Search Results

Search found 81885 results on 3276 pages for 'please help'.

Page 701/3276 | < Previous Page | 697 698 699 700 701 702 703 704 705 706 707 708  | Next Page >

• Htpc aka "Media Center": cheap and *silent*?

  - by Unknown

  It may be me, or the place I live (Italy), but it seems pretty hard to get a build or a prebuilt nettop or a laptop that fits the need. I need something silent able to playback all h.264 fullhd content without stuttering, and well (and not loosing the hw acceleration because of softsubs...) silent not ugly silent and (possibly) cheap. I'm going the linux route, therefore i'm moving towards a cpu-based or nvida-integrated solution (i don't think ati hw accelerated playback - or the intel "hd" acceleration - is useable yet). Ion nettop; it's either the Acer Revo (but here it's incredibly pricey and it's hard to find the dualcore version) or the Asrock Ion 330, that in the current version is rated "silent" at 26Db. 26. Sounds pretty noisy to me!!! the previous version was even worse. was this product really aimed at htpc market?? the Dell Zino - i think it's ATI based unfortunately. Laptop: correct me if I'm wrong: sub 600€/$ units are quite loud under full load (because of the tiny fans). ULW laptops are indeed quite similar: tiniest fans = high pitched noise and the cpu still lacks power for non hd-accelerated video decoding Handmade build: little money can be saved with underpowered cpus, a low-midrange cpu would help in the case of non-hw-accelerated content the cases are quite pricey the PSU one has to get ranges between 100/150 €/$ minimum to keep the noise down a low-mid build, all included, sums up to over 650 €/$ for a still-looking-ugly-unit, without the blu-ray drive. Please help. What do you advise on this? ;) Am I ignoring laptops too much, maybe? Are low-priced Acers that noisy/high pitched under full load?

  Read the article

• Slow upload speeds with pfsense virtual appliance

  - by Justin Shin

  I have a pfSense virtual appliance set up in front of a Windows server. The pfSense appliance has been configured with two L2L IPSec VPN sites and not too much else. The appliance has two vNics which both exist on the same VLAN, but one is "WAN" and the other is "LAN." When I run speedtest.net on my Windows server when I have configured it to use a static WAN address and gateway, I get great speeds - maybe around 50 down, 15 up. However, when I configure it with a private IP address, I get similar download speeds but terrible upload speeds - around 2 or 3 Mbps consistently. I used Wireshark to see what gives but there didn't appear to be too much helpful information there, or I just could not find it. Besides the L2L VPNs, other configurations include: Automatic Outbound NAT Virtual P-ARP IP for the Windows Server WAN Firewall rule to allow * to * on RDP WAN Firewall rule to allow * to * (enabled this just for testing... didn't help!) No DHCP or any other services besides IPSec VPN No Errors LAN or WAN No collisions LAN or WAN I would be happy to post the full config file if it would help. I've been scratching my head at this one all day!

  Read the article

• problem booting crusty old windows XP

  - by Carson Myers

  I have an acer aspire laptop running Windows XP home. I believe I have some virus on it, I'm not sure--I mostly just run linux in a VM on it so I wasn't too worried. I'm not sure if that virus caused this problem. The laptop wasn't recognizing my USB hard drive for some reason so I decided to restart it. When it started up, it got past the memory test, past the boot screen, (but it paused right here on a blank screen for awhile) and flashed the desktop once (like it does just before the login screen) and then crashed. I got a quick BSOD and then it restarted. Then it tried to boot again, etc etc infinite loop of failure. Well, before trying safe mode, I disabled automatic restart on system crash so I could read the blue screen. There wasn't anything important on it, it said *** STOP: 0x00000000 (0xC0000000 0x,.... ) beginning physical memory dump physical memory dump complete That's not verbatim (obviously) but it didn't help me. so I booted in safe mode, and it stopped on the driver gagp30kx.sys and then restarted (and infinite loop of failure again). I burned a recovery CD and tried that. It loaded it, and I went into repair mode. I ran chkdsk and then disabled the AGP driver. Same thing on booting in safe mode except it stopped at mup.sys instead. I enabled the AGP driver again, and ran chkdsk again from the CD. It said it found problems but didn't say it fixed them. So I ran it a second time, and it said "performing additional checking or recovery" lots of times (I can't tell how many, they went above the screen top). I tried booting again and no luck. Every time I run chkdsk after trying to boot again it says it found and fixed more errors. I think it might be whatever driver is after the AGP driver, but I don't know what it is or how to find out. Can anyone help me fix this?

