Search Results

Search found 19393 results on 776 pages for 'reference count'.

Page 717/776 | < Previous Page | 713 714 715 716 717 718 719 720 721 722 723 724  | Next Page >

  • WP7 databinding displays int but not string?

    - by user1794106
    Whenever I test my app.. it binds the data from Note class and displays it if it isn't a string. But for the string variables it wont bind. What am I doing wrong? Inside my main: <Grid x:Name="ContentPanel" Grid.Row="1" Margin="12,0,12,0"> <ListBox x:Name="Listbox" SelectionChanged="listbox_SelectionChanged" ItemsSource="{Binding}"> <ListBox.ItemTemplate> <DataTemplate> <Border Width="800" MinHeight="60"> <StackPanel> <TextBlock x:Name="Title" VerticalAlignment="Center" FontSize="{Binding TextSize}" Text="{Binding Name}"/> <TextBlock x:Name="Date" VerticalAlignment="Center" FontSize="{Binding TextSize}" Text="{Binding Modified}"/> </StackPanel> </Border> </DataTemplate> </ListBox.ItemTemplate> </ListBox> </Grid> </Grid> in code behind: protected override void OnNavigatedTo(System.Windows.Navigation.NavigationEventArgs e) { MessageBox.Show("enters onNav Main"); DataContext = null; DataContext = Settings.NotesList; Settings.CurrentNoteIndex = -1; Listbox.SelectedIndex = -1; if (Settings.NotesList != null) { if (Settings.NotesList.Count == 0) { Notes.Text = "No Notes"; } else { Notes.Text = ""; } } } and public static class Settings { public static ObservableCollection<Note> NotesList; static IsolatedStorageSettings settings; private static int currentNoteIndex; static Settings() { NotesList = new ObservableCollection<Note>(); settings = IsolatedStorageSettings.ApplicationSettings; MessageBox.Show("enters constructor settings"); } notes class: public class Note { public DateTimeOffset Modified { get; set; } public string Title { get; set; } public string Content { get; set; } public int TextSize { get; set; } public Note() { MessageBox.Show("enters Note Constructor"); Modified = DateTimeOffset.Now; Title = "test"; Content = "test"; TextSize = 32; } }

    Read the article

  • Matching array elements to get an array element at another index

    - by bccarlso
    I have a PHP array that I'm using to generate an HTML form. The PHP array is this: <?php $vdb = array ( array( "Alabama", 275), array( "Alaska", 197), array( "Arizona", 3322)); ?> The PHP to generate the HTML form is below. I need to have the value be the name of the state, because there is some AJAX I'm using to display which states a user has chosen. <?php echo "<table border='1'><thead><tr><th></th><th>State</th><th>Contacts</th><th>Email</th></tr></thead>"; for ($row = 0; $row < 42; $row++) { echo "<tr><td class='input_button'><input type='checkbox' name='vdb[]' value='".$vdb[$row][0]."' title='".$vdb[$row][1]."' /></td>"; echo "<td>".$vdb[$row][0]."</td>"; echo "<td>".$vdb[$row][1]."</td>"; } echo "</table>"; ?> What I'm trying to do is, on submission of the form, with the states the user selected, loop through the PHP array and total the numbers from the selected states. So if I checked Alabama and Alaska, I'd want to add 275 + 197. This is what I thought would have worked, but it's not: <?php $vendors = array(); if (isset($_POST["vdb"])) { $vendors = $_POST["vdb"]; } $ven_i = 0; $ven_j = 0; $ven_total = 0; foreach ($vendors as $value) { foreach ($vdb as $vdb_value) { if ($vendors[$ven_i] == $vdb[$ven_j][0]) { $ven_total += $vdb[$ven_j][1]; } $ven_j++; } $ven_i++; } ?> and then $ven_total should be the total I'm looking for. However, $ven_total just ends up being the first checkbox selected, and it ignores the rest. I am doing this correctly with the AJAX, displaying the total on the front end, but I don't know how to pass that on to the form submission. I'd rather not using GET and URL variables, because a user could type something into the URL and modify the count. Any idea what I'm doing wrong, or a better way to approach this that I would be able to understand? (Very much a novice programmer.)

    Read the article

  • jquery, manipulate content inserted by ajax, without using the callback

    - by Cody
    I am using ajax to insert a series of informational blocks via a loop. The blocks each have a title, and long description in them that is hidden by default. They function like an accordion, only showing one description at a time amongst all of the blocks. The problem is opening the description on the first block. I would REALLY like to do it with javascript right after the loop that is creating them is done. Is it possible to manipulate elements created ofter an ajax call without using the callback? <!-- example code--> <style> .placeholder, .long_description{ display:none;} </style> </head><body> <script> /* yes, this script is in the body, dont know if it matters */ $(document).ready(function() { $(".placeholder").each(function(){ // Use the divs to get the blocks var blockname = $(this).html(); // the contents if the div is the ID for the ajax POST $.post("/service_app/dyn_block",'form='+blockname, function(data){ var divname = '#div_' + blockname; $(divname).after(data); $(this).setupAccrdFnctly(); //not the actual code }); }); /* THIS LINE IS THE PROBLEM LINE, is it possible to reference the code ajax inserted */ /* Display the long description in the first dyn_block */ $(".dyn_block").first().find(".long_description").addClass('active').slideDown('fast'); }); </script> <!-- These lines are generated by PHP --> <!-- It is POSSIBLE to display the dyn_blocks --> <!-- here but I would really rather not --> <div id="div_servicetype" class="placeholder">servicetype</div> <div id="div_custtype" class="placeholder">custtype</div> <div id="div_custinfo" class="placeholder">custinfo</div> <div id="div_businfo" class="placeholder">businfo</div> </body>

    Read the article

  • PHP Parse Error unexpected '{'

