Search Results

Search found 19967 results on 799 pages for 'document template'.

Page 700/799 | < Previous Page | 696 697 698 699 700 701 702 703 704 705 706 707  | Next Page >

  • newbie problems with codeigniter

    - by Patrick
    hi, i'm trying to learn codeigniter (following a book) but don't understand why the web page comes out empty. my controller is class Welcome extends Controller { function Welcome() { parent::Controller(); } function index() { $data['title'] = "Welcome to Claudia's Kids"; $data['navlist'] = $this->MCats->getCategoriesNav(); $data['mainf'] = $this->MProducts->getMainFeature(); $skip = $data['mainf']['id']; $data['sidef'] = $this->MProducts->getRandomProducts(3, $skip); $data['main'] = "home"; $this->load->vars($data); $this->load->view('template'); } the view is: <--doctype declaration etc etc.. --> </head> <body> <div id="wrapper"> <div id="header"> <?php $this->load->view('header');?> </div> <div id='nav'> <?php $this->load->view('navigation');?> </div> <div id="main"> <?php $this->load->view($main);?> </div> <div id="footer"> <?php $this->load->view('footer');?> </div> </div> </body> </html> Now I know the model is passing back the right variables, but the page appears completely blank. I would expect at least to see an error, or the basic html structure, but the page is just empty. Moreover, the controller doesn't work even if I modify it as follows: function index() { echo "hello."; } What am I doing wrong? Everything was working until I made some changes to the model - but even if I delete all those new changes, the page is still blank.. i'm really confused! thanks, P.

    Read the article

  • Multiple dispatching issue

    - by user1440263
    I try to be synthetic: I'm dispatching an event from a MovieClip (customized symbol in library) this way: public function _onMouseDown(e:MouseEvent){ var obj = {targetClips:["tondo"],functionString:"testFF"}; dispatchEvent(new BridgeEvent(BridgeEvent.BRIDGE_DATA,obj)); } The BridgeEvent class is the following: package events { import flash.events.EventDispatcher; import flash.events.Event; public class BridgeEvent extends Event { public static const BRIDGE_DATA:String = "BridgeData"; public var data:*; public function BridgeEvent(type:String, data:*) { this.data = data; super(type, true); } } } The document class listens to the event this way: addEventListener(BridgeEvent.BRIDGE_DATA,eventSwitcher); In eventSwitcher method I have a simple trace("received"). What happens: when I click the MovieClip the trace action gets duplicated and the output window writes many "received" (even if the click is only one). What happens? How do I prevent this behaviour? What is causing this? Any help is appreciated. [SOLVED] I'm sorry, you will not believe this. A colleague, to make me a joke, converted the MOUSE_DOWN handler to MOUSE_OVER.

    Read the article

  • pdf external streams in Max OS X Preview

    - by olpa
    According to the specification, a part of a PDF document can reside in an external file. An example for an image: 2 0 obj << /Type /XObject /Subtype /Image /Width 117 /Height 117 /BitsPerComponent 8 /Length 0 /ColorSpace /DeviceRGB /FFilter /DCTDecode /F (pinguine.jpg) >> stream endstream endobj I found that this functionality does work in Adobe Acrobat 5.0 for Windows (sample PDF with the image), also I managed to view this file in Adobe Acrobat Reader 8.1.3 for Mac OS X after I found the setting "Allow external content". Unfortunately, it seems that non-Adobe tools ignore the external stream feature. I hope I'm wrong, therefore ask the question: How to enable external streams in Mac OS X? (I think that all the system Mac OS X tools use the same library, therefore say "Mac OS X" instead of "Preview".) Or maybe there could be a programming hook to emulate external streams? My task is: store a big set of images (total ˜300Mb) outside of a small PDF (˜1Mb). At some moment, I want to filter PDF through a quartz filter and get a PDF with the images embedded. Any suggestions are welcome.

    Read the article

  • How to use AJAX to populate state list depending on Country list?

