Search Results

Search found 18803 results on 753 pages for 'c link'.

Page 706/753 | < Previous Page | 702 703 704 705 706 707 708 709 710 711 712 713  | Next Page >

  • Converting Multiple files to zip and saving them in ownCloud

    - by user1055380
    I wanted to convert an array with some css, js and html files into a zip file and save them in ownCloud (it has it's own framework but it's knowledge is not required.) What I am saving is an infinite loop of zip files, as in, a zip inside a zip so I can't even check that the code is working correctly or not. Please help. Here is the link to the code. <?php /* creates a compressed zip file */ $filename = $_GET["filename"]; function create_zip($files = array(),$destination = '',$overwrite = false) { //if the zip file already exists and overwrite is false, return false if(file_exists($destination) && !$overwrite) { return false; } //vars $valid_files = array(); //if files were passed in... if(is_array($files)) { //cycle through each file foreach($files as $file => $local) { //make sure the file exists if(file_exists($file)) { $valid_files[$file] = $local; } } } //if we have good files... if(count($valid_files)) { //create the archive $zip = new ZipArchive(); if($zip->open($destination,$overwrite ? ZIPARCHIVE::OVERWRITE : ZIPARCHIVE::CREATE) !== true) { return false; } //add the files foreach($valid_files as $file => $local) { $zip->addFile($file, $local); } //debug //echo 'The zip archive contains ',$zip->numFiles,' files with a status of ',$zip->status; //close the zip -- done! $zip->close(); //check to make sure the file exists return file_exists($destination); } else { return false; } } $files_to_zip = array( 'apps/impressionist/css/mappingstyle.css' => '/css/mappingstyle.css', 'apps/impressionist/css/style.css' => '/css/style.css', 'apps/impressionist/js/jquery.js' => '/scripts/jquery.js', 'apps/impressionist/js/impress.js' => '/scripts/impress.js', realpath('apps/impressionist/output/'.$filename.'.html') => $filename.'.html' ); //if true, good; if false, zip creation failed $result = create_zip($files_to_zip, $filename.'.zip'); $save_file = OC_App::getStorage('impressionist'); $save_file ->file_put_contents($filename.'.zip',$files_to_zip); ?>

    Read the article

  • Ie7 float problems and hiperlinks not clickable

    - by Uffo
    Markup <ul class="navigation clearfix"> <li class="navigation-top"></li> <div class="first-holder" style="height:153px;"> <dl class="hold-items clearfix"> <dd class="clearfix with"><a href="http://site.com" title="Protokoll">Protokoll</a></dd> <dd class="with-hover"><a href="http://site.com" title="Mein/e Unternehmen">Mein/e Unternehmen</a></dd> <dd class="with"><a class="face-me" href="http://site.com" title="Erweiterte Suche">Erweiterte Suche</a></dd> <dd class="with"><a href="http://site.com" title="Abmelden">Abmelden</a></dd> </dl> </div><!--[end] /.first-holder--> <li class="navigation-bottom"></li> </ul><!--[end] /.navigation--> Css: .first-holder{height:304px;position:relative;width:178px;overflow:hidden;margin-bottom:0px;padding-bottom: 0px;} .hold-items{top:0px;position:absolute;} .navigation dd.with{line-height:38px;background:url('/images/sprite.png') no-repeat -334px -46px;width:162px;height:38px;padding-bottom:0px;overflow: hidden;} .navigation dd.with a{position:relative;outline:0;display:block;font-weight:bold;color:#3f78c0;padding-left:10px;line-height:38px;} .with-hover{background:url('/images/sprite.png') no-repeat -505px -47px;width:178px;height:38px;line-height:38px;overflow:none;} .with-hover a{position:relative;display:block;font-weight:bold;color:#fff;padding-left:10px} .navigation-top{background:url('/images/sprite.png') no-repeat -694px -46px;width:160px;height:36px;} .navigation-top a{display:block;outline:0;height:20px;padding-top:18px;padding-left:138px;} .navigation-top a span{display:block;background:url('/images/sprite.png') no-repeat -212px -65px;width:8px;height:6px;} .navigation-bottom{background:url('/images/sprite.png') no-repeat -784px -402px;width:160px;height:37px;} .navigation-bottom a{display:block;outline:0;height:20px;padding-top:18px;padding-left:138px;} .navigation-bottom a span{display:block;background:url('/images/sprite.png') no-repeat -212px -74px;width:8px;height:6px;} Also the links, are not clickable, if I click on a link in IE7 it doesn't do the action..it doesn't redirect me to the location. This is how it looks in IE7: http://screencast.com/t/MGY4NjljZjc This is how it look in IE8,Firefox,Chrome and so on http://screencast.com/t/MzhhMDQ1M What I'm doing wrong PS: .navigation-top a span and .navigation-bottom a span I'm using some where else, but that it's ok it works fine.

    Read the article

  • Trying to filter a ListView with runQueryOnBackgroundThread but nothing happens - what am I missing?