    - by Laxmidi
    Hi, I'm getting a "Parse error: syntax error, unexpected '{' in line 2". And I don't see the problem. <?php class pointLocation {     var $pointOnVertex = true; // Check if the point sits exactly on one of the vertices     function pointLocation() {     }                   function pointInPolygon($point, $polygon, $pointOnVertex = true) {         $this->pointOnVertex = $pointOnVertex;                  // Transform string coordinates into arrays with x and y values         $point = $this->pointStringToCoordinates($point);         $vertices = array();          foreach ($polygon as $vertex) {             $vertices[] = $this->pointStringToCoordinates($vertex);          }                  // Check if the point sits exactly on a vertex         if ($this->pointOnVertex == true and $this->pointOnVertex($point, $vertices) == true) {             return "vertex";         }                  // Check if the point is inside the polygon or on the boundary         $intersections = 0;          $vertices_count = count($vertices);              for ($i=1; $i < $vertices_count; $i++) {             $vertex1 = $vertices[$i-1];              $vertex2 = $vertices[$i];             if ($vertex1['y'] == $vertex2['y'] and $vertex1['y'] == $point['y'] and $point['x'] > min($vertex1['x'], $vertex2['x']) and $point['x'] < max($vertex1['x'], $vertex2['x'])) { // Check if point is on an horizontal polygon boundary                 return "boundary";             }             if ($point['y'] > min($vertex1['y'], $vertex2['y']) and $point['y'] <= max($vertex1['y'], $vertex2['y']) and $point['x'] <= max($vertex1['x'], $vertex2['x']) and $vertex1['y'] != $vertex2['y']) {                  $xinters = ($point['y'] - $vertex1['y']) * ($vertex2['x'] - $vertex1['x']) / ($vertex2['y'] - $vertex1['y']) + $vertex1['x'];                  if ($xinters == $point['x']) { // Check if point is on the polygon boundary (other than horizontal)                     return "boundary";                 }                 if ($vertex1['x'] == $vertex2['x'] || $point['x'] <= $xinters) {                     $intersections++;                  }             }          }          // If the number of edges we passed through is even, then it's in the polygon.          if ($intersections % 2 != 0) {             return "inside";         } else {             return "outside";         }     }               function pointOnVertex($point, $vertices) {         foreach($vertices as $vertex) {             if ($point == $vertex) {                 return true;             }         }          }                   function pointStringToCoordinates($pointString) {         $coordinates = explode(" ", $pointString);         return array("x" => $coordinates[0], "y" => $coordinates[1]);     }           } $pointLocation = new pointLocation(); $points = array("30 19", "0 0", "10 0", "30 20", "11 0", "0 11", "0 10", "30 22", "20 20"); $polygon = array("10 0", "20 0", "30 10", "30 20", "20 30", "10 30", "0 20", "0 10", "10 0"); foreach($points as $key => $point) { echo "$key ($point) is " . $pointLocation->pointInPolygon($point, $polygon) . "<br>"; } ?> Does anyone see the problem? Thanks, -Laxmidi

    Read the article

  • c# event fires windows form incorrectly

    - by MikeW
    I'm trying to understand what's happening here. I have a CheckedListBox which contains some ticked and some un-ticked items. I'm trying to find a way of determining the delta in the selection of controls. I've tried some cumbersome like this - but only works part of the time, I'm sure there's a more elegant solution. A maybe related problem is the myCheckBox_ItemCheck event fires on form load - before I have a chance to perform an ItemCheck. Here's what I have so far: void clbProgs_ItemCheck(object sender, ItemCheckEventArgs e) { // i know its awful System.Windows.Forms.CheckedListBox cb = (System.Windows.Forms.CheckedListBox)sender; string sCurrent = e.CurrentValue.ToString(); int sIndex = e.Index; AbstractLink lk = (AbstractLink)cb.Items[sIndex]; List<ILink> _links = clbProgs.DataSource as List<ILink>; foreach (AbstractLink lkCurrent in _links) { if (!lkCurrent.IsActive) { if (!_groupValues.ContainsKey(lkCurrent.Linkid)) { _groupValues.Add(lkCurrent.Linkid, lkCurrent); } } } if (_groupValues.ContainsKey(lk.Linkid)) { AbstractLink lkDirty = (AbstractLink)lk.Clone(); CheckState newValue = (CheckState)e.NewValue; if (newValue == CheckState.Checked) { lkDirty.IsActive = true; } else if (newValue == CheckState.Unchecked) { lkDirty.IsActive = false; } if (_dirtyGroups.ContainsKey(lk.Linkid)) { _dirtyGroups[lk.Linkid] = lkDirty; } else { CheckState oldValue = (CheckState)e.NewValue; if (oldValue == CheckState.Checked) { lkDirty.IsActive = true; } else if (oldValue == CheckState.Unchecked) { lkDirty.IsActive = false; } _dirtyGroups.Add(lk.Linkid, lk); } } else { if (!lk.IsActive) { _dirtyGroups.Add(lk.Linkid, lk); } else { _groupValues.Add(lk.Linkid, lk); } } } Then onclick of a save button - I check whats changed before sending to database: private void btSave_Click(object sender, EventArgs e) { List<AbstractLink> originalList = new List<AbstractLink>(_groupValues.Values); List<AbstractLink> changedList = new List<AbstractLink>(_dirtyGroups.Values); IEnumerable<AbstractLink> dupes = originalList.ToArray<AbstractLink>().Intersect(changedList.ToArray<AbstractLink>()); foreach (ILink t in dupes) { MessageBox.Show("Changed"); } if (dupes.Count() == 0) { MessageBox.Show("No Change"); } } For further info. The definition of type AbstractLink uses: public bool Equals(ILink other) { if (Object.ReferenceEquals(other, null)) return false; if (Object.ReferenceEquals(this, other)) return true; return IsActive.Equals(other.IsActive) && Linkid.Equals(other.Linkid); }

    Read the article

  • LINQ Except operator and object equality

    - by Abhijeet Patel
    Here is an interesting issue I noticed when using the Except Operator: I have list of users from which I want to exclude some users: The list of users is coming from an XML file: The code goes like this: interface IUser { int ID { get; set; } string Name { get; set; } } class User: IUser { #region IUser Members public int ID { get; set; } public string Name { get; set; } #endregion public override string ToString() { return ID + ":" +Name; } public static IEnumerable<IUser> GetMatchingUsers(IEnumerable<IUser> users) { IEnumerable<IUser> localList = new List<User> { new User{ ID=4, Name="James"}, new User{ ID=5, Name="Tom"} }.OfType<IUser>(); var matches = from u in users join lu in localList on u.ID equals lu.ID select u; return matches; } } class Program { static void Main(string[] args) { XDocument doc = XDocument.Load("Users.xml"); IEnumerable<IUser> users = doc.Element("Users").Elements("User").Select (u => new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType<IUser>(); //still a query, objects have not been materialized var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes should contain 6 users but here it contains 8 users } } When I call User.GetMatchingUsers(users) I get 2 matches as expected. The issue is that when I call users.Except(matches) The matching users are not being excluded at all! I am expecting 6 users ut "excludes" contains all 8 users instead. Since all I'm doing in GetMatchingUsers(IEnumerable users) is taking the IEnumerable and just returning the IUsers whose ID's match( 2 IUsers in this case), my understanding is that by default "Except" will use reference equality for comparing the objects to be excluded. Is this not how "Except" behaves? What is even more interesting is that if I materialize the objects using .ToList() and then get the matching users, and call "Except", everything works as expected! Like so: IEnumerable users = doc.Element("Users").Elements("User").Select (u = new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType().ToList(); //explicity materializing all objects by calling ToList() var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes now contains 6 users as expected I don't see why I should need to materialize objects for calling "Except" given that its defined on IEnumerable? Any suggesstions / insights would be much appreciated.

