Search Results

Search found 19539 results on 782 pages for 'pretty print'.

Page 728/782 | < Previous Page | 724 725 726 727 728 729 730 731 732 733 734 735  | Next Page >

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • Problem setting row backgrounds in Android Listview

    - by zchtodd
    I have an application in which I'd like one row at a time to have a certain color. This seems to work about 95% of the time, but sometimes instead of having just one row with this color, it will allow multiple rows to have the color. Specifically, a row is set to have the "special" color when it is tapped. In rare instances, the last row tapped will retain the color despite a call to setBackgroundColor attempting to make it otherwise. private OnItemClickListener mDirectoryListener = new OnItemClickListener(){ public void onItemClick(AdapterView parent, View view, int pos, long id){ if (stdir.getStationCount() == pos) { stdir.moreStations(); return; } if (playingView != null) playingView.setBackgroundColor(Color.DKGRAY); view.setBackgroundColor(Color.MAGENTA); playingView = view; playStation(pos); } }; I have confirmed with print statements that the code setting the row to gray is always called. Can anyone imagine a reason why this code might intermittently fail? If there is a pattern or condition that causes it, I can't tell. I thought it might have something to do with the activity lifecycle setting the "playingView" variable back to null, but I can't reliably reproduce the problem by switching activities or locking the phone. private class DirectoryAdapter extends ArrayAdapter { private ArrayList<Station> items; public DirectoryAdapter(Context c, int resLayoutId, ArrayList<Station> stations){ super(c, resLayoutId, stations); this.items = stations; } public int getCount(){ return items.size() + 1; } public View getView(int position, View convertView, ViewGroup parent){ View v = convertView; LayoutInflater vi = (LayoutInflater)getContext().getSystemService(Context.LAYOUT_INFLATER_SERVICE); if (position == this.items.size()) { v = vi.inflate(R.layout.morerow, null); return v; } Station station = this.items.get(position); v = vi.inflate(R.layout.songrow, null); if (station.playing) v.setBackgroundColor(Color.MAGENTA); else if (station.visited) v.setBackgroundColor(Color.DKGRAY); else v.setBackgroundColor(Color.BLACK); TextView title = (TextView)v.findViewById(R.id.title); title.setText(station.name); return v; } };

    Read the article

  • Strange compilation error - GAS3 generated class

    - by subh
    I am pretty new to GraniteDS..So far I have been able to successfully configure it to work with my remote java services as well as generate the equivalent AS3 files from my POJO's. But I am getting this strange error while building one of the classes using GAS3 [ERROR] C:\TestGDS_All\TestGDS-flex-remoteobjects\target\generated-sources\com\mycompany\TestGDS\masterdata\model\TankGradesMlBas e.as:[77,29] Syntax error: expecting identifier before use. public function set use(value:String):void { [ERROR] C:\TestGDS_All\TestGDS-flex-remoteobjects\target\generated-sources\com\mycompany\TestGDS\masterdata\model\TankGradesMlBas e.as:[77,52] Syntax error: expecting leftparen before leftbrace. public function set use(value:String):void { [ERROR] C:\TestGDS_All\TestGDS-flex-remoteobjects\target\generated-sources\com\mycompany\TestGDS\masterdata\model\TankGradesMlBas e.as:[77,52] Syntax error: expecting identifier before leftbrace. public function set use(value:String):void { [ERROR] C:\TestGDS_All\TestGDS-flex-remoteobjects\target\generated-sources\com\mycompany\TestGDS\masterdata\model\TankGradesMlBas e.as:[77,52] Syntax error: expecting rightparen before leftbrace. public function set use(value:String):void { [ERROR] C:\TestGDS_All\TestGDS-flex-remoteobjects\target\generated-sources\com\mycompany\TestGDS\masterdata\model\TankGradesMlBas e.as:[80,29] Syntax error: expecting identifier before use. public function get use():String { [ERROR] C:\TestGDS_All\TestGDS-flex-remoteobjects\target\generated-sources\com\mycompany\TestGDS\masterdata\model\TankGradesMlBas e.as:[80,42] Syntax error: expecting leftparen before leftbrace. public function get use():String { [ERROR] C:\TestGDS_All\TestGDS-flex-remoteobjects\target\generated-sources\com\mycompany\TestGDS\masterdata\model\TankGradesMlBas e.as:[80,42] Syntax error: expecting identifier before leftbrace. public function get use():String { [ERROR] C:\TestGDS_All\TestGDS-flex-remoteobjects\target\generated-sources\com\mycompany\TestGDS\masterdata\model\TankGradesMlBas e.as:[80,42] Syntax error: expecting rightparen before leftbrace. public function get use():String { The java class appears like this @Entity` @Table(name = "mmd_tank_grades_ml") @SuppressWarnings("serial") public class TankGradesMl implements Serializable { .... private String use; @Basic @Column(name = "USE", length = 45) public String getUse() { return use; } public void setUse(String use) { this.use = use; } What am I doing wrong? How to resolve this error? I tried by changing the java source variable like below private String usedFor; ---- @Basic @Column(name = "USE", length = 45) public String getUsedFor() { return usedFor; } /** * @param use * new value for use */ public void setUsedFor(String usedFor) { this.usedFor = usedFor; } and the error is gone...not sure why it was throwing exception for 'use'..too small for variable name :-)