    - by Ian Leslie
    I have a list of countries in a database. I have created a select country activity that consists of a edit box for filtering and a list which displays the flag and country name. When the activity starts the list shows the entire list of countries sorted alphabetically - works fine. When the customer starts typing into the search box I want the list to be filtered based on their typing. My database query was previously working in an AutoCompleteView (I just want to switch to a separate text box and list) so I know my full query and my constraint query are working. What I did was add a TextWatcher to the EditText view and every time the text is changed I invoke the list's SimpleCursorAdapter runQueryOnBackgroundThread with the edit boxes text as the constraint. The trouble is the list is never updated. I have set breakpoints in the debugger and the TextWatcher does make the call to runQueryOnBackgroundThread and my FilterQueryProvider is called with the expected constraint. The database query goes fine and the cursor is returned. The cursor adapter has a filter query provider set (and a view binder to display the flag): SimpleCursorAdapter adapter = new SimpleCursorAdapter (this, R.layout.country_list_row, countryCursor, from, to); adapter.setFilterQueryProvider (new CountryFilterProvider ()); adapter.setViewBinder (new FlagViewBinder ()); The FitlerQueryProvider: private final class CountryFilterProvider implements FilterQueryProvider { @Override public Cursor runQuery (CharSequence constraint) { Cursor countryCursor = myDbHelper.getCountryList (constraint); startManagingCursor (countryCursor); return countryCursor; } } And the EditText has a TextWatcher: myCountrySearchText = (EditText)findViewById (R.id.entry); myCountrySearchText.setHint (R.string.country_hint); myCountrySearchText.addTextChangedListener (new TextWatcher() { @Override public void afterTextChanged (Editable s) { SimpleCursorAdapter filterAdapter = (SimpleCursorAdapter)myCountryList.getAdapter (); filterAdapter.runQueryOnBackgroundThread (s.toString ()); } @Override public void onTextChanged (CharSequence s, int start, int before, int count) { // no work to do } @Override public void beforeTextChanged (CharSequence s, int start, int count, int after) { // no work to do } }); The query for the database looks like this: public Cursor getCountryList (CharSequence constraint) { if (constraint == null || constraint.length () == 0) { // Return the full list of countries return myDataBase.query (DATABASE_COUNTRY_TABLE, new String[] { KEY_ROWID, KEY_COUNTRYNAME, KEY_COUNTRYCODE }, null, null, null, null, KEY_COUNTRYNAME); } else { // Return a list of countries who's name contains the passed in constraint return myDataBase.query (DATABASE_COUNTRY_TABLE, new String[] { KEY_ROWID, KEY_COUNTRYNAME, KEY_COUNTRYCODE }, "Country like '%" + constraint.toString () + "%'", null, null, null, "CASE WHEN Country like '" + constraint.toString () + "%' THEN 0 ELSE 1 END, Country"); } } It just seems like there is a missing link somewhere. Any help would be appreciated. Thanks, Ian

    Read the article

  • Tag Cloud JS + Flash. Actual Tags In Cloud Not Clickable?

    - by Alex
    Hello all, I've implemented a tag cloud on a site of mine, and I'm using a JS script to populate it, but for some reason, the actual text in the tag cloud is not clickable. It displays and works correctly, but the actual text of the cloud is not getting treated as a link for some odd reason. My question is: In my script below, do you see anything that I need to fix in order to make my tag cloud's text actually be links? The site I've implemented it on is a stackexhange site that I run, it is supposed to be a cloud of the "recent tags." CloudPopulator.js <script type="text/javascript"> var divRecentTags = document.getElementById("recent-tags"); if (divRecentTags) { var cloud = new SWFObject("some/swfObject/url", "tagcloudflash", "200", "200", "9", "#ffffff"); cloud.addParam("allowScriptAccess", "always"); cloud.addVariable("tcolor", "0x0a94d6"); cloud.addVariable("tcolor2", "0xC0C0C0"); cloud.addVariable("hicolor", "0x000000"); cloud.addVariable("tspeed", "150"); cloud.addVariable("distr", "true"); cloud.addVariable("mode", "tags"); var aTags = divRecentTags.getElementsByTagName("a"); var tagHtml = ""; for(var i = 0; i < aTags.length; i++) { var hrefText = aTags[i].getAttribute("href"); var cssText = aTags[i].className; var tagName = $(aTags[i]).text(); var styleText = "style=\'font-size: 8pt;\'"; if (cssText == "post-tag pop1") { var styleText = "style=\'font-size: 15pt;\'"; } else if (cssText == "post-tag pop2") { var styleText = "style=\'font-size: 22pt;\'"; } var newLinkText = "<a href=\'"+hrefText+"\'"+styleText+">"+tagName+"</a>"; tagHtml = tagHtml + newLinkText; } cloud.addVariable("tagcloud", escape("<tags>" + tagHtml + "</tags>")); cloud.write("recent-tags"); } </script>

    Read the article

  • Regular expression to convert ul to textindent and back, with a different attribute value for first

    - by chapmanio
    Hi, This is a related to a previous question I have asked here, see the link below for a brief description as to why I am trying to do this. Regular expression from font to span (size and colour) and back (VB.NET) Basically I need a regex replace function (or if this can be done in pure VB then that's fine) to convert all ul tags in a string to textindent tags, with a different attribute value for the first textindent tag. For example: <ul> <li>This is some text</li> <li>This is some more text</li> <li> <ul> <li>This is some indented text</li> <li>This is some more text</li> </ul> </li> <li>More text!</li> <li> <ul> <li>This is some indented text</li> <li>This is some more text</li> </ul> </li> <li>More text!</li> </ul> Will become: <textformat indent="0"> <li>This is some text</li> <li>This is some more text</li> <li> <textformat indent="20"> <li>This is some indented text</li> <li>This is some more text</li> </textformat> </li> <li>More text!</li> <li> <textformat indent="20"> <li>This is some indented text</li> <li>This is some more text</li> </textformat> </li> <li>More text!</li> </textformat> Basically I want the first ul tag to have no indenting, but all nested ul tags to have an indent of 20. I appreciate this is a strange request but hopefully that makes sense, please let me know if you have any questions. Thanks in advance.

    Read the article

  • NHibernate Many to Many delete all my data in the table

    - by Daoming Yang
    I would love to thank @Stefan Steinegger and @David helped me out yesterday with many-to-many mapping. I have 3 tables which are "News", "Tags" and "News_Tags" with Many-To-Many relationship and the "News_Tags" is the link table. If I delete one of the news records, the following mappings will delete all my news records which have the same tags. One thing I need to notice, I only allowed unique tag stored in the "Tag" table. This mapping make sense for me, it will delete the tag and related News records, but how can I implement a tagging system with NHibernate? Can anyone give me some suggestion? Many thanks. Daoming. News Mapping: <class name="New" table="News" lazy="false"> <id name="NewID"> <generator class="identity" /> </id> <property name="Title" type="String"></property> <property name="Description" type="String"></property> <set name="TagsList" table="New_Tags" lazy="false" inverse="true" cascade="all"> <key column="NewID" /> <many-to-many class="Tag" column="TagID" /> </set> </class> Tag Mapping: <class name="Tag" table="Tags" lazy="false"> <id name="TagID"> <generator class="identity" /> </id> <property name="TagName" type="String"></property> <property name="DateCreated" type="DateTime"></property> <!--inverse="true" has been defined in the "News mapping"--> <set name="NewsList" table="New_Tags" lazy="false" cascade="all"> <key column="TagID" /> <many-to-many class="New" column="NewID" /> </set> </class>