  Read the article

• Windows Vista will not boot; the file header checksum does not match the computed checksum

  - by Magnus

  Right out of the blue, my wife's Sony Vaio stopped booting. This, not so fun, error message displays immediately after POST: The system cannot boot. The file is possibly corrupt. The file header checksum does not match the computed checksum The repair option on the Vista DVD says everything is fine and dandy, it couldn't be more happier or more clueless... Any ideas? Update: CHKDSK reports no issues. CHKDSK /r reports no issues. (Heck, both Windows Repair and CHKDSK could just as well tell me that I have won on lottery or that the earth is flat... ) Some have reported that a mem diagnostic could help, but for me the mem diag has just ran through 5 passes. It doesn't seem to help. According to Sony, pressing F10 should bring up the restore menu, but it doesn't, the error pops up straight after Bios POST. It seems that this error is first in line of all options at this point, and is doesn't put a smile on my face. I have attached an external USB drive and copied all user data/documents to it. I feel an OS re-install is around the corner.

  Read the article

• mysql startup, shtudown and logging on osx

  - by Joelio

  Hi, I am trying to troubleshoot some mysql problems (I have a table I cant seem to delete or drop, it hangs forever) I have 10.5.8 osx, I dont remember how/if I installed mysql, here is what I know: it automatically starts on boot the process looks like this: /usr/local/mysql/libexec/mysqld --basedir=/usr/local/mysql --datadir=/usr/local/mysql/var --pid-file=/usr/local/mysql/var/Joels-New-Pro.local.pid _mysql 96 0.0 0.0 75884 684 ?? Ss Sat06PM 0:00.02 /bin/sh /usr/local/mysql/bin/mysqld_safe when I run: /usr/local/mysql/libexec/mysqld --verbose --help it says: /usr/local/mysql/libexec/mysqld Ver 5.0.45 for apple-darwin9.1.0 on i686 (Source distribution) it seems to use my.cnf from /etc/my.cnf Now here are my questions: I dont see anything in the startupitems that remotely looks like mysql ls /Library/StartupItems/ BRESINKx86Monitoring ChmodBPF HP IO HP Trap Monitor Parallels ParallelsTransporter 1.) So how does it startup automatically? 2.) How do I start & stop this type of installation? Also, looking at the config, the logs have no values: /usr/local/mysql/libexec/mysqld --verbose --help|grep '^log' log (No default value) log-bin (No default value) log-bin-index (No default value) log-bin-trust-function-creators FALSE log-bin-trust-routine-creators FALSE log-error log-isam myisam.log log-queries-not-using-indexes FALSE log-short-format FALSE log-slave-updates FALSE log-slow-admin-statements FALSE log-slow-queries (No default value) log-tc tc.log log-tc-size 24576 log-update (No default value) log-warnings 1 3.) Does that mean there is no logging enabled in mysetup? thanks in advance! Joel

  Read the article

• Setting up a Pagefile and Partition in Server 2008

  - by Brett Powell

  I am setting up 18 new machines for our company, and I have instructions from my new boss on setting up a Pagefile and Partition. I have looked at their existing machines to base the new setups off of, but there is no consistency between any 2 machines, which has left me extremely frustrated to say the least. My instructions are... 1) Set a static pagefile (use recommended value as max/min), set it on SSD if SSD available. 2) Make 3 partitions: C: is used for OS and install files D: is used for backups on machines with a SSD. On machines without SSD create a D: partition for pagefile (2*installed RAM for partition size) E: must be the partition hosting user files I have never messed with Pagefiles before, and looking at their existing machines is offering no help. My questions are... 1) As the machines I am setting up have no SSD (just 2 SATA drives) does it sound like the Pagefile should be setup on the C: (primary) drive or the D:? The instructions are vague so I have no idea. 2) As C: and D: are both Physical drives, does it sound like C: should be partitioned out to create the E: drive or D:? Thanks for any help I can get. I am extremely stressed out under a massive workload right now, and these vague instructions are quite infuriating.