    Read the article

  • Searching in Ruby on Rails - How do I search on each word entered and not the exact string?

    - by bgadoci
    I have built a blog application w/ ruby on rails and I am trying to implement a search feature. The blog application allows for users to tag posts. The tags are created in their own table and belong_to :post. When a tag is created, so is a record in the tag table where the name of the tag is tag_name and associated by post_id. Tags are strings. I am trying to allow a user to search for any word tag_name in any order. Here is what I mean. Lets say a particular post has a tag that is 'ruby code controller'. In my current search feature, that tag will be found if the user searches for 'ruby', 'ruby code', or 'ruby code controller'. It will not be found if the user types in 'ruby controller'. Essentially what I am saying is that I would like each word entered in the search to be searched for, not necessarily the 'string' that is entered into the search. I have been experimenting with providing multiple textfields to allow the user to type in multiple words, and also have been playing around with the code below, but can't seem to accomplish the above. I am new to ruby and rails so sorry if this is an obvious question and prior to installing a gem or plugin I thought I would check to see if there was a simple fix. Here is my code: View: /views/tags/index.html.erb <% form_tag tags_path, :method => 'get' do %> <p> <%= text_field_tag :search, params[:search], :class => "textfield-search" %> <%= submit_tag "Search", :name => nil, :class => "search-button" %> </p> <% end %> TagsController def index @tags = Tag.search(params[:search]).paginate :page => params[:page], :per_page => 5 @tagsearch = Tag.search(params[:search]) @tag_counts = Tag.count(:group => :tag_name, :order => 'count_all DESC', :limit => 100) respond_to do |format| format.html # index.html.erb format.xml { render :xml => @tags } end end Tag Model class Tag < ActiveRecord::Base belongs_to :post validates_length_of :tag_name, :maximum=>42 validates_presence_of :tag_name def self.search(search) if search find(:all, :order => "created_at DESC", :conditions => ['tag_name LIKE ?', "%#{search}%"]) else find(:all, :order => "created_at DESC") end end end

    Read the article

  • Instance caching in Objective C

    - by zoul
    Hello! I want to cache the instances of a certain class. The class keeps a dictionary of all its instances and when somebody requests a new instance, the class tries to satisfy the request from the cache first. There is a small problem with memory management though: The dictionary cache retains the inserted objects, so that they never get deallocated. I do want them to get deallocated, so that I had to overload the release method and when the retain count drops to one, I can remove the instance from cache and let it get deallocated. This works, but I am not comfortable mucking around the release method and find the solution overly complicated. I thought I could use some hashing class that does not retain the objects it stores. Is there such? The idea is that when the last user of a certain instance releases it, the instance would automatically disappear from the cache. NSHashTable seems to be what I am looking for, but the documentation talks about “supporting weak relationships in a garbage-collected environment.” Does it also work without garbage collection? Clarification: I cannot afford to keep the instances in memory unless somebody really needs them, that is why I want to purge the instance from the cache when the last “real” user releases it. Better solution: This was on the iPhone, I wanted to cache some textures and on the other hand I wanted to free them from memory as soon as the last real holder released them. The easier way to code this is through another class (let’s call it TextureManager). This class manages the texture instances and caches them, so that subsequent calls for texture with the same name are served from the cache. There is no need to purge the cache immediately as the last user releases the texture. We can simply keep the texture cached in memory and when the device gets short on memory, we receive the low memory warning and can purge the cache. This is a better solution, because the caching stuff does not pollute the Texture class, we do not have to mess with release and there is even a higher chance for cache hits. The TextureManager can be abstracted into a ResourceManager, so that it can cache other data, not only textures.

    Read the article

  • Backbone.js (model instanceof Model) via Chrome Extension

    - by Leoncelot
    Hey guys, This is my first time ever posting on this site and the problem I'm about to pose is difficult to articulate due to the set of variables required to arrive at it. Let me just quickly explain the framework I'm working with. I'm building a Chrome Extension using jQuery, jQuery-ui, and Backbone The entire JS suite for the extension is written in CoffeeScript and I'm utilizing Rails and the asset pipeline to manage it all. This means that when I want to deploy my extension code I run rake assets:precompile and copy the resulting compressed JS to my extensions Directory. The nice thing about this approach is that I can actually run the extension js from inside my Rails app by including the library. This is basically the same as my extensions background.js file which injects the js as a content script. Anyway, the problem I've recently encountered was when I tried testing my extension on my buddy's site, whiskeynotes.com. What I was noticing is that my backbone models were being mangled upon adding them to their respective collections. So something like this.collection.add(new SomeModel) created some nonsense version of my model. This code eventually runs into Backbone's prepareModel code _prepareModel: function(model, options) { options || (options = {}); if (!(model instanceof Model)) { var attrs = model; options.collection = this; model = new this.model(attrs, options); if (!model._validate(model.attributes, options)) model = false; } else if (!model.collection) { model.collection = this; } return model; }, Now, in most of the sites on which I've tested the extension, the result is normal, however on my buddy's site the !(model instance Model) evaluates to true even though it is actually an instance of the correct class. The consequence is a super messed up version of the model where the model's attributes is a reference to the models collection (strange right?). Needless to say, all kinds of crazy things were happening afterward. Why this is occurring is beyond me. However changing this line (!(model instanceof Model)) to (!(model instanceof Backbone.Model)) seems to fix the problem. I thought maybe it had something to do with the Flot library (jQuery graph library) creating their own version of 'Model' but looking through the source yielded no instances of it. I'm just curious as to why this would happen. And does it make sense to add this little change to the Backbone source? Update: I just realized that the "fix" doesn't actually work. I can also add that my backbone Models are namespaced in a wrapping object so that declaration looks something like class SomeNamespace.SomeModel extends Backbone.Model

    Read the article

  • How do I pass the value of the previous form element into an "onchange" javascript function?