    Read the article

  • List of checkboxes

    - by Andrea Girardi
    Hi all, Happy New Year to all. I'm a newbie in VB.NET and ASP.NET. This is my problem: I retrieve a list of records from DB and, for every row, I need to show 4 checkboxes. I can use a checkboxlist for every rows, but it's not so clear how I can process the results after the submit. I've some object and some operations available for that object. From database I extract a list of object with all operations. For every operation I want to show a check box to enable or disable the operation. The result is something like that: OBJ1 - url - [] [x] [] OBJ2 - url - [] [x] [x] On url I've an href to another page created using the Id retrieved from DB. To create that I used this code: <td class="column-filename"> <strong> <asp:Label runat="server" Text='<%#DataBinder.Eval(Container.DataItem, "GroupName")%>'></asp:Label> </strong> </td> <td align="left"> <span style="vertical-align:middle"> <asp:CheckBoxList runat="server" ID="operations" RepeatDirection="Horizontal" RepeatLayout="Table"> <asp:ListItem Text="View"></asp:ListItem> <asp:ListItem Text="Upload"></asp:ListItem> <asp:ListItem Text="Move"></asp:ListItem> <asp:ListItem Text="Delete"></asp:ListItem> <asp:ListItem Text="Rename"></asp:ListItem> <asp:ListItem Text="Replace"></asp:ListItem> </asp:CheckBoxList> </span> </td> </asp> </asp> my problem is: how can I parse all checkboxes? could you help me or send me a link or any other resources to solve my issue? many thanks! Andrea

    Read the article

  • AJAX XML reply node value iteration

    - by XpiritO
    Hi there, guys. I would really appreciate to get your help on this, as I can't seem to detect and solve the problem I'm having with an AJAX functionality on a site that I'm currently developing. I have a webform that makes an asynchronous call to a handler (.ashx) that delivers a XML response that is later processed by a Javascript client-side function that places it's contents into the user-interface. I'm attaching an example of the response generated by my handler, and what I would like to know is how can I get all the <body> element innerHTML (with the text and child nodes) contents to append it to a <span> element on the user-interface. Can anyone help me out with this? XML Response returned by the handler (checked via Firebug): <message> <content> <messageId>2</messageId> <from>Barack Obama</from> <fromMail>[email protected]</fromMail> <subject>Yes, we can... get World Peace</subject> <body>Hello, dear citizen. I'm sending you this message to invite you to join us! <a href="http://www.whitehouse.gov">Test link</a> Thank you for your time.</body> </content> </message> Client-side Javascript function to affect the user-interface innerHTML property with the data returned via AJAX: function GetMessageContentsCallback(args, resp) { //XML Parser try { //Internet Explorer xmlDoc = new ActiveXObject("Microsoft.XMLDOM"); xmlDoc.async = "false"; xmlDoc.loadXML(resp); } catch (e) { parser = new DOMParser(); xmlDoc = parser.parseFromString(resp, "text/xml"); } var msgReply = xmlDoc.getElementsByTagName('message')[0]; var ajaxRespondeBodyInnerHTML = msgReply.getElementsByTagName(body)[0].firstChild.nodeValue; //this currently only delivers inner text content, without the <a href... bit and subsequent text document.getElementById("bodySpan").innerHTML = ajaxRespondeBodyInnerHTML; }

    Read the article

  • How to Load Dependent Files on Demand + Check if They're Loaded or Not?

    - by br4inwash3r
    I'm trying to implement an assets/dependency loader that i've found from an old article at 24Ways.org. most of you might be familiar with it. it's from this article by Christian Heilmann: http://24ways.org/2007/keeping-javascript-dependencies-at-bay i've modified the script to load CSS files as well. and it's now quite close to what i want. but i still need to do some checking to see wether an asset have been completely loaded or not. just wondering if you guys have any ideas :) here's what my script currently looked like: var assetLoader = { assets: { products: { js: 'products.js', css: 'products.css', loaded: false }, articles: { js: 'articles.js', css: 'articles.css', loaded: false }, [...] cycle: { js: 'jquery.cycle.min.js', loaded: false }, swfobject: { js: 'jquery.swfobject.min.js', loaded: false } }, add: function(asset) { var comp = assetLoader.assets[asset]; var path = '/path/to/assets/'; if (comp && comp.loaded == false) { if (comp.js) { // load js var js = document.createElement('script'); js.src = path + 'js/' + comp.js; js.type = 'text/javascript'; js.charset = 'utf-8'; // append to document document.getElementsByTagName('body')[0].appendChild(js); } if (comp.css) { // load css var css = document.createElement('link'); css.rel = 'stylesheet'; css.href = path + 'css/' + comp.css; css.type = 'text/css'; css.media = 'screen, projection'; css.charset = 'utf-8'; // append to document document.getElementsByTagName('head')[0].appendChild(css); } } }, check: function(asset) { assetLoader.assets[asset].loaded = true; } } Christian explains this method in his article in great detail. I don't want to confuse you guys anymore with my bad english :P and here's an example of how i run the script: ... // load jquery cycle plugin if (page=='tvc' || page=='products') { if (!assetLoader.assets.cycle.loaded) { assetLoader.add('cycle'); } } // load products page assets if (!assetLoader.assets.products.loaded) { assetLoader.add('products'); } ... this kind of approach is very problematic though. coz assets loads asynchronously, which means some of the code inside products.js that depends on jquery.cycle.js might continue running before jquery.cycle.js is even loaded resulting in errors. while i'm quite aware that scripts can be attached with an onload event, i'm just not really sure how to implement it to my script. anyone care to help me? please... :P