  Read the article

• win8: access denied to external USB disk; update access rights fails

  - by Gerard

  I use to work with 2 laptops (vista and win7), my work being files on an external usb disk. My oldest laptop broke down, so I bought a new one. I had no option other than take win8. 1/ I suspect something changed with access rights, as my external disk suffered some "access denied" problem on win8. I was prompted (by win8) somehow to fix the access rights, which I tried to do, getting to the properties - security. This process was very slow and ended up saying "disk is not ready". Additonnally, the usb somehow was not recognized anymore. 2/ Back to win7, I was warned that my disk needed to be verified, which I did. In this process, some files were lost (most of them i could recover from the folder found00x, but I have some backup anyway). Also, I don't know why, but under win7, all the folder showed with a lock. 3/ Then back again to win8. Same problem : access denied to my disk + no way to change access rights as it gets stuck "disk is not ready". Now I am pretty sure there is some kind of bug or inconsistence in win8 / win7. I did 2/ and 3/ a few times. At some point, I also got an access denied in win7. I could restore access rigths to the disk to "system" (properties - security - EDIT for full control to group "system" ...). But then I still get the same access right pb on win8, and getting stuck in the process to restore full control to "system" -- and "admin" groups. Now, after I tried for more than 3 days, I am losing my patience with that bloody win8 which I did not want to buy but had no choice. I upgraded win8 with the windows updates available. Does not help. Anybody can help me ?

  Read the article

• Enabling AHCI in BIOS for SSD

  - by Robert

  I am trying to help a friend with a desktop upgrade. It is an old machine with an Intel DG31 main board. The board has 1 IDE port to which a DVD-ROM drive is connected, and 2 SATA ports. 1 SATA port had a hard drive with XP on it. I have made that the secondary drive now and wiped the OS as requested, so it is just for data. The new SSD has been installed but I read that for best results one must enable AHCI in the BIOS? So I checked and in the BIOS there is a SATA Mode setting with 2 options - Native and Legacy. I think Native means AHCI? After setting to Native, I installed Windows 7 Home Premium and all the latest drivers from Intel's website and all Windows Updates. Now when I check Device Manager I see this: Also Microsoft says HKEY_LOCAL_MACHINE\System\CurrentControlSet\Services\Msahci\Start and HKEY_LOCAL_MACHINE\System\CurrentControlSet\Services\IastorV\Start should have value 0 for AHCI but I see that the value is 3 for both. So does this mean that Native mode is not AHCI? Or Windows 7 ignored BIOS setting and installed in IDE mode, maybe because both cables are present? Please help me enable AHCI on this system. Thanks!

  Read the article

• Fedora 17 - Dropping into debug shell after attempted partitioning

  - by i.h4d35

  So I tried creating a new partition on Fedora 17 using fdisk as follows: Command (m for help): n Command action e extended p primary partition (1-4) p Partition number (1-4): 1 First cylinder (2048-823215039, default 2048): Using default value 2048 Last cylinder or +size or +sizeM or +sizeK (1-9039, default 9039): +15G Once this was done,instead of formatting the partition I created, I ran the partprobe command to write the changes to the partition table. On rebooting the computer, it drops to the debug shell and gives me the error as follows: dracut warning:unable to process initqueue dracut warning:/dev/disk/by-uuid/vg_mymachine does not exist dropping to debug shell dracut:/# While trying to run fsck on the said partition from the debug shell, it says "etc/fstab not found" and inside /etc I see a fstab.empty file. Is it now possible to retrieve what I have from the computer? Any help would be appreciated. Thanks in advance Edit: I've also tried the following steps for additional troubleshooting: I tried to boot using the Fedora disk and tried the rescue mode - says no Linux partition detected. I tried to create an fstab file by combining the entries from blkid and the /etc/mtab file and using the UUIDs from the mtab file - It didn't work. As soon as I rebooted the machine, it promptly dropped me in to the debug shell and the fstab file which i created wansn't there anymore in /etc (part of this solution)

  Read the article

• Find Search Replace from landmark to landmark - including everything in between