    - by jasondavis
    I have the code below that will change a state dropdown list when you change the country list. How can I make it change the state list ONLY when country ID number 2234 and 224 are selected? If another country is selected is should change into this text input box <input type="text" name="othstate" value="" class="textBox"> The form <form method="post" name="form1"> <select style="background-color: #ffffa0" name="country" onchange="getState(this.value)"> <option>Select Country</option> <option value="223">USA</option> <option value="224">Canada</option> <option value="225">England</option> <option value="226">Ireland</option> </select> <select style="background-color: #ffffa0" name="state"> <option>Select Country First</option> </select> The javascript <script> function getState(countryId) { var strURL="findState.php?country="+countryId; var req = getXMLHTTP(); if (req) { req.onreadystatechange = function() { if (req.readyState == 4) { // only if "OK" if (req.status == 200) { document.getElementById('statediv').innerHTML=req.responseText; } else { alert("There was a problem while using XMLHTTP:\n" + req.statusText); } } } req.open("GET", strURL, true); req.send(null); } } </script>

    Read the article

  • Handling Types Defined in Plug-ins That Are No Longer Available

    - by Chris
    I am developing a .NET framework application that allows users to maintain and save "projects". A project can consist of components whose types are defined in the assemblies of the framework itself and/or in third-party assemblies that will be made available to the framework via a yet-to-be-built plug-in architecture. When a project is saved, it is simply binary-serialised to file. Projects are portable, so multiple users can load the same project into their own instances of the framework (just as different users may open the same MSWord document in their own local copies of MSWord). What's more, the plug-ins available to one user's framework might not be available to that of another. I need some way of ensuring that when a user attempts to open (i.e. deserialise) a project that includes a type whose defining assembly cannot be found (either because of a framework version incompatibility or the absence of a plug-in), the project still opens but the offending type is somehow substituted or omitted. Trouble is, the research I've done to date does not even hint at a suitable approach. Any ideas would be much appreciated, thanks.

    Read the article

  • How can i change a jquery plugin's option value with my value?

    - by Pandiya Chendur
    I have just jquery pagination plugin to work... But what happens is when i click page number 2 i get the first page and when i click 3 i get second page and so on.... My initial page my current page value changes to 0 instead 1 this causes the problem... My plugin has this, jQuery.fn.pagination = function(maxentries, opts){ opts = jQuery.extend({ items_per_page:10, num_display_entries:10, current_page:0, num_edge_entries:0, link_to:"#", prev_text:"Prev", next_text:"Next", ellipse_text:"...", prev_show_always:true, next_show_always:true, callback:function(){return false;} },opts||{}); current_page is set to 0 ... I have modified the current page value in my jquery function but it doesn't seem to work.... <script type="text/javascript"> var itemsPerPage = 5; var maxNumberOfElementsHere = 17; $(document).ready(function() { getRecordspage(1, itemsPerPage); $(".pager").pagination(maxNumberOfElementsHere, { callback: getRecordspage, current_page: 1, // Look here i have changed this but it doesn't work... items_per_page: itemsPerPage, num_display_entries: 5, next_text: 'Next', prev_text: 'Prev', num_edge_entries: 1 }); }); </script>

    Read the article

  • adding an uncertain number of fields using javascript

    - by user306472
    I'm new to javascript and a novice programmer, so this might be a really easy question to answer. I would like to loop over the values of x number of fields and add them up to display the sum in a final field. I can perform this function if I explicitly call each field, but I want to abstract this so I can deal with a flexible number of fields. Here's example code I've come up with (that's not working for me). Where am I going wrong? <html> <head> <script type="text/javascript"> function startAdd(){ interval = setInterval("addfields()",1); } function addfields(){ a = document.addition.total.value; b = getElementByTagName("sum").value; for (i=0; i<=b.length; i++){ a+=i; } return a; } function stopAdd(){ clearInterval(interval); } </script> </head> <body> <form name="addition"> <input type="text" name="sum" onFocus="startAdd();" onBlur="stopAdd;"> + <input type="text" name="sum" onFocus="startAdd();" onBlur="stopAdd;"> = <input type="text" name ="total"> </form> </body> </html>