    Read the article

  • Trying to integrate CakePHP and jQuery

    - by user198003
    Trying to integrate CakePHP and jQuery, using next example http://bakery.cakephp.org/articles/view/dynamic-select-boxes-with-ajax-jquery What I want is to when user change first option element, to automaticly fill second select option box with proper values. But, nothing happens, if you can help me why. So, there is a Invoice add form (add.ctp), with next code... <?php echo $form->create('Invoice');?> <?php echo $javascript->link('jquery.js'); $category = array('1' => 'First', '4' => 'Fourth', '7' => 'Seventh'); echo $form->input('client_id', array('options' => $category, 'empty' => 'Choose:')); echo $form->select('clientBank_id', array("Choose category first"), null, null, false); ?> <script> $("#InvoiceClientId").change(function () { $.post('/invoices/listTitleByCategory/' + $(this).val(), function(data) { $("#InvoiceClientBankId").empty().append(data); }, 'html'); }) </script> Also, there is controller (invoices_controller.php): <?php var $name = 'Invoices'; var $helpers = array('Html', 'Form', 'Time', 'Number', 'Javascript'); var $paginate = array('order' => array('Invoice.pinned DESC', 'Invoice.invoiceNumber')); var $components = array('RequestHandler'); function beforeRender(){ // prevent useless warnings for Ajax if($this->RequestHandler->isAjax()){ Configure::write('debug', 0); } } // etc... function listTitleByCategory($category = "") { $this->layout = 'ajax'; $this->beforeRender(); $this->autoRender = false; $data = $this->Invoice->Client->find('list'); echo "<option value=0>just for testing...</option>"; foreach($data as $key => $val) { echo "<option value=$key>$val</option>"; } } ?> Please, if you can help me solving this. Thank you in advance!

    Read the article

  • Can this be imporved? Scrubing of dangerous html tags.

    - by chobo2
    Hi I been finding that for something that I consider pretty import there is very little information or libraries on how to deal with this problem. I found this while searching. I really don't know all the million ways that a hacker could try to insert the dangerous tags. I have a rich html editor so I need to keep non dangerous tags but strip out bad ones. So is this script missing anything? It uses html agility pack. public string ScrubHTML(string html) { HtmlDocument doc = new HtmlDocument(); doc.LoadHtml(html); //Remove potentially harmful elements HtmlNodeCollection nc = doc.DocumentNode.SelectNodes("//script|//link|//iframe|//frameset|//frame|//applet|//object|//embed"); if (nc != null) { foreach (HtmlNode node in nc) { node.ParentNode.RemoveChild(node, false); } } //remove hrefs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("href", "#"); } } //remove img with refs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("src", "#"); } } //remove on<Event> handlers from all tags nc = doc.DocumentNode.SelectNodes("//*[@onclick or @onmouseover or @onfocus or @onblur or @onmouseout or @ondoubleclick or @onload or @onunload]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("onFocus"); node.Attributes.Remove("onBlur"); node.Attributes.Remove("onClick"); node.Attributes.Remove("onMouseOver"); node.Attributes.Remove("onMouseOut"); node.Attributes.Remove("onDoubleClick"); node.Attributes.Remove("onLoad"); node.Attributes.Remove("onUnload"); } } // remove any style attributes that contain the word expression (IE evaluates this as script) nc = doc.DocumentNode.SelectNodes("//*[contains(translate(@style, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'expression')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("stYle"); } } return doc.DocumentNode.WriteTo(); }

    Read the article

  • xml append issue in ie,chrome

    - by 3gwebtrain
    Hi, I am creating a html page, using xml data. in which i am using the following function. It works fine with firefox,opera,safari. but in case of ie7,ie8, and chrome the data what i am getting from xml, is not appending properly. any one help me to solve this issue? in case any special thing need to concentrate on append funcation as well let me know.. $(function(){ var thisPage; var parentPage; $('ul.left-navi li a').each(function(){ $('ul.left-navi li a').removeClass('current'); var pathname = (window.location.pathname.match(/[^\/]+$/)[0]); var currentPage = $(this).attr('href'); var pathArr = new Array(); pathArr = pathname.split("."); var file = pathArr[pathArr.length - 2]; thisPage = file; if(currentPage==pathname){ $(this).addClass("active"); } }) $.get('career-utility.xml',function(myData){ var myXml = $(myData).find(thisPage); parentPage = thisPage; var overviewTitle = myXml.find('overview').attr('title'); var description = myXml.find('discription').text(); var mainsublinkTitle = myXml.find('mainsublink').attr('title'); var thisTitle = myXml.find("intro").attr('title'); var thisIntro = myXml.find("introinfo").text(); $('<h3>'+overviewTitle+'</h3>').appendTo('.overViewInfo'); $('<p>'+description+'</p>').appendTo('.overViewInfo'); var sublinks = myXml.find('mainsublink').children('sublink'); $('#intro h3').append(thisTitle); $('#intro').append(thisIntro); sublinks.each(function(numsub){ var newSubLink = $(this); var sublinkPage = $(this).attr('pageto'); var linkInfo = $(this).text(); $('ul.career-link').append('<li><a href="'+sublinkPage+'">'+linkInfo+'</a></li>'); }) $(myXml).find('listgroup').each(function(index){ var count = index; var listGroup = $(this); var listGroupTitle = $(this).attr('title'); var shortNote = $(this).attr('shortnote'); var subLink = $(this).find('sublist'); var firstList = $(this).find('list'); $('.grouplist').append('<div class="list-group"><h3>'+listGroupTitle+'</h3><ul class="level-one level' + count + '"></ul></div>'); firstList.each(function(listnum) { $(this).wrapInner('<li>') .find('sublistgroup').wrapInner('<ul>').children().unwrap() .find('sublist').wrapInner('<li>').children().unwrap(); $('ul.level'+count).append($(this).children()); }); }); }); }) Thanks for advance..

    Read the article

  • Can this be improved? Scrubing of dangerous html tags.