    Read the article

  • Which network protocol to use for lightweight notification of remote apps?

    - by Chris Thornton
    I have this situation.... Client-initiated SOAP 1.1 communication between one server and let's say, tens of thousands of clients. Clients are external, coming in through our firewall, authenticated by certificate, https, etc.. They can be anywhere, and usually have their own firewalls, NAT routers, etc... They're truely external, not just remote corporate offices. They could be in a corporate/campus network, DSL/Cable, even Dialup. Client uses Delphi (2005 + SOAP fixes from 2007), and the server is C#, but from an architecture/design standpoint, that shouldn't matter. Currently, clients push new data to the server and pull new data from the server on 15-minute polling loop. The server currently does not push data - the client hits the "messagecount" method, to see if there is new data to pull. If 0, it sleeps for another 15 min and checks again. We're trying to get that down to 7 seconds. If this were an internal app, with one or just a few dozen clients, we'd write a cilent "listener" soap service, and would push data to it. But since they're external, sit behind their own firewalls, and sometimes private networks behind NAT routers, this is not practical. So we're left with polling on a much quicker loop. 10K clients, each checking their messagecount every 10 seconds, is going to be 1000/sec messages that will mostly just waste bandwidth, server, firewall, and authenticator resources. So I'm trying to design something better than what would amount to a self-inflicted DoS attack. I don't think it's practical to have the server send soap messages to the client (push) as this would require too much configuration at the client end. But I think there are alternatives that I don't know about. Such as: 1) Is there a way for the client to make a request for GetMessageCount() via Soap 1.1, and get the response, and then perhaps, "stay on the line" for perhaps 5-10 minutes to get additional responses in case new data arrives? i.e the server says "0", then a minute later in response to some SQL trigger (the server is C# on Sql Server, btw), knows that this client is still "on the line" and sends the updated message count of "5"? 2) Is there some other protocol that we could use to "ping" the client, using information gathered from their last GetMessageCount() request? 3) I don't even know. I guess I'm looking for some magic protocol where the client can send a GetMessageCount() request, which would include info for "oh by the way, in case the answer changes in the next hour, ping me at this address...". Also, I'm assuming that any of these "keep the line open" schemes would seriously impact the server sizing, as it would need to keep many thousands of connections open, simultaneously. That would likely impact the firewalls too, I think. Is there anything out there like that? Or am I pretty much stuck with polling? TIA, Chris

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

  • Where should I initialize variables for an OO Recursive Descent Parse Tree?