  - by Erick Tronboll

  Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

  Read the article

• Magento Apache Config & Memory Issues

  - by cheshirepine

  I have a Magento installation on a VPS that is giving me a headache. This particular VPS has a reasonable spec - 2gb Memory and 50gb storage. It runs a single domain, with a single Magento install - and nothing else. About 5 months ago we started having issues. Every so often (about once every 2 or 3 weeks) the VPS would crash - all processes stopped and the only way to restart the container is via Virtuozzo. Now, however its 2 or 3 times a week. My VPS hosts confirm I am breaching the 2gb memory limit, at which point all VPS processes are killed to stop it bringing the entire node down. I have not made any config changes to it at all - I was running New Relic on it for a short while, but have removed that in case it was contributing to the issues. I can see nothing in the logs which indicates an issue and we have no CRON jobs running at the time the crashes happen. The site generates steady, but not huge amounts of traffic (averaging usually less than 100 visits per day) Is there anything in particular I should have done to the Apache or PHP configs to help? Im not a massivley experienced Apache admin, but know more than enough to solve most problems... Failing that, any other ideas that might help? Can't afford for this site to be down this much.

  Read the article

• GRE Tunnel over IPsec with Loopback

  - by Alek

  I'm having a really hard time trying to estabilish a VPN connection using a GRE over IPsec tunnel. The problem is that it involves some sort of "loopback" connection which I don't understand -- let alone be able to configure --, and the only help I could find is related to configuring Cisco routers. My network is composed of a router and a single host running Debian Linux. My task is to create a GRE tunnel over an IPsec infrastructure, which is particularly intended to route multicast traffic between my network, which I am allowed to configure, and a remote network, for which I only bear a form containing some setup information (IP addresses and phase information for IPsec). For now it suffices to estabilish a communication between this single host and the remote network, but in the future it will be desirable for the traffic to be routed to other machines on my network. As I said this GRE tunnel involves a "loopback" connection which I have no idea of how to configure. From my previous understanding, a loopback connection is simply a local pseudo-device used mostly for testing purposes, but in this context it might be something more specific that I do not have the knowledge of. I have managed to properly estabilish the IPsec communication using racoon and ipsec-tools, and I believe I'm familiar with the creation of tunnels and addition of addresses to interfaces using ip, so the focus is on the GRE step. The worst part is that the remote peers do not respond to ping requests and the debugging of the general setup is very difficult due to the encrypted nature of the traffic. There are two pairs of IP addresses involved: one pair for the GRE tunnel peer-to-peer connection and one pair for the "loopback" part. There is also an IP range involved, which is supposed to be the final IP addresses for the hosts inside the VPN. My question is: how (or if) can this setup be done? Do I need some special software or another daemon, or does the Linux kernel handle every aspect of the GRE/IPsec tunneling? Please inform me if any extra information could be useful. Any help is greatly appreciated.

  Read the article

• Installed Paragon HFS+ for Windows 8, now my pc won't recognize the external firewire drive

  - by Steve

  I'm not incredibly knowledgeable about computers and I really need some help. Just got a Seagate external firewire drive this morning. I downloaded the necessary pc driver (Paragon HFS+ for Windows 8) through their website per the instructions that came with the drive. After installation, I restarted and the pc recognized the firewire drive just fine. About three hours into copying files from my pc to the firewire drive, it gave me an error and told me the files couldn't be copied. When I clicked to get out of the message, the computer crashed. After an hour of it trying to repair itself in safe mode, it restored me to an earlier version before the system crashed. Here's my current dilemma: The Paragon HFS+ is still showing up in my programs as installed, but the Device Manager is not recognizing the drive. When I try to uninstall and reinstall Paragon, it interrupts me with a message saying "The setup must update files or services that cannot be updated while the system is running" and basically gives me the finger. I have no idea what to do now, as it won't let me uninstall and reinstall Paragon, and I have no idea why it crashed my computer in the first place. Is there possibly another Mac - PC firewire driver I can try downloading instead? I really don't know what I'm doing and any help would be greatly appreciated.

  Read the article

• Which Firefox add-on is responsible for a rendering bug?

  - by Gilles

  I've found a page that isn't rendered correctly by Firefox with my usual profile. It is rendered correctly with a blank profile. I have quite a few add-ons. One of them is surely the culprit. How can I find out which? Userscripts often affect the rendering. But I turned off Greasemonkey, and it didn't help. So it's something else, presumably an extension (what else could it be? I have no chrome/userChrome.css.). I'm looking for an easy way to find out which one, easier than disabling a bunch of extensions and restarting umpteen times. Related: Create a tool to help users identify a problematic add-on by bisecting the list of installed add-ons — a similar problem which would admit a similar solution. I want to automate this as much as possible; something like git bisect, that doesn't require me to change my actual profile, would be ideal. A Linux-specific solution is fine with me.