    - by chobo2
    I been finding that for something that I consider pretty import there is very little information or libraries on how to deal with this problem. I found this while searching. I really don't know all the million ways that a hacker could try to insert the dangerous tags. I have a rich html editor so I need to keep non dangerous tags but strip out bad ones. So is this script missing anything? It uses html agility pack. public string ScrubHTML(string html) { HtmlDocument doc = new HtmlDocument(); doc.LoadHtml(html); //Remove potentially harmful elements HtmlNodeCollection nc = doc.DocumentNode.SelectNodes("//script|//link|//iframe|//frameset|//frame|//applet|//object|//embed"); if (nc != null) { foreach (HtmlNode node in nc) { node.ParentNode.RemoveChild(node, false); } } //remove hrefs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("href", "#"); } } //remove img with refs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("src", "#"); } } //remove on<Event> handlers from all tags nc = doc.DocumentNode.SelectNodes("//*[@onclick or @onmouseover or @onfocus or @onblur or @onmouseout or @ondoubleclick or @onload or @onunload]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("onFocus"); node.Attributes.Remove("onBlur"); node.Attributes.Remove("onClick"); node.Attributes.Remove("onMouseOver"); node.Attributes.Remove("onMouseOut"); node.Attributes.Remove("onDoubleClick"); node.Attributes.Remove("onLoad"); node.Attributes.Remove("onUnload"); } } // remove any style attributes that contain the word expression (IE evaluates this as script) nc = doc.DocumentNode.SelectNodes("//*[contains(translate(@style, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'expression')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("stYle"); } } return doc.DocumentNode.WriteTo(); }

    Read the article

  • Sliding panel in the middle of the page. Z-index given not working

    - by Nehal Rupani
    Hi all, I am implementing sliding panel element but problem is when i slide out other div element is floating down. I guess and tried to give z-index to element which i am sliding but it doesn't seems to work. Let me put code for both div. <div class="vrcontrol"> <div class="slide-out-div"> <a class="handle" href="http://link-for-non-js-users.html">Content</a> <h3>Contact me</h3> <p>Thanks for checking out my jQuery plugin, I hope you find this useful. </p> <p>This can be a form to submit feedback, or contact info</p> </div> This is div which i am sliding in and out and beneath is code of effective div. <div class="askform"> <p class="titletext">Ask an Expert Trade Forum</p> <p class="detailtext">WD-40’s leading source for DIY tips and tricks.</p> <span> <form id="askform" name="askform" action="" method="post"> <span class="left"><input name="input" type="text" class="askinputbox"/></span><span class="marginleft"><input type="image" src="images/search_icon.gif" /></span> </form> </span> <div class="followus"> <span class="followtext">Follow us on</span><span class="right"><img src="images/bookmark.jpg" width="121" height="45" alt="Bookmark" /></span> </div> </div> Sliding div is in left portion of the page and effective div is in right portion of the page. I guess something with z-index, positioning element and overflow properties will do something.

    Read the article

  • session management: problem displaying username in the header

    - by aeonsleo
    hi, I am working on a simple login and logout module for my website without any security. I am using wamp on a windows xp machine. I am creating session when a user submits the login informaton it redirects to a process.php file which creates the session variables and starts session. Now if the login is successful user is redirected to the welcome page which includes a header file(which displays the header involving signin logout help options) The problem is the header is not changing the signin link to logout as the user logs successfully. The below code is from process.php which initiates a login. $username = $_POST['username']; $password = $_POST['password']; //echo "{$username}:{$password}"; $connection = mysql_connect("localhost","root",""); if(!$connection) { die("Database Connection Failed".mysql_error()); } $db_select = mysql_select_db("tester",$connection); if(!$db_select) { die("Database Selection Failed".mysql_error()); } $result = mysql_query("SELECT * FROM user",$connection); if(!$result) { die("Database Selection Failed".mysql_error()); } $q = "SELECT * FROM user " ."WHERE Name='".$username."' AND Password='".$password. "' "; // Run query $r = mysql_query($q); if ( $obj = @mysql_fetch_object($r) ) { session_start(); // Login good, create session variables $_SESSION["valid_id"] = session_id(); $_SESSION["valid_user"] = $_POST["username"]; $_SESSION["valid_time"] = time(); Header('Location: welcome.php'); The following code is from header.php which is included in welcome.php </div> <div id = "userdetail"> <?php if(isset($_SESSION["valid_user"])) { echo($_SESSION["valid_user"]." " ); echo("<a href=logout.php>Logout</a>"); } else { echo("<a href = login.php>Sign In</a>"); } ?> | Help | Search <input type = "text" name = "searchbox" value = "" /> </div> </div>

    Read the article

  • Problem Fetching JSON Result with jQuery in Firefox and Chrome (IE8 Works)

    - by senfo
    I'm attempting to parse JSON using jQuery and I'm running into issues. Using the code below, the data keeps coming back null: <!DOCTYPE html> <html> <head> <title>JSON Test</title> </head> <body> <div id="msg"></div> <script src="http://code.jquery.com/jquery-latest.js"></script> <script> $.ajax({ url: 'http://datawarehouse.hrsa.gov/ReleaseTest/HGDWDataWebService/HGDWDataService.aspx?service=HC&zip=20002&radius=10&filter=8357&format=JSON', type: 'GET', dataType: 'json', success: function(data) { $('#msg').html(data[0].title); // Always null in Firefox/Chrome. Works in IE8. }, error: function(data) { alert(data); } }); </script> </body> </html> The JSON results look like the following: {"title":"HEALTHPOINT TYEE CAMPUS","link":"http://www.healthpointchc.org","id":"tag:datawarehouse.hrsa.gov,2010-04-29:/8357","org":"HEALTHPOINT TYEE CAMPUS","address":{"street-address":"4424 S. 188TH St.","locality":"Seatac","region":"Washington","postal-code":"98188-5028"},"tel":"206-444-7746","category":"Service Delivery Site","location":"47.4344818181818 -122.277672727273","update":"2010-04-28T00:00:00-05:00"} If I replace my URL with the Flickr API URL (http://api.flickr.com/services/feeds/photos_public.gne?tags=cat&tagmode=any&format=json&jsoncallback=?), I get back a valid JSON result that I am able to make use of. I have successfully validated my JSON at JSONLint, so I've run out of ideas as to what I might be doing wrong. Any thoughts? Update: I had the client switch the content type to application/json. Unfortunately, I'm still experiencing the exact same problem. I also updated my HTML and included the live URL I've been working with. Update 2: I just gave this a try in IE8 and it works fine. For some reason, it doesn't work in either Firefox 3.6.3 or Chrome 4.1.249.1064 (45376). I did notice a mistake with the data being returned (the developer is returning a collection of data, even for queries that will always return a single record), but it still baffles me why it doesn't work in other browsers. It might be important to note that I am working from an HTML file on my local file system. I thought it might be a XSS issue, but that doesn't explain why Flickr works.