    - by Vasto
    I'd like to preface this by stating that this is for a class, so please don't solve this for me. One of my labs for my cse class is creating an interpreter for a BNF that was provided. I understand most of the concepts, but I'm trying to build up my tree and I'm unsure where to initialize values. I've tried in both the constructor, and in the methods but Eclipse's debugger still only shows the left branch, even though it runs through completely. Here is my main procedure so you can get an idea of how I'm calling the methods. public class Parser { public static void main(String[] args) throws IOException { FileTokenizer instance = FileTokenizer.Instance(); FileTokenizer.main(args); Prog prog = new Prog(); prog.ParseProg(); prog.PrintProg(); prog.ExecProg(); } Now here is My Prog class: public class Prog { private DeclSeq ds; private StmtSeq ss; Prog() { ds = new DeclSeq(); ss = new StmtSeq(); } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) // ds = new DeclSeq(); ds.ParseDS(); instance.skipToken(); //Skips begin (2) // ss = new StmtSeq(); ss.ParseSS(); instance.skipToken(); } I've tried having Prog() { ds = null; ss = null; } public void ParseProg() { FileTokenizer instance = FileTokenizer.Instance(); instance.skipToken(); //Skips program (1) ds = new DeclSeq(); ds.ParseDS(); ... But it gave me the same error. I need the parse tree built up so I can do a pretty print and an execute command, but like I said, I only get the left branch. Any help would be appreciated. Explanations why are even more so appreciated. Thank you, Vasto

    Read the article

  • Converting C source to C++

    - by Barry Kelly
    How would you go about converting a reasonably large (300K), fairly mature C codebase to C++? The kind of C I have in mind is split into files roughly corresponding to modules (i.e. less granular than a typical OO class-based decomposition), using internal linkage in lieu private functions and data, and external linkage for public functions and data. Global variables are used extensively for communication between the modules. There is a very extensive integration test suite available, but no unit (i.e. module) level tests. I have in mind a general strategy: Compile everything in C++'s C subset and get that working. Convert modules into huge classes, so that all the cross-references are scoped by a class name, but leaving all functions and data as static members, and get that working. Convert huge classes into instances with appropriate constructors and initialized cross-references; replace static member accesses with indirect accesses as appropriate; and get that working. Now, approach the project as an ill-factored OO application, and write unit tests where dependencies are tractable, and decompose into separate classes where they are not; the goal here would be to move from one working program to another at each transformation. Obviously, this would be quite a bit of work. Are there any case studies / war stories out there on this kind of translation? Alternative strategies? Other useful advice? Note 1: the program is a compiler, and probably millions of other programs rely on its behaviour not changing, so wholesale rewriting is pretty much not an option. Note 2: the source is nearly 20 years old, and has perhaps 30% code churn (lines modified + added / previous total lines) per year. It is heavily maintained and extended, in other words. Thus, one of the goals would be to increase mantainability. [For the sake of the question, assume that translation into C++ is mandatory, and that leaving it in C is not an option. The point of adding this condition is to weed out the "leave it in C" answers.]