    - by Jen
    Hello, I want to make some UI improvements to a page I am developing. Specifically, I need to add another drop down menu to allow the user to filter results. This is my current code: HTML file: <select name="test_id" onchange="showGrid(this.name, this.value, 'gettestgrid')"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> This is pseudo code for what I want to happen: <select name="test_id"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> <select name="statistics" onchange="showGrid(PREVIOUS.name, PREVIOUS.VALUE, THIS.value)"> <option selected>Select a data display --></option> <option value='gettestgrid'>Show averages by student</option> <option value='gethomeroomgrid'>Show averages by homeroom</option> <option value='getschoolgrid'>Show averages by school</option> </select> How do I access the previous field's name and value? Any help much appreciated, thx! Also, JS function for reference: function showGrid(name, value, phpfile) { xmlhttp=GetXmlHttpObject(); if (xmlhttp==null) { alert ("Browser does not support HTTP Request"); return; } var url=phpfile+".php"; url=url+"?"+name+"="+value; url=url+"&sid="+Math.random(); xmlhttp.onreadystatechange=stateChanged; xmlhttp.open("GET",url,true); xmlhttp.send(null); }

    Read the article

  • Slow MySQL query....only sometimes

    - by Shane N
    I have a query that's used in a reporting system of ours that sometimes runs quicker than a second, and other times takes 1 to 10 minutes to run. Here's the entry from the slow query log: # Query_time: 543 Lock_time: 0 Rows_sent: 0 Rows_examined: 124948974 use statsdb; SELECT count(distinct Visits.visitorid) as 'uniques' FROM Visits,Visitors WHERE Visits.visitorid=Visitors.visitorid and candidateid in (32) and visittime>=1275721200 and visittime<=1275807599 and (omit=0 or omit>=1275807599) AND Visitors.segmentid=9 AND Visits.visitorid NOT IN (SELECT Visits.visitorid FROM Visits,Visitors WHERE Visits.visitorid=Visitors.visitorid and candidateid in (32) and visittime<1275721200 and (omit=0 or omit>=1275807599) AND Visitors.segmentid=9); It's basically counting unique visitors, and it's doing that by counting the visitors for today and then substracting those that have been here before. If you know of a better way to do this, let me know. I just don't understand why sometimes it can be so quick, and other times takes so long - even with the same exact query under the same server load. Here's the EXPLAIN on this query. As you can see it's using the indexes I've set up: id select_type table type possible_keys key key_len ref rows Extra 1 PRIMARY Visits range visittime_visitorid,visitorid visittime_visitorid 4 NULL 82500 Using where; Using index 1 PRIMARY Visitors eq_ref PRIMARY,cand_visitor_omit PRIMARY 8 statsdb.Visits.visitorid 1 Using where 2 DEPENDENT SUBQUERY Visits ref visittime_visitorid,visitorid visitorid 8 func 1 Using where 2 DEPENDENT SUBQUERY Visitors eq_ref PRIMARY,cand_visitor_omit PRIMARY 8 statsdb.Visits.visitorid 1 Using where I tried to optimize the query a few weeks ago and came up with a variation that consistently took about 2 seconds, but in practice it ended up taking more time since 90% of the time the old query returned much quicker. Two seconds per query is too long because we are calling the query up to 50 times per page load, with different time periods. Could the quick behavior be due to the query being saved in the query cache? I tried running 'RESET QUERY CACHE' and 'FLUSH TABLES' between my benchmark tests and I was still getting quick results most of the time. Note: last night while running the query I got an error: Unable to save result set. My initial research shows that may be due to a corrupt table that needs repair. Could this be the reason for the behavior I'm seeing? In case you want server info: Accessing via PHP 4.4.4 MySQL 4.1.22 All tables are InnoDB We run optimize table on all tables weekly The sum of both the tables used in the query is 500 MB MySQL config: key_buffer = 350M max_allowed_packet = 16M thread_stack = 128K sort_buffer = 14M read_buffer = 1M bulk_insert_buffer_size = 400M set-variable = max_connections=150 query_cache_limit = 1048576 query_cache_size = 50777216 query_cache_type = 1 tmp_table_size = 203554432 table_cache = 120 thread_cache_size = 4 wait_timeout = 28800 skip-external-locking innodb_file_per_table innodb_buffer_pool_size = 3512M innodb_log_file_size=100M innodb_log_buffer_size=4M

    Read the article

  • Flex/Air/AS3 Selecting and Populating a unFocused tab.

    - by Deyon
    I'm having a problem displaying data from a function to text box within a tab. If you run the code and click "Select Tab 2 and Fill..." I get an error; "TypeError: Error #1009: Cannot access a property or method of a null object reference." I'm guessing this is because "Tab 2" is/was not rendered yet. Now if I run the code, select "Tab 2" then select "Tab 1" and click "Select Tab 2 and Fill..." it works the way I would like. Dose any one know a way around this problem. ----Full Flex 4/Flash Builder Code just copy paste---- <?xml version="1.0" encoding="utf-8"?> <s:WindowedApplication xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:mx="library://ns.adobe.com/flex/halo" creationComplete=" "> <fx:Script> <![CDATA[ public function showtab2():void { mytextbox.text="I made it!"; tn.selectedIndex=1; } ]]> </fx:Script> <fx:Declarations> <!-- Place non-visual elements (e.g., services, value objects) here --> </fx:Declarations> <mx:Panel title="TabNavigator Container Example" height="90%" width="90%" paddingTop="10" paddingLeft="10" paddingRight="10" paddingBottom="10"> <mx:Label width="100%" color="blue" text="Select the tabs to change the panel."/> <mx:TabNavigator id="tn" width="100%" height="100%"> <!-- Define each panel using a VBox container. --> <mx:VBox label="Panel 1"> <mx:Label text="TabNavigator container panel 1"/> <mx:Button label="Select Tab 2 and Fill with Text" click="showtab2()"/> </mx:VBox> <mx:VBox label="Panel 2"> <mx:Label text="TabNavigator container panel 2"/> <s:TextInput id="mytextbox" /> </mx:VBox> </mx:TabNavigator> <mx:HBox> </mx:HBox> </mx:Panel> </s:WindowedApplication>

    Read the article

  • Which network protocol to use for lightweight notification of remote apps?