    Read the article

  • Anchor as a Submit button

    - by griegs
    I have an MVC 2 application that has the following on it; <% using( Html.BeginForm("Results","Quote", FormMethod.Post, new { name="Results" })){ %> <% Html.RenderPartial("Needs", Model.needs); %> <div class="But green" style=""> <a href="." onclick="javascript:document.Results.submit();">Go</a> </div> <input type="submit" /> <%} %> Pressing the Submit button or the anchor both post back to the right ActionResult. However, when in the controller I return View(stuff..) only the Submit button will come back to the page. When the call finishes from pressing the anchor, I go to an error page informing me that the resource cannot be found. I suspect it has something to do with href="." but am unsure what to set it to.

    Read the article

  • Event type property lost in IE-8

    - by Channel72
    I've noticed a strange Javascript error which only seems to happen on Internet Explorer 8. Basically, on IE-8 if you have an event handler function which captures the event object in a closure, the event "type" property seems to become invalidated from within the closure. Here's a simple code snippet which reproduces the error: <html> <head> <script type = "text/javascript"> function handleClickEvent(ev) { ev = (ev || window.event); alert(ev.type); window.setTimeout(function() { alert(ev.type); // Causes error on IE-8 }, 20); } function foo() { var query = document.getElementById("query"); query.onclick = handleClickEvent; } </script> </head> <body> <input id = "query" type = "submit"> <script type = "text/javascript"> foo(); </script> </body> </html> So basically, what happens here is that within the handleClickEvent function, we have the event object ev. We call alert(ev.type) and we see the event type is "click". So far, so good. But then when we capture the event object in a closure, and then call alert(ev.type) again from within the closure, now all of a sudden Internet Explorer 8 errors, saying "Member not found" because of the expression ev.type. It seems as though the type property of the event object is mysteriously gone after we capture the event object in a closure. I tested this code snippet on Firefox, Safari and Chrome, and none of them report an error condition. But in IE-8, the event object seems to become somehow invalidated after it's captured in the closure. Question: Why is this happening in IE-8, and is there any workaround?

    Read the article

  • Loading an FLV in Facebox with jQuery for IE7 and IE8

    - by Trip
    It goes almost without saying, this works perfectly in Chrome, Firefox, and Safari. IE (any version) being the problem. Objective: I am trying to load JWplayer which loads an FLV from S3 in a Facebox popup. jQuery(document).ready(function($) { $('a[rel*=facebox]').facebox() }) HTML (haml): %li#videoGirl = link_to 'What is HQchannel?', '#player', :rel => 'facebox' .grid_8.omega.alpha#player{:style => 'display: none;'} :javascript var so = new SWFObject('/flash/playerTrans.swf','mpl','640px','360px','0'); so.addParam('allowscriptaccess','always'); so.addParam('allowfullscreen','true'); so.addParam('wmode','transparent'); so.addVariable('file', 'http://hometownquarterlyvideos.s3.amazonaws.com/whatishqchannel.flv&autostart=true&controlbar=none&repeat=always&image=/flash/video_girl/whatishqchannel.jpg&icons=false&screencolor=none&backcolor=FFFFFF&screenalpha=0&overstretch'); so.addVariable('overstretch', 'true') so.write('player'); Problem: Despite the video being set to display: none;. It begins playing anyway. When clicking on the activation div, IE7 pops up a wrong sized blank div with a nav (params are set to not show nav and scrubber), and no buttons on the nav and srubber work. IE8 shows the right size but same behavior with nav and scrubber not working, and blank screen. My guess: I'm thinking that the problem is with the javascript not being called at the right times. It seems it's loading the facebox without the jwplayer. At least I assume. Hence the reason why the nav is there. I thinking that it did not read the javascript for that.

