr As New StreamWriter(content) wtr.WriteLine("Hello World GetRequestStream") wtr.WriteLine("Hello World GetRequestStream 2") wtr.Flush() ' Set the Length header value req.ContentLength = content.Length End Using ' In this case closing the StreamWriter also closed the Stream, but ... End Using Dim rsp As ObexWebResponse = CType(req.GetResponse(),ObexWebResponse) Console.WriteLine("Response Code: {0} (0x{0:X})", rsp.StatusCode)

    Read the article

< Previous Page | 66 67 68 69 70 71 72 73 74 75 76 77  | Next Page >