    Read the article

  • HTML-like GUI Framework in Java

    - by wintermute
    I was recently brought onto a project where we are developing a lot GUI elements for BlackBerry devices. The standard RIM APIs are pretty basic, almost never do what is required and are difficult or impossible to extend, so we end up re-implementing chunks of it. Currently the code we have isn't super organized and factored so there are lots of little tricks that get implemented over and over again. I had a thought about how to aid development efforts on this platform and wanted to see if the community could tell me if I'm still sane or if I've gone totally nuts. By far, the biggest organizational problem I've run into is making sure that each screen is laid out properly with proper padding and such. The current approach is to manually keep track of padding like so: protected void sublayout(int width, int height) { final int padding = 5; int y = padding; int x = padding; layoutChild(_someChild, width - padding * 2, height / 3 - padding * 2); setPositionChild(_someChild, x, y); y += _someChild.getHeight() + padding; // Calculate where to start drawing next. /* ... snipped ... */ } As you can see, positioning elements on a screen is a nightmare due to the tedium. I have investigated other GUI frameworks but, for a variety of reasons, it is difficult to find one that suites our purposes. One potential solution that came to me is to create a GUI framework who's API resembles HTML/CSS. This would allow for things like padding, margins, borders and colours to be handled through a sort of CSS API while the content would be organized using the HTML part of the API. It might look something like this: public class OptionsScreen extends Document { public OptionsScreen() { // You would set the style (like CSS style) through the constructor. Div content = new Div(new Style(new Padding(5), Color.BLACK)); // Then build up a tree of elements which can each have their own style's. // Each element knows how to draw itself, but it doesn't have to worry about // manually handling things like padding. // content.addChild(new P("This is a paragraph", new Style(new Padding(), Color.RED))); Ul list = new Ul(); list.addChild(new Li("item 1")); list.addChild(new Li("item 2")); content.addChild(list); addChild(content); } } I can imagine this making it easier to customize the UI of our app (which is very important) with different fonts, colours and layouts. Does this idea belong on The Daily WTF or do you think there is some promise?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Generic Type constraint in .net

    - by Jose
    Okay I'm looking for some input, I'm pretty sure this is not currently supported in .NET 3.5 but here goes. I want to require a generic type passed into my class to have a constructor like this: new(IDictionary<string,object>) so the class would look like this public MyClass<T> where T : new(IDictionary<string,object>) { T CreateObject(IDictionary<string,object> values) { return new T(values); } } But the compiler doesn't support this, it doesn't really know what I'm asking. Some of you might ask, why do you want to do this? Well I'm working on a pet project of an ORM so I get values from the DB and then create the object and load the values. I thought it would be cleaner to allow the object just create itself with the values I give it. As far as I can tell I have two options: 1) Use reflection(which I'm trying to avoid) to grab the PropertyInfo[] array and then use that to load the values. 2) require T to support an interface like so: public interface ILoadValues { void LoadValues(IDictionary values); } and then do this public MyClass<T> where T:new(),ILoadValues { T CreateObject(IDictionary<string,object> values) { T obj = new T(); obj.LoadValues(values); return obj; } } The problem I have with the interface I guess is philosophical, I don't really want to expose a public method for people to load the values. Using the constructor the idea was that if I had an object like this namespace DataSource.Data { public class User { protected internal User(IDictionary<string,object> values) { //Initialize } } } As long as the MyClass<T> was in the same assembly the constructor would be available. I personally think that the Type constraint in my opinion should ask (Do I have access to this constructor? I do, great!) Anyways any input is welcome.

    Read the article

  • Java NoSuchElementException using scanner.nextInt()

    - by othnin
    I am trying to read in a pgm file (512x512 array) and when I read in a larger file I get the error: java.util.NoSuchElementException on reading element (3,97). I have created a much smaller file to read (23x23) and it reads fine. Is there a size limit? I have checked the file and confirmed that there is an int for the value: This appears to be the line it crashes at: fileArray[row][col] = scan.nextInt(); Here is the file: import java.util.Scanner; import java.io.*; public class FileReader { public static void main(String[] args) throws IOException { String fileName = "lena.pgma"; int width, height, maxValue; FileInputStream fileInputStream = null; fileInputStream = new FileInputStream(fileName); Scanner scan = new Scanner(fileInputStream); // Discard the magic number scan.nextLine(); // Discard the comment line scan.nextLine(); // Read pic width, height and max value width = scan.nextInt(); System.out.println("Width: " + width); height = scan.nextInt(); System.out.println("Heigth: " + height); maxValue = scan.nextInt(); fileInputStream.close(); // Now parse the file as binary data FileInputStream fin = new FileInputStream(fileName); DataInputStream dis = new DataInputStream(fin); // look for 4 lines (i.e.: the header) and discard them int numnewlines = 4; while (numnewlines > 0) { char c; do { c = (char)(dis.readUnsignedByte()); } while (c != '\n'); numnewlines--; } // read the image data int[][] fileArray = new int[height][width]; for (int row = 0; row < height; row++) { for (int col = 0; col < width; col++) { fileArray[row][col] = scan.nextInt(); System.out.print("(" + row + " ," + col +"): " + fileArray[row][col]+ " "); } System.out.println(); } dis.close(); } } any advise would be appreciated.