    Read the article

  • Jquery click event propagation

    - by ozsenegal
    I've a table with click events bind to it rows (tr). Also,there're A elements with it owns click events assigned inside those rows. Problem is when i click on A element,it also fires click event from TD.And Im dont want this behavior,i just want to fire A click's event. Code: //Event row TR $("tr:not(:first)").click(function(){ $(".window,.backFundo,.close").remove(); var position = $(this).offset().top; position = position < 0 ? 20 : position; $("body").append($("<div></div>").addClass("backFundo")); $("body").append($("<div></div>").addClass("window").html("<span class=close><img src=Images/close.png id=fechar /></span>").append("<span class=titulo>O que deseja fazer?</span><span class=crud><a href=# id=edit>Editar</a></span><span class=crud><a href=# id=delete codigo=" + $(this).children("td:first").html() + ">Excluir</a></span>").css({top:"20px"}).fadeIn("slow")); $(document).scrollTop(0); }); //Element event $("a").live("click",function(){alert("clicked!");}); Whenever you click the anchor it fires event from it parent row.Any ideas?

    Read the article

  • passing data from a servlet to javascript code in an Ajax application ?

    - by A.S al-shammari
    I have a simple jsp/servlet application and I want to add AJAX feature to this app. I use JQuery , but it doesn't matter what javascript framework I use. This is my code: <script type="text/javascript"> function callbackFunction(data){ $('#content').html(data); } $('document').ready(function(){ $('#x').click(function() { $.post('/ajax_2/servlet',callbackFunction) }); }); </script> <body> <a href="#" id="x">Increase it</a> <div id="content"></div> </body> </html> Servlet HttpSession session = request.getSession(); Integer myInteger = (Integer)session.getAttribute("myInteger"); if(myInteger == null) myInteger = new Integer(0); else myInteger = new Integer(myInteger+1); session.setAttribute("myInteger", myInteger); response.getWriter().println(myInteger); The Question: I use out.print to transfer data from a servlet to javascript code (ajax code) , but If I have a complex structure such as Vector of Object or something like this , what is the best way to transfer the data? what about an XML file , JSON ? Is there any special jsp/servlets library to transfer data from a servlet to ajax application ? How can I parse this data in callbackFunction ?

    Read the article

  • Rack, FastCGI, Lighttpd configuration

    - by zacsek
    Hi! I want to run a simple application using Rack, FastCGI and Lighttpd, but I cannot get it working. I get the following error: /usr/lib/ruby/1.8/rack/handler/fastcgi.rb:23:in `initialize': Address already in use - bind(2) (Errno::EADDRINUSE) from /usr/lib/ruby/1.8/rack/handler/fastcgi.rb:23:in `new' from /usr/lib/ruby/1.8/rack/handler/fastcgi.rb:23:in `run' from /www/test.rb:7 Here is the application: #!/usr/bin/ruby app = Proc.new do |env| [200, {'Content-Type' => 'text/plain'}, "Hello World!"] end require 'rack' Rack::Handler::FastCGI.run app, :Port => 4000 ... and the lighttpd.conf: server.modules += ( "mod_access", "mod_accesslog", "mod_fastcgi" ) server.port = 80 server.document-root = "/www" mimetype.assign = ( ".html" => "text/html", ".txt" => "text/plain", ".jpg" => "image/jpeg", ".png" => "image/png" ) index-file.names = ( "test.rb" ) fastcgi.debug = 1 fastcgi.server = ( ".rb" => (( "host" => "127.0.0.1", "port" => 4000, "bin-path" => "/www/test.rb", "check-local" => "disable", "max-procs" => 1 )) ) Can someone help me? What am I doing wrong?