    - by Chris Thornton
    I have this situation.... Client-initiated SOAP 1.1 communication between one server and let's say, tens of thousands of clients. Clients are external, coming in through our firewall, authenticated by certificate, https, etc.. They can be anywhere, and usually have their own firewalls, NAT routers, etc... They're truely external, not just remote corporate offices. They could be in a corporate/campus network, DSL/Cable, even Dialup. Client uses Delphi (2005 + SOAP fixes from 2007), and the server is C#, but from an architecture/design standpoint, that shouldn't matter. Currently, clients push new data to the server and pull new data from the server on 15-minute polling loop. The server currently does not push data - the client hits the "messagecount" method, to see if there is new data to pull. If 0, it sleeps for another 15 min and checks again. We're trying to get that down to 7 seconds. If this were an internal app, with one or just a few dozen clients, we'd write a cilent "listener" soap service, and would push data to it. But since they're external, sit behind their own firewalls, and sometimes private networks behind NAT routers, this is not practical. So we're left with polling on a much quicker loop. 10K clients, each checking their messagecount every 10 seconds, is going to be 1000/sec messages that will mostly just waste bandwidth, server, firewall, and authenticator resources. So I'm trying to design something better than what would amount to a self-inflicted DoS attack. I don't think it's practical to have the server send soap messages to the client (push) as this would require too much configuration at the client end. But I think there are alternatives that I don't know about. Such as: 1) Is there a way for the client to make a request for GetMessageCount() via Soap 1.1, and get the response, and then perhaps, "stay on the line" for perhaps 5-10 minutes to get additional responses in case new data arrives? i.e the server says "0", then a minute later in response to some SQL trigger (the server is C# on Sql Server, btw), knows that this client is still "on the line" and sends the updated message count of "5"? 2) Is there some other protocol that we could use to "ping" the client, using information gathered from their last GetMessageCount() request? 3) I don't even know. I guess I'm looking for some magic protocol where the client can send a GetMessageCount() request, which would include info for "oh by the way, in case the answer changes in the next hour, ping me at this address...". Also, I'm assuming that any of these "keep the line open" schemes would seriously impact the server sizing, as it would need to keep many thousands of connections open, simultaneously. That would likely impact the firewalls too, I think. Is there anything out there like that? Or am I pretty much stuck with polling? TIA, Chris

    Read the article

  • Between/Timerange LINQ

    - by dezza
    My intention here is to select all entries (Bookings) between "begin" (begin_prefix) and "end" (end_prefix) BUT! The important thing is: If I have a booking at 07:25-10:00 - you query for 09:00-10:00 it should still show the booking because it reserves the room until 10 no matter what .. So .. 07.25-10.00 booking means query for 09:00-10.00 still returns a list of bookings within 09:00-10.00 (which means 07.25-10.00 is included) public static List<booking> Today(DateTime begin, DateTime end) { try { IFormatProvider Culturez = new CultureInfo(ConfigurationManager.AppSettings["locale"].ToString(), true); DateTime begin_prefix = DateTime.ParseExact(begin.ToString(), "dd-MM-yyyy HH:mm:ss", Culturez); DateTime end_prefix = DateTime.ParseExact(end.ToString(), "dd-MM-yyyy HH:mm:ss", Culturez); dbDataContext db = new dbDataContext(); // gives bookings BEFORE begin_prefix (why?) IQueryable<booking> bQ = from b in db.bookings where begin_prefix >= b.Starts && b.Ends <= end_prefix && b.Ends > b.Starts && b.pointsbookings.Count > 0 select b; // ^gives bookings BEFORE begin_prefix (why?) List<booking> bL = bQ.ToList(); return bL; } catch (Exception) { throw; } } I've tried getting this right for some time now .. Seems everytime I correct it to something new, a new overlap or selection outside the two begin/end dates seem to appear :( UPDATE CRITERIA and SOURCE: Bookings has to be WITHIN "begin_prefix" and "end_prefix" or on the exact same time .. .. currently the above code gives me bookings BEFORE begin_prefix date, which is not intentioned! We're in 2011, I got bookings from 2010 as well! ** NEW!! UPDATED: This is what I have: SEARCH.START = BOOKING.START BOOKING.END <= SEARCH.END ... the problem comes up when .. BOOKING entry: 10:00(Start)-14:00(End) This means according to above: 08.59 = 10.00 (SEARCH.START = BOOKING.START) It will never include it. But it should, since this is the same room and the seats are booked individually!

    Read the article

  • Loading images to UIScrollview crashes

    - by Icky
    Hello All. I have a Navigationcontroller pushing a UIViewController with a scrollview inside. Within the scrollview I download a certain number of images around 20 (sometimes more) each sized around 150 KB. All these images are added to the scrollview so that their origin is x +imageSize and the following is sorted right to the one before. All in all I think its a lot of data (3-4 MB). On an I pod Touch this sometimes crashes, the IPhone can handle it once, if it has to load the data again (some other images) , it crashes too. I guess its a memory issue but within my code, I download the image, save it to a file on the phone as NSData, read it again from file and add it to a UIImageview which I release. So I have freed the memory I allocated, nevertheless it still crashes. Can anyone help me out? Since Im new to this, I dont know the best way to handle the Images in a scrollview. Besides I create the controller at start from nib, which means I dont have to release it, since I dont use alloc - right? Code: In my rootviewcontroller I do: -(void) showImages { [[self naviController] pushViewController:imagesViewController animated:YES]; [imagesViewController viewWillAppear:YES]; } Then in my Controller handling the scroll View, this is the method to load the images: - (void) loadOldImageData { for (int i = 0; i < 40 ; i++) { NSArray *paths = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES); NSString *documentsDirectory = [paths objectAtIndex:0]; NSString *filePath = [documentsDirectory stringByAppendingPathComponent:[NSString stringWithFormat:@"img%d.jpg", i]]; NSData *myImg = [NSData dataWithContentsOfFile:filePath]; UIImage *im = [UIImage imageWithData:myImg]; if([im isKindOfClass:[UIImage class]]) { NSLog(@"IM EXISTS"); UIImageView *imgView = [[UIImageView alloc] initWithImage:im]; CGRect frame = CGRectMake(i*320, 0, 320, 416); imgView.frame = frame; [myScrollView addSubview:imgView]; [imgView release]; //NSLog(@"Adding img %d", i); numberImages = i; NSLog(@"setting numberofimages to %d", numberImages); //NSLog(@"scroll subviews %d", [myScrollView.subviews count]); } } myScrollView.contentSize = CGSizeMake(320 * (numberImages + 1), 416); }