    Read the article

  • Route Angular to New Controller after Login

    - by MizAkita
    I'm kind of stuck on how to route my angular app to a new controller after login. I have a simple app, that uses 'loginservice'... after logging in, it then routes to /home which has a different template from the index.html(login page). I want to use /home as the route that displays the partial views of my flightforms controllers. What is the best way to configure my routes so that after login, /home is the default and the routes are called into that particular templates view. Seems easy but I keep getting the /login page when i click on a link which is suppose to pass the partial view into the default.html template: var app= angular.module('myApp', ['ngRoute']); app.config(['$routeProvider', function($routeProvider) { $routeProvider.when('/login', { templateUrl: 'partials/login.html', controller: 'loginCtrl' }); $routeProvider.when('/home', { templateUrl: 'partials/default.html', controller: 'defaultCtrl' }); }]); flightforms.config(['$routeProvider', function($routeProvider){ //sub pages $routeProvider.when('/home', { templateUrl: 'partials/default.html', controller: 'defaultCtrl' }); $routeProvider.when('/status', { templateUrl: 'partials/subpages/home.html', controller: 'statusCtrl' }); $routeProvider.when('/observer-ao', { templateUrl: 'partials/subpages/aobsrv.html', controller: 'obsvaoCtrl' }); $routeProvider.when('/dispatch', { templateUrl: 'partials/subpages/disp.html', controller: 'dispatchCtrl' }); $routeProvider.when('/fieldmgr', { templateUrl: 'partials/subpages/fieldopmgr.html', controller: 'fieldmgrCtrl' }); $routeProvider.when('/obs-backoffice', { templateUrl: 'partials/subpages/obsbkoff.html', controller: 'obsbkoffCtrl' }); $routeProvider.when('/add-user', { templateUrl: 'partials/subpages/users.html', controller: 'userCtrl' }); $routeProvider.otherwise({ redirectTo: '/status' }); }]); app.run(function($rootScope, $location, loginService) { var routespermission=['/home']; //route that require login $rootScope.$on('$routeChangeStart', function(){ if( routespermission.indexOf($location.path()) !=-1) { var connected=loginService.islogged(); connected.then(function(msg) { if(!msg.data) $location.path('/login'); }); } }); }); and my controllers are simple. Here's a sample of what they look like: var flightformsControllers = angular.module('flightformsController', []); flightforms.controller('fieldmgrCtrl', ['$scope','$http','loginService', function($scope,loginService) { $scope.txt='You are logged in'; $scope.logout=function(){ loginService.logout(); } }]); Any ideas on how to get my partials to display in the /home default.html template would be appreciated.

    Read the article

  • jQuery toggling divs, expand collapse all and keep first item selected when page loads

    - by hollyb
    Hi, I have a question about some functionality I'm trying to add to my jQuery to enable a button or text to expand/contract all the divs on click... and I'd like to figure out how to keep the first div open when the page loads. Here is the jQuery: (document).ready(function(){ //Hides containers on load $(".toggle_container").hide(); //Switch "Open" and "Close" state on click $("h2.trigger").toggle(function(){ $(this).addClass("active"); }, function () { $(this).removeClass("active"); }); //Slide up and down on click $("h2.trigger").click(function(){ $(this).next(".toggle_container").slideToggle("slow"); }); }); And the css: // uses a background image with an on (+) and off (-) state stacked on top of each other h2.trigger { background: url(buttonBG.gif) no-repeat;height: 46px;line-height: 46px;width: 300px;font-size: 2em;font-weight: normal;} h2.trigger a {color: #fff;text-decoration: none; display: block;} h2.active {background-position: left bottom;} .toggle_container { overflow: hidden; } .toggle_container .block {padding: 20px;} And the html <h2 class="trigger"><a href="#">Heading</a></h2> <div class="toggle_container"> <div class="block">Stuff goes here</div> </div> <h2 class="trigger"><a href="#">Heading 2</a></h2> <div class="toggle_container"> <div class="block">Stuff goes here</div> </div> So it works great and looks great. However, when I try to get it to keep the first instance open, the background image that should adjust show the (-) state doesn't change. The code I used to this was: $(".toggle_container:first").show(); So, my question is, does anyone know of an easier way to show the first instance of this as open without having to created specials rules/class for the first item? Also, any ideas about how to make an open all/close all link? Thanks!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • div "top" bug IE and everything else. Big problem

    - by Victor
    Hi everyone. I am new in CSS so please help me in this problem. I hope to describe it wright. I am making div named content where my site content is. I made it with z-index:-1; so an image to be over this div. But in Chrome, FF and safari, content became inactive. I cant select text , click on link and write in the forms. So I tried with positive states in the z-index but IE don't know what this means. Damn. So I decided to make conditional div. Here is the code: .content { background:#FFF; width:990px; position:relative; float:left; top:50px; } .content_IE { background:#FFF; width:990px; position:relative; float:left; top: 50px; z-index:-1; } and here is the HTML: <!--[if IE 7]> <div class="content_IE" style="height:750px;"> <![endif]--> <div class="content" style="height:550px;"> Everything is fine with the z-index but the problem is that if there is no top in .content class everything looks fine in IE but there is no space in the other browsers. If i put back the top:50px; there onother 50px like padding in the .content_IE class. I mean that the page looks like I've put top:50px; and padding-top=50px;. I've try everything like margin-top:-50px; padding-top:-50px; and stuff like this but I am still in the circle. It look fine only if there is no top option in .content class. Please help.