    Read the article

  • why the main method are not covered? urgent, please help me

    - by Mike.Huang
    main method: public static void main(String[] args) throws Exception { if (args.length != EXPECTED_NUMBER_OF_ARGUMENTS) { System.err.println("Usage - java XFRCompiler ConfigXML PackageXML XFR"); } String configXML = args[0]; String packageXML = args[1]; String xfr = args[2]; AutoConfigCompiler compiler = new AutoConfigCompiler(); compiler.setConfigDocument(loadDocument(configXML)); compiler.setPackageInfoDoc(loadDocument(packageXML)); // compiler.setVisiblityDoc(loadDocument("VisibilityFilter.xml")); compiler.compileModel(xfr); } private static Document loadDocument(String fileName) throws Exception { TXDOMParser parser = (TXDOMParser) ParserFactory.makeParser(TXDOMParser.class.getName()); InputSource source = new InputSource(new FileInputStream(fileName)); parser.parse(source); return parser.getDocument(); } testcase: @Test public void testCompileModel() throws Exception { // construct parameters URL configFile = Thread.currentThread().getContextClassLoader().getResource("Ford_2008_Mustang_Config.xml"); URL packageFile = Thread.currentThread().getContextClassLoader().getResource("Ford_2008_Mustang_Package.xml"); File tmpFile = new File("Ford_2008_Mustang_tmp.xfr"); if(!tmpFile.exists()) { tmpFile.createNewFile(); } String[] args = new String[]{configFile.getPath(),packageFile.getPath(),tmpFile.getPath()}; try { // test main method XFRCompiler.main(args); } catch (Exception e) { assertTrue(true); } try { // test args length is less than 3 XFRCompiler.main(new String[]{"",""}); } catch (Exception e) { assertTrue(true); } tmpFile.delete(); } coverage outputs displayed as the lines from “String configXML = args[0];" in main method are not covered

    Read the article

  • undefined method `key?' for nil:NilClass when using MongoMapper

    - by Radek Slupik
    I set up a new Rails application by following these instructions. I generated a new controller and added resources :tickets to the routes file. Hexapoda::Application.routes.draw do resources :tickets end This is the controller (`/app/controllers/tickets_controller.rb'). class TicketsController < ApplicationController def index @tickets = Ticket.all end end I then added a new model Ticket in /app/models/ticket.rb. class Ticket include MongoMapper::Document key :summary, String, :required => true end Here's the view (/app/views/index.html.erb): <h1>Tickets#index</h1> <p>Find me in app/views/tickets/index.html.erb</p> Now when I go to /tickets in my browser, I get an error message. NoMethodError in TicketsController#index undefined method `key?' for nil:NilClass I have no idea what's going on. What could be the problem? I'm using Rails 3.2.5 and MongoMapper 0.11.1.

    Read the article

  • Convert XML to TCL Object

    - by pws5068
    Greetings, I'm new to TCL scripting, and I have a very very basic xml file which I need to import information from into tcl. Example of XML Document Structure: <object> <type>Hardware</type> <name>System Name</name> <description>Basic Description of System.</description> <attributes> <vendor>Dell</vendor> <contract>MM/DD/YY</contract> <supportExpiration>MM/DD/YY</supportExpiration> <location>Building 123</location> <serial>xxx-xxx-xxxx</serial> <mac>some-mac-address</mac> </attributes> </object> Etc... I've seen something called TCLXML but I'm not sure if this is the best route or even how to create the package to use it.. Any help will be greatly appreciated.

    Read the article

  • Servlet receiving data both in ISO-8859-1 and UTF-8. How to URL-decode?

    - by AJPerez
    I've a web application (well, in fact is just a servlet) which receives data from 3 different sources: Source A is a HTML document written in UTF-8, and sends the data via <form method="get">. Source B is written in ISO-8859-1, and sends the data via <form method="get">, too. Source C is written in ISO-8859-1, and sends the data via <a href="http://my-servlet-url?param=value&param2=value2&etc">. The servlet receives the request params and URL-decodes them using UTF-8. As you can expect, A works without problems, while B and C fail (you can't URL-decode in UTF-8 something that's encoded in ISO-8859-1...). I can make slight modifications to B and C, but I am not allowed to change them from ISO-8859-1 to UTF-8, which would solve all the problems. In B, I've been able to solve the problem by adding accept-charset="UTF-8" to the <form>. So the <form> sends the data in UTF-8 even with the page being ISO. What can I do to fix C? Alternatively, is there any way to determine the charset on the servlet, so I can call URL-decode with the right encoding in each case?