  Read the article

• How do i tell if my drivers are up to date on Acer?

  - by joe

  Hoping some kind souls can help me out ? I got a blue screen the other day after trying to load sandboxie. So its obviously conflicting with something. I checked if my drivers were up to date on my acer aspire one AOD270 on this intel based site; http://www.drivermanager.com/en/down...tel&Logo=intel Its showing i have 2 drivers that need updating ; Intel NM10 Express chipset and the Realtek PCIE Cardreader. I have no idea whether to do the update via the Intel Driver update site or the Acer drivers download page? I then ran Bluescreenview and on the dump file its showing ; ''caused by driver'' igdkmd32.sys ''file description'' Intel (R) WDDM Kernel mode driver ''product name''Intel Graphics Accelerator Drivers for Windows 7(R) I bought the laptop here in SE Asia about a year ago. The ''HOT!! NEW download tool'' on the acer drivers site (below) doesnt seem to work and the info about removing and installing drivers is limited. Not sure what to trust on non acer/manufacturer sites. http://support.acer.com/us/en/produc...1&modelId=4040 I've located the igdkmd32.sys file inside the INTEL GRAPHICS MEDIA ACCELERATOR 3600 SERIES 8.14.8.1064. When i click on ''update driver'' in control panel it searches and says its up to date. In windows maintenance it says this intel had a problem, but no solution. For all i know my drivers could be up to date and its something else. Can anybody advise a dummy step by step the process i should follow ? I've never done this before. eg do i delete the old driver first and then download the new one.how much of a problem i could cause by downloading this type of thing wrongly? As yet i havent downloaded any drivers. I've asked on other forums but no luck as yet. Thanks for any help!

  Read the article

• Can't Login to phpPgAdmin

  - by Devin

  I'm trying to set up phpPgAdmin on my test machine so that I can interface with PostgreSQL without always having to use the psql CLI. I have PostgreSQL 9.1 installed via the RPM repository, while I installed phpPgAdmin 5.0.4 "manually" (by extracting the archive from the phpPgAdmin website). For the record, my host OS is CentOS 6.2. I made the following configuration changes already: PostgreSQL Inside pg_hba.conf, I changed all METHODs to md5. I gave the postgres account a password I added a new account named webuser with a password (note that I did not do anything else to the account, so I can't exactly say that I know what permissions it has and all) phpPgAdmin config.inc.php Changed the line $conf['servers'][0]['host'] = ''; to $conf['servers'][0]['host'] = '127.0.0.1'; (I've also tried using localhost as the value there). Set $conf['extra_login_security'] to false. Whenever I try to log in to phpPgAdmin, I get "Login failed", even if I use successful credentials (ones that work in psql). I've tried to go through some of the steps noted in Question 3 in the FAQ, but it hasn't worked out well so far there. It likely does not help that this is my first day working with PostgreSQL. I'm farily familiar with MySQL, but I have to use PostgreSQL for the project I'm working on. Could anyone offer some help for how to set up phpPgAdmin on CentOS 6.2? If I've done something terribly wrong in my configuration so far, it's no big deal to blow something/everything away, as it's not like I've stored any data there yet! I appreciate any insight you may have!

  Read the article

• Passenger not booting Rails App

  - by firecall

  I'm at the end of ability, so time to ask for help. My hosting company are moving me to a new server. I've got my own VPS. It's a fresh CentOS 5 install with Plesk 9.5.2 Essentially Passenger just doesnt seem to be booting the Rails app. It's like it doesnt see it's a Rails app to be booted. I've got Rails 3.0 install with Ruby 1.9.2 built from source. I can run Bundle Install and that works. I've currently got Passenger 3 RC1 installed as per here, but have tried v2 as well. My conf/vhost.conf file looks like this: DocumentRoot /var/www/vhosts/foosite.com.au/httpdocs/public/ RackEnv development #Options Indexes I've got a /etc/httpd/conf.d/passenger.conf file which looks like this: LoadModule passenger_module /usr/local/lib/ruby/gems/1.9.1/gems/passenger-3.0.0.pre4/ext/apache2/mod_passenger.so PassengerRoot /usr/local/lib/ruby/gems/1.9.1/gems/passenger-3.0.0.pre4 PassengerRuby /usr/local/bin/ruby PassengerLogLevel 2 and all I get is a 403 forbidden or the directory listing if I enable Indexes. I dont know what else to do! Yikes. There's nothing in the Apache error log that I can see. The new server admin isnt much help as I think he's a bit junior and says he doesnt know about Rails... sigh :/ I'm a programmer and server admin isnt my bag :(

  Read the article

• Can I have a single solid state drive and a RAID array on the same machine?