    Read the article

  • jQuery UI dialog + WebKit + HTML response with script

    - by Anthony Koval'
    Once again I am faced with a great problem! :) So, here is the stuff: on the client side, I have a link. By clicking on it, jQuery makes a request to the server, gets response as HTML content, then popups UI dialog with that content. Here is the code of the request-function: function preview(){ $.ajax({ url: "/api/builder/", type: "post", //dataType: "html", data: {"script_tpl": $("#widget_code").text(), "widgets": $.toJSON(mwidgets), "widx": "0"}, success: function(data){ //console.log(data) $("#previewArea").dialog({ bgiframe: true, autoOpen: false, height: 600, width: 600, modal: true, buttons: { "Cancel": function() { $(this).dialog('destroy'); } } }); //console.log(data.toString()); $('#previewArea').attr("innerHTML", data.toString()); $("#previewArea").dialog("open"); }, error: function(){ console.log("shit happens"); } }) } The response (data) is: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript">var smakly_widget_sid = 0 ,widgets = [{"cols": "2","rows": "2","div_id": "smakly_widget","wid": "0","smakly_style": "small_image",}, ] </script> <script type="text/javascript" src="/media/js/smak/smakme.js"></script> </head> <body> preview <div id="smakly_widget" style="width:560px;height:550px"> </div> </body> </html> As you see, there is a script to load: smakme.js, somehow it doesn't execute in WebKit-based browsers (I tried in Safari and Chrome), but in Firefox, Internet Explorer and Opera it works as expected! Here is that script: String.prototype.format = function(){ var pattern = /\{\d+\}/g; var args = arguments; return this.replace(pattern, function(capture){ return args[capture.match(/\d+/)]; }); } var turl = "/widget" var widgetCtrl = new(function(){ this.render_widget = function (w, content){ $("#" + w.div_id).append(content); } this.build_widgets = function(){ for (var widx in widgets){ var w = widgets[widx], iurl = '{0}?sid={1}&wid={2}&w={3}&h={4}&referer=http://ya.ru&thrash={5}'.format( turl, smakly_widget_sid, w.wid, w.cols, w.rows, Math.floor(Math.random()*1000).toString()), content = $('<iframe src="{0}" width="100%" height="100%"></iframe>'.format(iurl)); this.render_widget(w, content); } } }) $(document).ready(function(){ widgetCtrl.build_widgets(); }) Is that some security issue, or anything else?

    Read the article

  • How do I make a full screen scrolling messagebox or window?

    - by chobo2
    Hi First let me start of saying I know absolutely nothing about c++ and I am really just more interested in getting this to work then learning c++(I got enough on my plate to learn). So basically I am trying to make a terms of service for my windows mobile 6 professional application but it seems I need to use c++ to do it. After hours of searching I found a solution but it developed for windows mobile standard. So they somehow used c++ to make a message box and on standard devices(ie non touch screen phones) the message box can have like scrolling. For some reason this is not the case with professional devices(touch screen devices). So my message box goes off the page and you can never accept or decline the terms. So your stuck and on the screen forever till you do some sort of soft restart. http://www.mobilepractices.com/2008/10/setupdll-sample-and-walkthrough-terms.html The above link is the tutorial but here is the actual file that seems to display the message. #include "stdafx.h" #include "ce_setup.h" // This is a variable containing the text to be displayed // in the Terms & Conditions dialog TCHAR Message[] = _T("TERMS & CONDITIONS\r\n ") _T("Selecting YES you're accepting our terms & conditions.\r\n") _T("This is just a sample application.\r\n") _T("From http://www.mobilepractices.com\r\n") _T("You can replace this text with your own.\r\n") _T("We're using a setup.dll to show this dialog.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Last line.\r\n") ; // This function will be called when the user // tries to install the cab. According to its return // value the installation continues or is cancelled. // As this could be called more than once // (i.e. if there is not enough space on the target) // we should take care about fFirstCall parameter // to show the dialog only once. codeINSTALL_INIT Install_Init( HWND hwndParent, BOOL fFirstCall, BOOL fPreviouslyInstalled, LPCTSTR pszInstallDir ) { if (!fFirstCall || ::MessageBoxW(0, Message, _T("SplashScreenSample") , MB_YESNO) == IDYES) return codeINSTALL_INIT_CONTINUE; else return codeINSTALL_INIT_CANCEL; } So I want to change this to something that can scroll. Can I use like a panel control since I know what has scroll or something else? Thanks

    Read the article

  • How to make html image clickable inside a TextView

    - by Gonan
    I have the following text in a string in the resources file: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;</a> It shows the image fine (I implemented ImageGetter) but it is not clickable. I have tried adding the Linkify thingy but I don't think it's meant for this case, and so it doesn't work. The setMovementMethod doesn't work either. I have tried different combinations of the above: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;hello</a> Here, even the "hello" part is not clickable (neither blue nor underlined). <a href="mailto:[email protected]"><img src="mail_big" /></a> This doesn't even show the image. &lt;a href="mailto:[email protected]"&gt;&lt;img src="mail_big" /&gt;&lt;/a&gt; If I just write the email, without the <a> tag it works perfectly, but I would like to use the image of an envelope that the user can click on. It's not possible to use an imagebutton because this text is in the middle of a string and so I can't split it. Any ideas? Thanks! EDIT: I found a solution or rather found how to do it correctly. All I had to do was adding the setMovementMethod call before the call to setText in the TextView and ALSO, and COMPLETELY NECESSARY, remove the attribute "android:autoLink="all" from the layout. Apparently, parsing mails and urls in a string is mutually exclusive to interpreting the link tags in a string. So one or the other but not both. Finally my layout is just a TextView with nothing special, just width and height. The activity is like this: TextView tv = (TextView)findViewById(R.id.about_text); tv.setMovementMethod(LinkMovementMethod.getInstance()); tv.setText(Html.fromHtml(getString(R.string.about_content), new ImageGetter(), null)); And the string is like this: <string name="about_content"><a href="mailto:[email protected]"><img src="mail" /></a></string>