    Read the article

  • cycle through spans on jquery click, removing the first-child

    - by jacob
    Basically, this advances to the next hidden span when clicked. The markup: <div id="facts"> <span>click to cycle</span> <span>fact 1</span> <span>fact 2</span> <span>fact 3</span> <span>fact 4</span> </div> The js: $(document).ready(function() { var current = 1; $('#facts span').click(function() { // Hide all of them $('#facts span').hide(); // Unhide the current one: $('#facts span:eq(' + (current % $('#facts span').length) + ')').show(); // Increment the variable console.log(current % 4); current++; }); // Unhide the first one on load $('#facts span:first-child').show(); });? What I'm trying to do now is remove the first span after it's been clicked, because it is not necessary for the user to see the 'click to cycle' instruction again.

    Read the article

  • Trying to fadein divs in a sequence, over time, using JQuery

    - by user346602
    Hi, I'm trying to figure out how to make 4 images fade in sequentially when the page loads. The following is my (amateurish) code: Here is the HTML: <div id="outercorners"> <img id="corner1" src="images/corner1.gif" width="6" height="6" alt=""/> <img id="corner2" src="images/corner2.gif" width="6" height="6" alt=""/> <img id="corner3" src="images/corner3.gif" width="6" height="6" alt=""/> <img id="corner4" src="images/corner4.gif" width="6" height="6" alt=""/> </div><!-- end #outercorners--> Here is the JQuery: $(document).ready(function() { $("#corner1").fadeIn("2000", function(){ $("#corner3").fadeIn("4000", function(){ $("#corner2").fadeIn("6000", function(){ $("#corner4").fadeIn("8000", function(){ }); }); }); }); Here is the css: #outercorners { position: fixed; top:186px; left:186px; width:558px; height:372px; } #corner1 { position: fixed; top:186px; left:186px; display: none; } #corner2 { position: fixed; top:186px; left:744px; display: none; } #corner3 { position: fixed; top:558px; left:744px; display: none; } #corner4 { position: fixed; top:558px; left:186px; display: none; } They seem to just wink at me, rather than fade in in the order I've ascribed to them. Should I be using the queue() function? And, if so, how would I implement it in this case? Thank you for any assistance.

    Read the article

  • custom control in DataGridTemplateColumn

    - by Johnsonlu
    Hi all, I'd like to add my custom control into a template column of data grid. The custom control is very similar to a text box, but has an icon in it. The user can click the icon, and selects an item from a prompted window, then the selected item will be filled into the text box. My problem is when the text box is filled, after I click the second column, the text will disappear. If I replace the custom control with a simple text box, the result is the same. Here is the sample code: //Employee.cs using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace SimpleGridTest { public class Employee { public string Department { get; set; } public int ID { get; set; } public string Name { get; set; } } } Mainwindow.xaml <Window x:Class="SimpleGridTest.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Title="MainWindow" Height="350" Width="525"> <Grid> <DataGrid x:Name="grid" Grid.Row="1" Margin="5" AutoGenerateColumns="False" RowHeight="25" RowHeaderWidth="10" ItemsSource="{Binding}" CanUserAddRows="True" CanUserSortColumns="False"> <DataGrid.Columns> <DataGridTemplateColumn Header="Department" Width="150"> <DataGridTemplateColumn.CellTemplate> <DataTemplate> <TextBox Text="{Binding Department}" /> </DataTemplate> </DataGridTemplateColumn.CellTemplate> </DataGridTemplateColumn> <DataGridTextColumn Header="ID" Binding="{Binding Path=ID}" Width="100"/> <DataGridTextColumn Header="Name" Binding="{Binding Path=Name}" Width="200"/> </DataGrid.Columns> </DataGrid> </Grid> </Window> MainWindow.xaml.cs using System.Windows; using System.Collections.ObjectModel; namespace SimpleGridTest { /// <summary> /// Interaction logic for MainWindow.xaml /// </summary> public partial class MainWindow : Window { private ObservableCollection<Employee> _employees = new ObservableCollection<Employee>(); public ObservableCollection<Employee> Employees { get { return _employees; } set { _employees = value; } } public MainWindow() { InitializeComponent(); grid.ItemsSource = Employees; } } } How can I fix this problem? Or I need to write a DataGrid***Column as DataGridTextColumn? Thanks in advance! Best Regards, Johnson