    Read the article

  • using Object input\ output Streams with files and array list

    - by soad el-hayek
    hi every one .. i'm an it student , and it's time to finish my final project in java , i've faced too many problems , this one i couldn't solve it and i'm really ubset ! :S my code is like this : in Admin class : public ArrayList cos_info = new ArrayList(); public ArrayList cas_info = new ArrayList(); public int cos_count = 0 ; public int cas_count = 0 ; void coustmer_acount() throws FileNotFoundException, IOException{ String add=null; do{ person p = new person() ; cos_info.add(cos_count, p); cos_count ++ ; add =JOptionPane.showInputDialog("Do you want to add more coustmer..\n'y'foryes ..\n 'n'for No .."); } while(add.charAt(0) == 'Y'||add.charAt(0)=='y'); writenew_cos(); // add_acounts(); } void writenew_cos() throws IOException{ ObjectOutputStream aa = new ObjectOutputStream(new FileOutputStream("coustmer.txt")); aa.writeObject(cos_info); JOptionPane.showMessageDialog(null,"Added to file done sucessfuly.."); aa.close(); } in Coustmer class : void read_cos() throws IOException, ClassNotFoundException{ person p1= null ; int array_count = 0; ObjectInputStream d = new ObjectInputStream(new FileInputStrea ("coustmer.txt")); JOptionPane.showMessageDialog(null,d.available() ); for(int i = 0;d.available() == 0;i++){ a.add(array_count,(ArrayList) d.readObject()); array_count++; JOptionPane.showMessageDialog(null,"Haaaaai :D" ); JOptionPane.showMessageDialog(null,array_count ); } d.close(); JOptionPane.showMessageDialog(null,array_count +"1111" ); for(int i = 0 ; i<a.size()&& found!= true ; i++){ count++ ; p1 =(person)a.get(i); user=p1.user; pass = p1.pass; cas_checkpass(); } } it just print JOptionPane.showMessageDialog(null,d.available() ); and having excep. here a.add(array_count,(ArrayList) d.readObject()); p.s : person object from my own class and it's Serializabled

    Read the article

  • How do we simplify this kind of code in Java? Something like macros in C?

    - by Terry Li
    public static boolean diagonals(char[][] b, int row, int col, int l) { int counter = 1; // because we start from the current position char charAtPosition = b[row][col]; int numRows = b.length; int numCols = b[0].length; int topleft = 0; int topright = 0; int bottomleft = 0; int bottomright = 0; for (int i=row-1,j=col-1;i>=0 && j>=0;i--,j--) { if (b[i][j]==charAtPosition) { topleft++; } else { break; } } for (int i=row-1,j=col+1;i>=0 && j<=numCols;i--,j++) { if (b[i][j]==charAtPosition) { topright++; } else { break; } } for (int i=row+1,j=col-1;i<=numRows && j>=0;i++,j--) { if (b[i][j]==charAtPosition) { bottomleft++; } else { break; } } for (int i=row+1,j=col+1;i<=numRows && j<=numCols;i++,j++) { if (b[i][j]==charAtPosition) { bottomright++; } else { break; } } return topleft + bottomright + 1 >= l || topright + bottomleft + 1 >= l; //in this case l is 5 } After I was done posting the code above here, I couldn't help but wanted to simplify the code by merging the four pretty much the same loops into one method. Here's the kind of method I want to have: public int countSteps(char horizontal, char vertical) { } Two parameters horizontal and vertical can be either + or - to indicate the four directions to walk in. What I want to see if possible at all is i++; is generalized to i horizontal horizontal; when horizontal taking the value of +. What I don't want to see is if or switch statements, for example: public int countSteps(char horizontal, char vertical) { if (horizontal == '+' && vertical == '-') { for (int i=row-1,j=col+1;i>=0 && j<=numCols;i--,j++) { if (b[i][j]==charAtPosition) { topright++; } else { break; } } } else if (horizontal == '+' && vertical == '+') { for (int i=row+1,j=col+1;i>=0 && j<=numCols;i++,j++) { if (b[i][j]==charAtPosition) { topright++; } else { break; } } } else if () { } else { } } Since it is as tedious as the original one. Note also that the comparing signs for the loop condition i>=0 && j<=numCols; for example, >= && <= have correspondence with the value combination of horizontal and vertical. Sorry for my bad wording, please let me know if anything is not clear.