    Read the article

  • NSNotifications vs delegate for multiple instances of same protocol

    - by Brent Traut
    I could use some architectural advice. I've run into the following problem a few times now and I've never found a truly elegant way to solve it. The issue, described at the highest level possible:I have a parent class that would like to act as the delegate for multiple children (all using the same protocol), but when the children call methods on the parent, the parent no longer knows which child is making the call. I would like to use loose coupling (delegates/protocols or notifications) rather than direct calls. I don't need multiple handlers, so notifications seem like they might be overkill. To illustrate the problem, let me try a super-simplified example: I start with a parent view controller (and corresponding view). I create three child views and insert each of them into the parent view. I would like the parent view controller to be notified whenever the user touches one of the children. There are a few options to notify the parent: Define a protocol. The parent implements the protocol and sets itself as the delegate to each of the children. When the user touches a child view, its view controller calls its delegate (the parent). In this case, the parent is notified that a view is touched, but it doesn't know which one. Not good enough. Same as #1, but define the methods in the protocol to also pass some sort of identifier. When the child tells its delegate that it was touched, it also passes a pointer to itself. This way, the parent know exactly which view was touched. It just seems really strange for an object to pass a reference to itself. Use NSNotifications. The parent defines a separate method for each of the three children and then subscribes to the "viewWasTouched" notification for each of the three children as the notification sender. The children don't need to attach themselves to the user dictionary, but they do need to send the notification with a pointer to themselves as the scope. Same as #4, but rather than using separate methods, the parent could just use one with a switch case or other branching along with the notification's sender to determine which path to take. Create multiple man-in-the-middle classes that act as the delegates to the child views and then call methods on the parent either with a pointer to the child or with some other differentiating factor. This approach doesn't seem scalable. Are any of these approaches considered best practice? I can't say for sure, but it feels like I'm missing something more obvious/elegant.

    Read the article

  • Spring.Net Message Selectors with compound statements don't seem to be working

    - by Jonathan Beerhalter
    I'm using Spring.NET to connect to ActiveMQ and do some fairly simple pub sub routing. Everything works fine when my selector is a simple expression like Car='Honda' but if I try a compound expression like Car='Honda' AND Make='Pilot' I never get any matches on my subscription. Here's the code to generate the subscription, does anyone see where I might be doing something wrong? public bool AddSubscription(string topicName, Dictionary<string,string> selectorList, GDException exp) { try { ActiveMQTopic topic = new ActiveMQTopic(topicName); string selectorString = ""; if (selectorList.Keys.Count == 0) { // Select all items for this topic selectorString = "2>1"; } else { foreach (string key in selectorList.Keys) { selectorString += key + " = '" + selectorList[key] + "'" + " AND "; } selectorString = selectorString.Remove(selectorString.Length - 5, 5); } IMessageConsumer consumer = this._subSession.CreateConsumer(topic, selectorString, false); if (consumer != null) { _consumers.Add(consumer); consumer.Listener += new MessageListener(HandleRecieveMessage); return true; } else { exp.SetValues("Error adding subscription, null consumer returned"); return false; } } catch (Exception ex) { exp.SetValues(ex); return false; } } And then the code to send the message, which seems simple enough to me public void SendMessage(GDPubSubMessage messageToSend) { if (!this.isDisposed) { if (_producers.ContainsKey(messageToSend.Topic)) { IBytesMessage bytesMessage = this._pubSession.CreateBytesMessage(messageToSend.Payload); foreach (string key in messageToSend.MessageProperties.Keys) { bytesMessage.Properties.SetString(key, messageToSend.MessageProperties[key]); } _producers[messageToSend.Topic].Send(bytesMessage, false, (byte)255, TimeSpan.FromSeconds(1)); } else { ActiveMQTopic topic = new ActiveMQTopic(messageToSend.Topic); _producers.Add(messageToSend.Topic, this._pubSession.CreateProducer(topic)); IBytesMessage bytesMessage = this._pubSession.CreateBytesMessage(messageToSend.Payload); foreach (string key in messageToSend.MessageProperties.Keys) { bytesMessage.Properties.SetString(key, messageToSend.MessageProperties[key]); } _producers[messageToSend.Topic].Send(bytesMessage); } } else { throw new ObjectDisposedException(this.GetType().FullName); } } 07/102009: Update Ok, found the problem bytesMessage.Properties.SetString(key, messageToSend.MessageProperties[key]); This justs sets a single property, so my messages are only being tagged with a single property, hence the combo subscription never gets hit. Anyone know how to add more properties? You'd think bytesMessage.Properties would have a Add method, but it doesn't.

    Read the article

  • How to implement a caching model without violating MVC pattern?

    - by RPM1984
    Hi Guys, I have an ASP.NET MVC 3 (Razor) Web Application, with a particular page which is highly database intensive, and user experience is of the upmost priority. Thus, i am introducing caching on this particular page. I'm trying to figure out a way to implement this caching pattern whilst keeping my controller thin, like it currently is without caching: public PartialViewResult GetLocationStuff(SearchPreferences searchPreferences) { var results = _locationService.FindStuffByCriteria(searchPreferences); return PartialView("SearchResults", results); } As you can see, the controller is very thin, as it should be. It doesn't care about how/where it is getting it's info from - that is the job of the service. A couple of notes on the flow of control: Controllers get DI'ed a particular Service, depending on it's area. In this example, this controller get's a LocationService Services call through to an IQueryable<T> Repository and materialize results into T or ICollection<T>. How i want to implement caching: I can't use Output Caching - for a few reasons. First of all, this action method is invoked from the client-side (jQuery/AJAX), via [HttpPost], which according to HTTP standards should not be cached as a request. Secondly, i don't want to cache purely based on the HTTP request arguments - the cache logic is a lot more complicated than that - there is actually two-level caching going on. As i hint to above, i need to use regular data-caching, e.g Cache["somekey"] = someObj;. I don't want to implement a generic caching mechanism where all calls via the service go through the cache first - i only want caching on this particular action method. First thought's would tell me to create another service (which inherits LocationService), and provide the caching workflow there (check cache first, if not there call db, add to cache, return result). That has two problems: The services are basic Class Libraries - no references to anything extra. I would need to add a reference to System.Web here. I would have to access the HTTP Context outside of the web application, which is considered bad practice, not only for testability, but in general - right? I also thought about using the Models folder in the Web Application (which i currently use only for ViewModels), but having a cache service in a models folder just doesn't sound right. So - any ideas? Is there a MVC-specific thing (like Action Filter's, for example) i can use here? General advice/tips would be greatly appreciated.