    Read the article

  • juqery image fading with tabs

    - by StealthRT
    Hey all, i am trying my best to figure out how to go about doing this: I have 2 tabs. When the page loads tab1 is selected automatically. This shows the tab as 1.0 transparency while tab2 stays at 0.7. Once the user clicks on tab2, tab1 goes to 0.7 transparency and tab2 goes to 1.0. However, i can not seem to get it to do that! Here is my code: function checkTab(theTab) { $('#tab1').fadeTo(250, 0.70); $('#tab2').fadeTo(250, 0.70); if ($("#tabActive").val() == theTab) { $(theTab).fadeTo(250, 1); } } $(document).ready(function() { $('#tab1').hover(function() {$(this).fadeTo(250, 1)}, function() {checkTab('#tab1')}); $('#tab2').hover(function() {$(this).fadeTo(250, 1)}, function() {checkTab('#tab2')}); $('#tab2').fadeTo(250, 0.70); $('#tabActive').val('tab1'); }); </script> <li class="stats"><img src="images/Stats.png" name="nav1" width="70" height="52" id="tab1" onclick="$('#tabActive').val('tab1');" /></li> <li class="cal"><img src="images/cal.png" name="nav1" width="70" height="52" id="tab2" onclick="$('#tabActive').val('tab2');" /></li> <input name="tabActive" id="tabActive" type="text" /> Any help would be great! :) David

    Read the article

  • Sharepoint user details not visible to other users

    - by richardoz
    I am managing a SharePoint site that uses Form Based Authentication. We have several generic lists, document libraries and active task lists that users can create update and delete. Users can use the people pickers to select/search for everyone. But the users cannot see other users names, email addresses etc. in display lists or the people pickers. If I log in as the site collection administrator, I can see everyones details. So I know the data is available. Updated details on this problem (non-administrators) SharePoint users cannot see other users information. Example: User A assigns a task to user B. User A creates a new task and uses the people picker to find user B. User B is only visible by the login name “bname” and any information about user B is not visible or searchable within the people picker. Once user B is assigned the task, user A no longer sees the name in the task list – even though user A created it. No modified by, created by, assigned to or owner field data is visible to non-administrator users. Facts: Extranet site is configured to use Forms Based Authentication. Intranet uses windows based authentication Users of both the intranet and extranet have the same problem All databases are local The site uses SSRS integration SharePoint WSS on Windows 2003 Std -- After activating the verbose logging it looks like SharePoint is definately asking SQL server for only the user info for the currently logged in user: SELECT TOP 6 /lots-of-columns/ FROM UserData INNER MERGE JOIN Docs AS t1 ON ( 1 = 1 AND UserData.[tp_RowOrdinal] = 0 AND t1.SiteId = UserData.tp_SiteId AND t1.SiteId = @L2 AND t1.DirName = UserData.tp_DirName AND t1.LeafName = UserData.tp_LeafName AND t1.Level = UserData.tp_Level AND t1.IsCurrentVersion = 1 AND (1 = 1) ) LEFT OUTER JOIN AllUserData AS t2 ON ( UserData.[tp_Author]=t2.[tp_ID] AND UserData.[tp_RowOrdinal] = 0 AND t2.[tp_RowOrdinal] = 0 AND ( (t2.tp_IsCurrent = 1) ) AND t2.[tp_CalculatedVersion] = 0 AND t2.[tp_DeleteTransactionId] = 0x AND t2.tp_ListId = @L3 AND UserData.tp_ListId = @L4 AND t2.[tp_Author]=162 /* this is the currently logged in user */ ) WHERE (UserData.tp_IsCurrent = 1) AND UserData.tp_SiteId=@L2 AND (UserData.tp_DirName=@DN) AND UserData.tp_RowOrdinal=0 AND ( ( (UserData.[datetime1] IS NULL ) OR (UserData.[datetime1] = @L5DTP) ) AND t1.SiteId=@L2 AND (t1.DirName=@DN) ) ORDER BY UserData.[tp_Modified] Desc, UserData.[tp_ID] Asc Again, any ideas would be appreciated.