  - by jaminto

  Hi- To summarize, i'm looking to use a single solid state drive as my primary drive, and two conventional sata drives in a RAID 1 configuration for data. I am trying to install 64-bit Windows 7 onto this configuration. Is this possible? Here are the details: I built a desktop that has been running 64-bit Vista on two 500Gb in a RAID 1 array for a few years. I just purchased an Intel X25-M 80Gb Sata Solid-State Drive, and was planning on using this a my primary drive, and keeping the RAID 1 array as my data drive. I added the SSD drive and in the RAID setup, configured it as a RAID 0 array of only one disk. Then, I tried to do a clean install of windows 7 64-bit, but got stuck in the "Missing driver for CD/DVD drive" black hole of selecting driver files and Windows telling me that i don't have the appropriate driver for my hardware. The missing hardware is NOT a CD/DVD drive, since i'm installing off of my only CD/DVD drive. Plus at one point i was able to point it at a driver for my raid controller, and then my hard drives magically showed up as browsable sources for finding drivers for some other unnamed device that setup couldn't recognize. After a few hours of trying drivers (this was a very slow process) i decided to reboot and look at the BIOS settings. I'm using an ASUS M2A-VM motherboard which has an ATI SB600 RAID controller on board. I switched the "On board SATA Type" setting from "SATA" to "AHCI" thinking that since AHCI is an Intel thing, this would help. Unfortunately, this abandoned my RAID configuration, and my previously mirrored drives are showing up as separate drives when i boot into my current windows installation. Am i trying to do the impossible here? Should i just buy a separate SATA/RAID PCI card and plug the SSD into that? Any help would be greatly appreciated.

  Read the article

• Event Log: atapi - the device did not respond within the timeout period - Freeze

  - by rjlopes

  Hi, I have a Windows Server 2003 that stops working randomly (displays image on monitor but is completely frozen), all I could found on the event log as causes were an error from atapi and a warning from msas2k3. The event log entries are: Event Type: Error Event Source: atapi Event Category: None Event ID: 9 Date: 22-07-2009 Time: 16:13:33 User: N/A Computer: SERVER Description: The device, \Device\Ide\IdePort0, did not respond within the timeout period. For more information, see Help and Support Center at http : // go.microsoft.com / fwlink / events.asp. Data: 0000: 0f 00 10 00 01 00 64 00 ......d. 0008: 00 00 00 00 09 00 04 c0 .......À 0010: 01 01 00 50 00 00 00 00 ...P.... 0018: f8 06 20 00 00 00 00 00 ø. ..... 0020: 00 00 00 00 00 00 00 00 ........ 0028: 00 00 00 00 01 00 00 00 ........ 0030: 00 00 00 00 07 00 00 00 ........ Event Type: Warning Event Source: msas2k3 Event Category: None Event ID: 129 Date: 22-07-2009 Time: 16:14:23 User: N/A Computer: SERVER Description: Reset to device, \Device\RaidPort0, was issued. For more information, see Help and Support Center at http : // go.microsoft.com / fwlink / events.asp. Data: 0000: 0f 00 10 00 01 00 68 00 ......h. 0008: 00 00 00 00 81 00 04 80 ......? 0010: 04 00 00 00 00 00 00 00 ........ 0018: 00 00 00 00 00 00 00 00 ........ 0020: 00 00 00 00 00 00 00 00 ........ 0028: 00 00 00 00 00 00 00 00 ........ 0030: 01 00 00 00 81 00 04 80 ......? Any hints?

  Read the article

• Troubleshooting wireless connection problem / site survey?