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • Autoconf -- building with static library (newbie)

    - by EB
    I am trying to migrate my application from manual build to autoconf, which is working very nicely so far. But I have one static library that I can't figure out how to integrate. That library will NOT be located in the usual library locations - the location of the binary (.a file) and header (.h file) will be given as a configure argument. (Notably, even if I move the .a file to /usr/lib or anywhere else I can think of, it still won't work.) It is also not named traditionally (it does not start with "lib" or "l"). Manual compilation is working with these (directory is not predictable - this is just an example): gcc ... -I/home/john/mystuff /home/john/mystuff/helper.a (Uh, I actually don't understand why the .a file is referenced directly, not with -L or anything. Yes, I have a half-baked understanding of building C programs.) So, in my configure.ac, I can use the relevant configure argument to successfully find the header (.h file) using AC_CHECK_HEADER. Inside the AC_CHECK_HEADER I then add the location to CPFLAGS and the #include of the header file in the actual C code picks it up nicely. Given a configure argument that has been put into $location and the name of the needed files are helper.h and helper.a (which are both in the same directory), here is what works so far: AC_CHECK_HEADER([$location/helper.h], [AC_DEFINE([HAVE_HELPER_H], [1], [found helper.h]) CFLAGS="$CFLAGS -I$location"]) Where I run into difficulties is getting the binary (.a file) linked in. No matter what I try, I always get an error about undefined references to the function calls for that library. I'm pretty sure it's a linkage issue, because I can fuss with the C code and make an intentional error in the function calls to that library which produces earlier errors that indicate that the function prototypes have been loaded and used to compile. I tried adding the location that contains the .a file to LDFLAGS and then doing a AC_CHECK_LIB but it is not found. Maybe my syntax is wrong, or maybe I'm missing something more fundamental, which would not be surprising since I'm a newbie and don't really know what I'm doing. Here is what I have tried: AC_CHECK_HEADER([$location/helper.h], [AC_DEFINE([HAVE_HELPER_H], [1], [found helper.h]) CFLAGS="$CFLAGS -I$location"; LDFLAGS="$LDFLAGS -L$location"; AC_CHECK_LIB(helper)]) No dice. AC_CHECK_LIB is looking for -lhelper I guess (or libhelper?) so I'm not sure if that's a problem, so I tried this, too (omit AC_CHECK_LIB and include the .a directly in LDFLAGS), without luck: AC_CHECK_HEADER([$location/helper.h], [AC_DEFINE([HAVE_HELPER_H], [1], [found helper.h]) CFLAGS="$CFLAGS -I$location"; LDFLAGS="$LDFLAGS -L$location/helper.a"]) To emulate the manual compilation, I tried removing the -L but that doesn't help: AC_CHECK_HEADER([$location/helper.h], [AC_DEFINE([HAVE_HELPER_H], [1], [found helper.h]) CFLAGS="$CFLAGS -I$location"; LDFLAGS="$LDFLAGS $location/helper.a"]) I tried other combinations and permutations, but I think I might be missing something more fundamental....

    Read the article

  • C++ Undeclared Identifier (but it is declared?)