    Read the article

  • add dynamic field near his parent field?

    - by Kaps Hasija
    hi in my web page i am using Add Dynamic Field Functionality by using jquery. I am adding new div bu clicking on Existing div Like <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> by clicking on parent div i am creating new daynamic div <div class="divA">DivA2 </div> its coming end of the all div's like that <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> <div class="divA">DivA2 </div> But i need along with his parent div Like that <div class="divA">divA1 </div> <div class="divA">DivA2 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> any idea Thanks. This is My Jquery Code newTextBoxDiv = $(document.createElement('div')) .attr("id", text).attr("class", 'test0 ' + text); newTextBoxDiv.html('<div style=" width:150px; class="DivA" float: left"> </div>'); } newTextBoxDiv.appendTo("#contents"); contents is id of main div

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • IE browser caching and the jQuery Form Plugin

    - by Harfleur
    Like so many lost souls before me, I'm floundering in the snake pit that is Ajax form submission and IE browser caching. I'm trying to write a simple script using the jQuery Form Plugin to Ajaxify Wordpress comments. It's working fine in Firefox, Chrome, Safari, et. al., but in IE, the response text is cached with the result that Ajax is pulling in the wrong comment. jQuery(this).ajaxSubmit({ success: function(data) { var response = $("<ol>"+data+"</ol>"); response.find('.commentlist li:last').hide().appendTo(jQuery('.commentlist')).slideDown('slow'); } }); ajaxSubmit sends the comment to wp-comments-post.php, which inelegantly spits back the entire page as a response. So, despite the fact that it's ugly as toads, I'm sticking the response text in a variable, using :last to isolate the most recent comment, and sliding it down in its place. IE, however, is returning the cached version of the page, which doesn't include the new comment. So ".commentlist li:last" selects the previous comment, a duplicate of which then uselessly slides down beneath the original. I've tried setting "cache: false" in the ajaxSubmit options, but it has no effect. I've tried setting a url option and tacking on a random number or timestamp, but it winds up being attached to the POST that submits the comment to the server rather than the GET that returns the response, and so has no effect. I'm not sure what else to try. Everything works fine in IE if I turn off browser caching, but that's obviously not something I can expect anyone viewing the page to do. Any help will be hugely appreciated. Thanks in advance! EDIT WITH A PROGRESS REPORT: A couple of people have suggested using PHP headers to prevent caching, and this does indeed work. The trouble is that wp-comments-post is spitting back the entire page when a new comment is submitted, and the only way I can see to add headers is to put them in the Wordpress post template, which disables caching on all posts at all times--not quite the behavior I'm looking for. Is there a way to set a php conditional--"if is_ajax" or something like that--that would keep the headers from being applied during regular pageloads, but plug them in if the page was called by an Ajax GET?

    Read the article

< Previous Page | 696 697 698 699 700 701 702 703 704 705 706 707  | Next Page >