    Read the article

  • SQL Native Client 10 Performance miserable (due to server-side cursors)

    - by namezero
    we have an application that uses ODBC via CDatabase/CRecordset in MFC (VS2010). We have two backends implemented. MSSQL and MySQL. Now, when we use MSSQL (with the Native Client 10.0), retrieving records with SELECT is dramatically slow via slow links (VPN, for example). The MySQL ODBC driver does not exhibit this nasty behavior. For example: CRecordset r(&m_db); r.Open(CRecordset::snapshot, L"SELECT a.something, b.sthelse FROM TableA AS a LEFT JOIN TableB AS b ON a.ID=b.Ref"); r.MoveFirst(); while(!r.IsEOF()) { // Retrieve CString strData; crs.GetFieldValue(L"a.something", strData); crs.MoveNext(); } Now, with the MySQL driver, everything runs as it should. The query is returned, and everything is lightning fast. However, with the MSSQL Native Client, things slow down, because on every MoveNext(), the driver communicates with the server. I think it is due to server-side cursors, but I didn't find a way to disable them. I have tried using: ::SQLSetConnectAttr(m_db.m_hdbc, SQL_ATTR_ODBC_CURSORS, SQL_CUR_USE_ODBC, SQL_IS_INTEGER); But this didn't help either. There are still long-running exec's to sp_cursorfetch() et al in SQL Profiler. I have also tried a small reference project with SQLAPI and bulk fetch, but that hangs in FetchNext() for a long time, too (even if there is only one record in the resultset). This however only happens on queries with LEFT JOINS, table-valued functions, etc. Note that the query doesn't take that long - executing the same SQL via SQL Studio over the same connection returns in a reasonable time. Question1: Is is possible to somehow get the native client to "cache" all results locally use local cursors in a similar fashion as the MySQL driver seems to do it? Maybe this is the wrong approach altogether, but I'm not sure how else to do this. All we want is to retrieve all data at once from a SELECT, then never talk the server again until the next query. We don't care about recordset updates, deletes, etc or any of that nonsense. We only want to retrieve data. We take that recordset, get all the data, and delete it. Question2: Is there a more efficient way to just retrieve data in MFC with ODBC?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Multi-tier applications using L2S, WCF and Base Class

    - by Gena Verdel
    Hi all. One day I decided to build this nice multi-tier application using L2S and WCF. The simplified model is : DataBase-L2S-Wrapper(DTO)-Client Application. The communication between Client and Database is achieved by using Data Transfer Objects which contain entity objects as their properties. abstract public class BaseObject { public virtual IccSystem.iccObjectTypes ObjectICC_Type { get { return IccSystem.iccObjectTypes.unknownType; } } [global::System.Data.Linq.Mapping.ColumnAttribute(Storage = "_ID", AutoSync = AutoSync.OnInsert, DbType = "BigInt NOT NULL IDENTITY", IsPrimaryKey = true, IsDbGenerated = true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order = 1)] public virtual long ID { //get; //set; get { return _ID; } set { _ID = value; } } } [DataContract] public class BaseObjectWrapper<T> where T : BaseObject { #region Fields private T _DBObject; #endregion #region Properties [DataMember] public T Entity { get { return _DBObject; } set { _DBObject = value; } } #endregion } Pretty simple, isn't it?. Here's the catch. Each one of the mapped classes contains ID property itself so I decided to override it like this [global::System.Data.Linq.Mapping.TableAttribute(Name="dbo.Divisions")] [global::System.Runtime.Serialization.DataContractAttribute()] public partial class Division : INotifyPropertyChanging, INotifyPropertyChanged { [global::System.Data.Linq.Mapping.ColumnAttribute(Storage="_ID", AutoSync=AutoSync.OnInsert, DbType="BigInt NOT NULL IDENTITY", IsPrimaryKey=true, IsDbGenerated=true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order=1)] public override long ID { get { return this._ID; } set { if ((this._ID != value)) { this.OnIDChanging(value); this.SendPropertyChanging(); this._ID = value; this.SendPropertyChanged("ID"); this.OnIDChanged(); } } } } Wrapper for division is pretty straightforward as well: public class DivisionWrapper : BaseObjectWrapper<Division> { } It worked pretty well as long as I kept ID values at mapped class and its BaseObject class the same(that's not very good approach, I know, but still) but then this happened: private CentralDC _dc; public bool UpdateDivision(ref DivisionWrapper division) { DivisionWrapper tempWrapper = division; if (division.Entity == null) { return false; } try { Table<Division> table = _dc.Divisions; var q = table.Where(o => o.ID == tempWrapper.Entity.ID); if (q.Count() == 0) { division.Entity._errorMessage = "Unable to locate entity with id " + division.Entity.ID.ToString(); return false; } var realEntity = q.First(); realEntity = division.Entity; _dc.SubmitChanges(); return true; } catch (Exception ex) { division.Entity._errorMessage = ex.Message; return false; } } When trying to enumerate over the in-memory query the following exception occurred: Class member BaseObject.ID is unmapped. Although I'm stating the type and overriding the ID property L2S fails to work. Any suggestions?

    Read the article

  • How to refresh a fragment in a viewpager?

    - by aut_silvia
    I know there are already some questions to this problem. But I am really new in Android and ecspecially to Fragments and Viewpager. Pls have passion with me. I didn't found a answer which fits to my code. I dont know how to refresh a fragment or reload it when it's "active" again. TabsPagerAdapter.java: public class TabsPagerAdapter extends FragmentPagerAdapter{ public TabsPagerAdapter(FragmentManager fm){ super(fm); } @Override public Fragment getItem(int index) { switch (index) { case 0: return new KFZFragment(); case 1: return new LogFragment(); case 2: return new TrackFragment(); } return null; } @Override public int getCount() { // get item count - equal to number of tabs return 3; } } I have this 3 Fragments (KFZFragment,LogFragment,TrackFragment) and on the TrackFragment I calculate some data and this data should be display in a ListView in LogFragment. But when I change to LogFragment it's not the latest data. So it doesnt refresh. Now how should I modify my code to refresh the fragments when it's "active"? MainActivityFragment.java: public class MainActivityFragment extends FragmentActivity implements ActionBar.TabListener{ private ViewPager viewPager; private TabsPagerAdapter mAdapter; private ActionBar actionBar; List<Fragment> fragments; private String[] tabs = { "KFZ", "Fahrten Log", "Kosten Track" }; @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.activity_main_fragment); // Initilization viewPager = (ViewPager) findViewById(R.id.pager); actionBar = getActionBar(); mAdapter = new TabsPagerAdapter(getSupportFragmentManager()); fragments = new Vector<Fragment>(); fragments.add(Fragment.instantiate(this, KFZFragment.class.getName(),savedInstanceState)); fragments.add(Fragment.instantiate(this, LogFragment.class.getName(),savedInstanceState)); viewPager.setAdapter(mAdapter); actionBar.setHomeButtonEnabled(false); actionBar.setNavigationMode(ActionBar.NAVIGATION_MODE_TABS); // Adding Tabs for (String tab_name : tabs) { actionBar.addTab(actionBar.newTab().setText(tab_name) .setTabListener(this)); } viewPager.setOnPageChangeListener(new ViewPager.OnPageChangeListener() { @Override public void onPageSelected(int position) { // on changing the page // make respected tab selected actionBar.setSelectedNavigationItem(position); } @Override public void onPageScrolled(int arg0, float arg1, int arg2) { } @Override public void onPageScrollStateChanged(int arg0) { } }); } @Override public void onTabReselected(Tab tab, FragmentTransaction ft) { // TODO Auto-generated method stub } @Override public void onTabSelected(Tab tab, FragmentTransaction ft) { viewPager.setCurrentItem(tab.getPosition()); } @Override public void onTabUnselected(Tab tab, FragmentTransaction ft) { // TODO Auto-generated method stub } @Override public boolean onKeyDown(int keyCode, KeyEvent event) { if (keyCode == KeyEvent.KEYCODE_BACK) { } return super.onKeyDown(keyCode, event); } } Pls help me out.