    - by Joshua
    I'm pretty sure I've included the qanda class, but when I try to declare a vector that contains it or a class of that type I get an error saying that qanda is undefined. Any idea what the problem might be? bot_manager_item.h #pragma once #include "../bot_packet/bot_packet.h" #include <vector> class bot_manager_item; #include "qanda.h" #include "bot_manager.h" class bot_manager_item { public: bot_manager_item(bot_manager* mngr, const char* name, const char* work_dir); ~bot_manager_item(); bool startup(); void cleanup(); void on_push_event(bot_exchange_format f); bool disable; private: void apply_changes(); bot_manager *_mngr; std::string _name; std::string _work_dir; std::string _message; std::string _message_copy; std::vector<qanda> games; qanda test; char _config_full_path[2600]; }; qanda.h #ifndef Q_AND_A #define Q_AND_A #include "users.h" #include "..\bot_packet\bot_packet.h" #include "bot_manager.h" #include <string> #include <algorithm> #include <map> #include <vector> #include <fstream> class qanda { public: qanda(bot_manager * manager, std::string name, std::string directory); ~qanda(){}; void room_message(std::string username, std::string user_message); void timer_tick(); private: // data members std::string question; std::string answer; std::string directory; std::string command_prefix; std::string name; Users users; std::map <std::string, std::string> questions_and_answers; int time_per_question; // seconds int time_between_questions; // seconds int timer; // milliseconds bool is_delayed; bool is_playing; bot_manager * manager; // functions void new_question(); void send_message(std::string msg); void announce_question(); void load_questions(); }; #endif

    Read the article

  • R: Plotting a graph with different colors of points based on advanced criteria

    - by balconydoor
    What I would like to do is a plot (using ggplot), where the x axis represent years which have a different colour for the last three years in the plot than the rest. The last three years should also meet a certain criteria and based on this the last three years can either be red or green. The criteria is that the mean of the last three years should be less (making it green) or more (making it red) than the 66%-percentile of the remaining years. So far I have made two different functions calculating the last three year mean: LYM3 <- function (x) { LYM3 <- tail(x,3) mean(LYM3$Data,na.rm=T) } And the 66%-percentile for the remaining: perc66 <- function(x) { percentile <- head(x,-3) quantile(percentile$Data, .66, names=F,na.rm=T) } Here are two sets of data that can be used in the calculations (plots), the first which is an example from my real data where LYM3(df1) < perc66(df1) and the second is just made up data where LYM3 perc66. df1<- data.frame(Year=c(1979:2010), Data=c(347261.87, 145071.29, 110181.93, 183016.71, 210995.67, 205207.33, 103291.78, 247182.10, 152894.45, 170771.50, 206534.55, 287770.86, 223832.43, 297542.86, 267343.54, 475485.47, 224575.08, 147607.81, 171732.38, 126818.10, 165801.08, 136921.58, 136947.63, 83428.05, 144295.87, 68566.23, 59943.05, 49909.08, 52149.11, 117627.75, 132127.79, 130463.80)) df2 <- data.frame(Year=c(1979:2010), Data=c(sample(50,29,replace=T),75,75,75)) Here’s my code for my plot so far: plot <- ggplot(df1, aes(x=Year, y=Data)) + theme_bw() + geom_point(size=3, aes(colour=ifelse(df1$Year<2008, "black",ifelse(LYM3(df1) < perc66(df1),"green","red")))) + geom_line() + scale_x_continuous(breaks=c(1980,1985,1990,1995,2000,2005,2010), limits=c(1978,2011)) plot As you notice it doesn’t really do what I want it to do. The only thing it does seem to do is that it turns the years before 2008 into one level and those after into another one and base the point colour off these two levels. Since I don’t want this year to be stationary either, I made another tiny function: fun3 <- function(x) { df <- subset(x, Year==(max(Year)-2)) df$Year } So the previous code would have the same effect as: geom_point(size=3, aes(colour=ifelse(df1$Year<fun3(df1), "black","red"))) But it still does not care about my colours. Why does it make the years into levels? And how come an ifelse function doesn’t work within another one in this case? How would it be possible to the arguments to do what I like? I realise this might be a bit messy, asking for a lot at the same time, but I hope my description is pretty clear. It would be helpful if someone could at least point me in the right direction. I tried to put the code for the plot into a function as well so I wouldn’t have to change the data frame at all functions within the plot, but I can’t get it to work. Thank you!