  - by johnnyb10

  I just started in the IT department of a small company (200 users) and it's clear that one of the main problems that is driving everyone crazy is the spotty nature of the wireless connectivity throughout the office, particularly in certain conference rooms. This is a huge problem because the connection often drops during important presentations to clients. I was hired to help ease the load on the existing IT admin, who has done a great job, but is overloaded with many other tasks to deal with. So I would like to try to help out with this wireless issue. I am looking for advice on the best way to solve this problem--a realistic troubleshooting methodology that does not require me to spend any money. So far, I've experimented with Ekahau Heat Mapper, which is free and helps create a site survey. But I'm not exactly sure what I'm looking for or if there are other programs/tools/methods I should try as well. Any advice would be greatly appreciated. [Some background: The wireless setup consists of an HP ProCurve Mobility MSM (710?) controller that controls 10 access points throughout the building. There are three virtual wireless networks configured on the controller: one seems to be a default that cannot be changed, one is for internal employees and authenticates via Active Directory, and the third is a guest network for visitors. When I use HeatMapper, these show up as three different SSIDs, with different MAC addresses, all on the same channel. At first I thought maybe this would cause interference, but this seems to be the way the controller works;apparently, it automatically configures the channels to avoid interference from the other APs on the network.]

  Read the article

• Visual Studio 2005 won't install on Windows 7

  - by Peanut

  Hi, My question relates very closely to this question: http://superuser.com/questions/34190/visual-studio-2005-sp1-refuses-to-install-in-windows-7 However this question hasn't provided the answer I'm looking for. I'm trying to install Visual Studio 2005 onto a clean Windows 7 (64 bit) box. However I keep getting the following error when the 'Microsoft Visual Studio 2005' component finishes installing ... Error 1935.An error occurred during the installation of assembly 'policy.8.0.Microsoft.VC80.OpenMP,type="win32-policy",version="8.0.50727.42",publicKeyToken="1fc8b3b9a1e18e3b",processorArchitecture="x86",Please refer to Help and Support for more information. HRESULT: 0x80073712. On my first attempt to install VS 2005 I got a warning about compatibility issues. I stopped at this point, downloaded the necessary service packs and restarted the installation from the beginning. Every since then I just get the error message above. I keep rolling back the installation and trying again ... it's but always the same error. Any help would be very much appreciated. Thanks.

  Read the article

• MMC crashes on Windows Server 2008 x64 - Exchange console, event viewer

  - by David M Williams

  Help! I don't know what happened; this server has been very reliable but suddenly began having problems with a particular .NET 2.0 web site simply hanging - it wouldn't load at all. However, another ASP.NET site was still fine. Reinstalling the site didn't fix it, nor did deleting and re-creating the application within IIS. Trying the event viewer was met with a horrifying "Microsoft Management Console has stopped working". Some Googling led me to believe the .NET framework was the problem. I found a tool called the .NET cleanup tool - http://blogs.msdn.com/astebner/pages/8904493.aspx - which cleaned out .NET entirely. I reinstalled .NET 1.1 and 3.5 (which installed 2.0 and 3.0 as well). Using the .NET verification tool - http://blogs.msdn.com/astebner/pages/8999004.aspx - I believe these have all installed ok. However, my server is in worse shape now. The Exchange 2010 Management Console crashes with an MMC error and now my other (previously reliable) .NET web app now hangs on loading too. I thought I should use Computer Management to remove and re-add the application and web server roles but sure enough, MMC crashes. If anyone can help I will be extremely grateful. Thank you !

  Read the article

• MacPorts pHash not showing up in Python

  - by Nitzan Wilnai

  I am having a problem where python does not show pHash installed even though I installed it using macports. I made sure I am using the MacPorts version of Python by doing: sudo port select --set python python27 I then installed pHash by doing: sudo port install pHash. It installed without any errors. When I call help('modules'), I do not see pHash listed among the installed packages. Any ideas on why python is not seeing the pHash install by MacPorts? Calling port select --list python shows the following: Available versions for python: none python25-apple python26-apple python27 (active) python27-apple Printing out sys.path outputs the following: (reformatted to make it easier to read here) ['/Library/Python/2.7/site-packages/boto-2.9.9-py2.7.egg', '/Library/Python/2.7/site-packages/setuptools-0.9.8-py2.7.egg', '/Library/Python/2.7/site-packages/pip-1.4.1-py2.7.egg', '/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python27.zip', '/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7', '/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/plat-darwin', '/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/plat-mac', '/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/plat-mac/lib-scriptpackages', '/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/lib-tk', '/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/lib-old', '/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/lib-dynload', '/opt/local/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages', '/Library/Python/2.7/site-packages'] Can anyone help? Thanks.