    Read the article

  • Embedded "Smart" character LCD driver. Is this a good idea?

    - by chris12892
    I have an embedded project that I am working on, and I am currently coding the character LCD driver. At the moment, the LCD driver only supports "dumb" writing. For example, let's say line 1 has some text on it, and I make a call to the function that writes to the line. The function will simply seek to the beginning of the line and write the text (plus enough whitespace to erase whatever was last written). This is well and good, but I get the feeling it is horribly inefficient sometimes, since some lines are simply: "Some-reading: some-Value" Rather than "brute force" replacing the entire line, I wanted to develop some code that would figure out the best way to update the information on the LCD. (just as background, it takes 2 bytes to seek to any char position. I can then begin writing the string) My idea was to first have a loop. This loop would compare the input to the last write, and in doing so, it would cover two things: A: Collect all the differences between the last write and the input. For every contiguous segment (be it same or different) add two bytes to the byte count. This is referenced in B to determine if we are wasting serial bandwidth. B: The loop would determine if this is really a smart thing to do. If we end up using more bytes to update the line than to "brute force" the line, then we should just return and let the brute force method take over. We should exit the smart write function as soon as this condition is met to avoid wasting time. The next part of the function would take all the differences, seek to the required char on the LCD, and write them. Thus, if we have a string like this already on the LCD: "Current Temp: 80F" and we want to update it to "Current Temp: 79F" The function will go through and see that it would take less bandwidth to simply seek to the "8" and write "79". The "7" will cover the "8" and the "9" will cover the "0". That way, we don't waste time writing out the entire string. Does this seem like a practical idea?

    Read the article

  • How to Convert arrays or SimpleXML-Objects into an XML-String

    - by streetparade
    I want to create a xml from a given string, i have a function but i didn't wrote it.It seems a bit cryptical too. Can please some one review it and give me some Ideas, how it could be written clearer for everybody? /** * Converts arrays or SimpleXML-Objects into an XML-String * @params mixed Accepts an array or xml string with data to Post * @params integer DO NOT PROVIDE. Internal Usage for recursion only */ private function mixedDataToXML($data, $level = 1) { if(!$data){ return FALSE; } if(is_array($data)) { $xml = ''; if ($level==1) { $xml .= '<?xml version="1.0" encoding="ISO-8859-1"?>'."\n"; } foreach ($data as $key => $value) { $key = strtolower($key); if (is_array($value)) { $multi_tags = false; foreach($value as $key2=>$value2) { if (is_array($value2)) { $xml .= str_repeat("\t",$level)."<$key>\n"; $xml .= $this->mixedDataToXML($value2, $level+1); $xml .= str_repeat("\t",$level)."</$key>\n"; $multi_tags = true; } else { if (trim($value2)!='') { if (htmlspecialchars($value2)!=$value2) { $xml .= str_repeat("\t",$level). "<$key><![CDATA[$value2]]>". "</$key>\n"; } else { $xml .= str_repeat("\t",$level). "<$key>$value2</$key>\n"; } } $multi_tags = true; } } if (!$multi_tags and count($value)>0) { $xml .= str_repeat("\t",$level)."<$key>\n"; $xml .= $this->mixedDataToXML($value, $level+1); $xml .= str_repeat("\t",$level)."</$key>\n"; } } else { if (trim($value)!='') { if (htmlspecialchars($value)!=$value) { $xml .= str_repeat("\t",$level)."<$key>". "<![CDATA[$value]]></$key>\n"; } else { $xml .= str_repeat("\t",$level). "<$key>$value</$key>\n"; } } } } return $xml; }else{ return (string)$data; } }

    Read the article

  • [C#] Problems with implementing generic IEnumerator and IComparable

    - by r0h
    Hi all! I'm working on an AVL Tree. The tree itself seems to be working but I need a iterator to walk through the values of the tree. Therefore I tried to implement the IEnumerator interace. Unfortunately I get a compile time error implementing IEnumerator and IComparable. First the code and below that the error. class AvlTreePreOrderEnumerator<T> : IEnumerator<T> where T :IComparable<T> { private AvlTreeNode<T> current = default(T); private AvlTreeNode<T> tree = null; private Queue<AvlTreeNode<T>> traverseQueue = null; public AvlTreePreOrderEnumerator(AvlTreeNode<T> tree) { this.tree = tree; //Build queue traverseQueue = new Queue<AvlTreeNode<T>>(); visitNode(this.tree.Root); } private void visitNode(AvlTreeNode<T> node) { if (node == null) return; else { traverseQueue.Enqueue(node); visitNode(node.LeftChild); visitNode(node.RightChild); } } public T Current { get { return current.Value; } } object IEnumerator.Current { get { return Current; } } public void Dispose() { current = null; tree = null; } public void Reset() { current = null; } public bool MoveNext() { if (traverseQueue.Count > 0) current = traverseQueue.Dequeue(); else current = null; return (current != null); } } The error given by VS2008: Error 1 The type 'T' cannot be used as type parameter 'T' in the generic type or method 'Opdr2_AvlTreeTest_Final.AvlTreeNode'. There is no boxing conversion or type parameter conversion from 'T' to 'System.IComparable'. For now I've not included the tree and node logic. I anybody thinks is necessary to resolve this probleem, just say so! Thx!

    Read the article

< Previous Page | 713 714 715 716 717 718 719 720 721 722 723 724  | Next Page >