    Read the article

  • Custom SessionListener, name is not bound in this context, javax.naming.NameNotFoundException

    - by mehmet6parmak
    Hi, I am trying to implement HttpSessionListener so that users of this listener can register implementation of ISessionEvent interface to session Events.code is below: public class MySessionListener implements HttpSessionListener{ @Resource ISessionEvent sessionEvent; public ISessionEvent getSessionEvent() { return sessionEvent; } public void setSessionEvent(ISessionEvent sessionEvent) { this.sessionEvent = sessionEvent; } @Override public void sessionCreated(HttpSessionEvent arg0) { sessionEvent.SessionCreated(arg0.getSession()); } @Override public void sessionDestroyed(HttpSessionEvent arg0) { sessionEvent.SessionDestroyed(arg0.getSession()); } } When user implement ISessionEvent and add as a bean, SessionCreated and SessionDestroyed functions of implementation will be called when these events occured. You can ask why dont you just write inside listeners methods, i dont i'm just trying. When i try the code above i got the following error message: javax.naming.NameNotFoundException: Name com.mehmet6parmak.sessionlistener.MySessionListener is not bound in this Context at org.apache.naming.NamingContext.lookup(NamingContext.java:770) at org.apache.naming.NamingContext.lookup(NamingContext.java:153) at org.apache.catalina.util.DefaultAnnotationProcessor.lookupFieldResource(DefaultAnnotationProcessor.java:278) at org.apache.catalina.util.DefaultAnnotationProcessor.processAnnotations(DefaultAnnotationProcessor.java:187) at org.apache.catalina.core.StandardContext.listenerStart(StandardContext.java:4082) at org.apache.catalina.core.StandardContext.start(StandardContext.java:4630) at org.apache.catalina.core.ContainerBase.start(ContainerBase.java:1045) at org.apache.catalina.core.StandardHost.start(StandardHost.java:785) at org.apache.catalina.core.ContainerBase.start(ContainerBase.java:1045) at org.apache.catalina.core.StandardEngine.start(StandardEngine.java:445) at org.apache.catalina.core.StandardService.start(StandardService.java:519) at org.apache.catalina.core.StandardServer.start(StandardServer.java:710) at org.apache.catalina.startup.Catalina.start(Catalina.java:581) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.catalina.startup.Bootstrap.start(Bootstrap.java:289) at org.apache.catalina.startup.Bootstrap.main(Bootstrap.java:414) Resource annotation causes the error but i could not resolve it. Thanks All... Interface and Implementation @Resource public interface ISessionEvent { public void SessionCreated(HttpSession session); public void SessionDestroyed(HttpSession session); } @Resource public class SessionEvent implements ISessionEvent { @Override public void SessionDestroyed(HttpSession session) { System.out.println("From Session Event Callback(Destroy):" + session.getId()); } @Override public void SessionCreated(HttpSession session) { System.out.println("From Session Event Callback(Create):" + session.getId()); } } Bean Definition <context:annotation-config/> <context:component-scan base-package="com.mehmet6parmak"> </context:component-scan> <bean id="sessionEvent" autowire="byName" class="com.mehmet6parmak.sessionlistener.SessionEvent"></bean> Solution:Using the method used in link works.

    Read the article

  • How can I progrommatically change the target framework from 4.0 to 3.5 of a project/solution?

    - by scott
    Edit 3: After more googling it looks like you can't have the TargetFrameworkMoniker property in a .NET 3.5 application. So I guess I should be asking a different question. How do I change the Target framework from 4.0 to 3.5? Unfortunately, I can only find stuff on how to go the other way. or better yet how do i progrommatically set the target framework version of a project to something other than 4.0? Original question: I just switched to vs2010. I have an application that uses .net 3.5. It loads plugins which are generated by a different app. The plugins are using .net 4 and there for cannot be loaded. I'm using EnvDTE.Project to create a project and set the settings. I can't find what setting needs to be set for this. Edit 1: I'm generating code for about 50 solutions. When I made the switch from vs2005 to vs2010 the projects in those solutions are defaulting to .NET Framework 4.0. So I need to set the .NET Framework to 3.5 when I am generating the code for these solutions. Edit 2: After a lot of googling I found this. so then I tried this: loProp = vsGetProperty("TargetFrameworkMoniker"); vsSetValue(loProp, ".NETFramework,Version=v3.5"); the definitions for those two methods are below. as far as I can tell they do the same this as project.Properties.Item("TargetFrameworkMoniker").Value = ".NETFramework,Version=v4.0,Profile=Client"; I start getting an Property Unavailable Exception later in the code. When I remove the new lines everything works except the projects target framework is still 4.0. The code generators target framework is 3.5 so I can't use the FrameworkName class like shown in the second example in that link. here is vsGetProperty protected Property vsGetProperty(string aProperty) { bool lbDone = false; int liCount = 0; Property loProp; while (!lbDone && liCount < pMaxRetries) { try { loProp = pProject.Properties.Item(aProperty); lbDone = true; return loProp; } catch (System.Runtime.InteropServices.COMException loE) { liCount++; if ((uint)loE.ErrorCode == 0x80010001) { // RPC_E_CALL_REJECTED - sleep half sec then try again System.Threading.Thread.Sleep(pDelayBetweenRetry); } } } return null; } and vsSetValue protected void vsSetValue(Property aProperty, string aValue) { bool lbDone = false; int liCount = 0; while (!lbDone && liCount < pMaxRetries) { try { aProperty.Value = aValue; lbDone = true; } catch (System.Runtime.InteropServices.COMException loE) { liCount++; if ((uint)loE.ErrorCode == 0x80010001) { // RPC_E_CALL_REJECTED - sleep half sec then try again System.Threading.Thread.Sleep(pDelayBetweenRetry); } } } }

    Read the article

< Previous Page | 702 703 704 705 706 707 708 709 710 711 712 713  | Next Page >