  Read the article

• Apache is sending php files to my browser instead of parsing

  - by justen doherty

  I have to set up PHP on an existing web host. I have made a virtual host entry, but for some reason Apache is sending the PHP to the browser instead of parsing.. from googling around it looks like it's a problem with the mimetypes, but I'm not an Apache expert by any means, so if anyone could help it would be appreciated... I have the following in my httpd.conf: AddHandler php5-script php DirectoryIndex index.html index.phtml index.php index.phps AddType application/x-httpd-php .phtml AddType application/x-httpd-php .php AddType application/x-httpd-php-source .phps The PHP module is loaded into Apache: /usr/sbin/apachectl -M Loaded Modules: core_module (static) mpm_prefork_module (static) http_module (static) so_module (static) auth_basic_module (shared) auth_digest_module (shared) authn_file_module (shared) authn_alias_module (shared) authn_anon_module (shared) authn_dbm_module (shared) authn_default_module (shared) authz_host_module (shared) authz_user_module (shared) authz_owner_module (shared) authz_groupfile_module (shared) authz_dbm_module (shared) authz_default_module (shared) ldap_module (shared) authnz_ldap_module (shared) include_module (shared) log_config_module (shared) logio_module (shared) env_module (shared) ext_filter_module (shared) mime_magic_module (shared) expires_module (shared) deflate_module (shared) headers_module (shared) usertrack_module (shared) setenvif_module (shared) mime_module (shared) dav_module (shared) status_module (shared) autoindex_module (shared) info_module (shared) dav_fs_module (shared) vhost_alias_module (shared) negotiation_module (shared) dir_module (shared) actions_module (shared) speling_module (shared) userdir_module (shared) alias_module (shared) rewrite_module (shared) proxy_module (shared) proxy_balancer_module (shared) proxy_ftp_module (shared) proxy_http_module (shared) proxy_connect_module (shared) cache_module (shared) suexec_module (shared) disk_cache_module (shared) file_cache_module (shared) mem_cache_module (shared) cgi_module (shared) version_module (shared) fcgid_module (shared) perl_module (shared) php5_module (shared) proxy_ajp_module (shared) ssl_module (shared) And this is my virtual host entry: <VirtualHost 10.16.140.113:80> ServerName viridor-cms.co.uk ServerAlias www.viridor-cms.co.uk UseCanonicalName Off DocumentRoot /var/www/vhosts/viridor-cms.co.uk/httpdocs CustomLog /var/www/vhosts/viridor-cms.co.uk/cms-access_log common ErrorLog /var/www/vhosts/viridor-cms.co.uk/cms-error_log DirectoryIndex index.php index.html <IfModule sapi_apache2.c> php_admin_flag engine on php_admin_flag safe_mode on </IfModule> <IfModule mod_php5.c> php_admin_flag engine on php_admin_flag safe_mode on </IfModule> AddType application/x-httpd-php .php AddType application/x-httpd-php-source .phps </VirtualHost> Please help, my head is so sore from banging it against the table and the wall!

  Read the article

• SQL Server Instance login issue

  - by reallyJim

  I've just brought up a new installation of SQL Server 2008. I installed the default instance as well as one named instance. I'm having a problem connecting to the named instance from anywhere besides the server itself with any user besides 'sa'. I am running in mixed mode. I have a login/user that has a known username. Using that user/login, I can properly connect when directly on the server. When I attempt to login from anywhere else, I recieve a "Login failed for user ''", with Error 18456. In the log file in the server, I see a reason that doesn't seem to help: "Reason: Could not find a login matching the name provided.". However, that user/login DOES exist, as I can use it locally. There are no further details about the error. Where can I start to find something to help me with this? I've tried deleting and recreating the user, as well as just creating a new one from scratch--same result, locally fine, remotely an error. EDIT: Partially Resolved. I'm now passed the base issue--the clients were trying to connect via the default instance. I don't know why. So, once proper ports were opened in the firewall, and a static port assigned to the named instance, I can now connect--BUT ONLY if I specify the connection as Server,Port. SQLBrowser is apparently not helping/working in this case. I've verified it IS running, and done a stop/restart after my config changes, but no difference yet.

  Read the article

< Previous Page | 697 698 699 700 701 702 703 704 705 706 707 708  | Next Page >