    Read the article

  • MFC: Reading entire file to buffer...

    - by deostroll
    I've meddled with some code but I am unable to read the entire file properly...a lot of junk gets appended to the output. How do I fix this? // wmfParser.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include "wmfParser.h" #include <cstring> #ifdef _DEBUG #define new DEBUG_NEW #endif // The one and only application object CWinApp theApp; using namespace std; int _tmain(int argc, TCHAR* argv[], TCHAR* envp[]) { int nRetCode = 0; // initialize MFC and print and error on failure if (!AfxWinInit(::GetModuleHandle(NULL), NULL, ::GetCommandLine(), 0)) { // TODO: change error code to suit your needs _tprintf(_T("Fatal Error: MFC initialization failed\n")); nRetCode = 1; } else { // TODO: code your application's behavior here. CFile file; CFileException exp; if( !file.Open( _T("c:\\sample.txt"), CFile::modeRead, &exp ) ){ exp.ReportError(); cout<<'\n'; cout<<"Aborting..."; system("pause"); return 0; } ULONGLONG dwLength = file.GetLength(); cout<<"Length of file to read = " << dwLength << '\n'; /* BYTE* buffer; buffer=(BYTE*)calloc(dwLength, sizeof(BYTE)); file.Read(buffer, 25); char* str = (char*)buffer; cout<<"length of string : " << strlen(str) << '\n'; cout<<"string from file: " << str << '\n'; */ char str[100]; file.Read(str, sizeof(str)); cout << "Data : " << str <<'\n'; file.Close(); cout<<"File was closed\n"; //AfxMessageBox(_T("This is a test message box")); system("pause"); } return nRetCode; }

    Read the article

  • c++ i need help with this program. everytime i try to run it, i got a problem

    - by FOXMULDERIZE
    1-the program must read numeric data from a file. 2-only one line per number 3-half way between those numbers is a negative number. 4-the program must sum those who are above the negative number in a acumulator an those below the negative number in another acumulator. 5-the black screen shall print both results and determined who is grater or equal. include include using namespace std; void showvalues(int,int,int[]); void showvalues2(int,int); void sumtotal(int,int); int main() { int total1=0; int total2=0; const int SIZE_A= 9; int arreglo[SIZE_A]; int suma,total,a,b,c,d,e,f; ifstream archivo_de_entrada; archivo_de_entrada.open("numeros.txt"); //lee/// for(int count =0 ;count < SIZE_A;count++) archivo_de_entrada>>arreglo[count] ; archivo_de_entrada.close(); showvalues(0,3,arreglo); showvalues2(5,8); sumtotal(total1,total2); system("pause"); return 0; } void showvalues(int a,int b,int arreglos) { int total1=0; //muestra//////////////////////// cout<< "los num son "; for(int count = a ;count <= b;count++) total1 += arreglos[count]; cout < } void showvalues2(int c,int d) { ////////////////////////////// int total2=0; cout<< "los num 2 son "; for(count =5 ;count <=8;count++) total2 = total2 + arreglo[count]; cout < void sumtotal(int e,int f) { ///////////////////////////////// cout<<"la suma de t1 y t2 es "; total= total1 + total2; cout< }

    Read the article

  • disable dates using jquery inside gridview control

    - by bladerunner
    Hi there, I have a gridview which contains a textbox control. I need to show the calendar for the user to pick the date and certain dates are to be disabled using jquery. I found a post on stackoverflow that talked about how to disable certain dates. I am done with that part, except not sure how to pass the textbox control to this jquery function. Here is the code. <script type="text/javascript" language="javascript"> function pageLoad(sender, args) { var enabledDays = ['09/21/2011', '10/05/2011', '10/19/2011', '11/02/2011', '11/16/2011']; /* utility functions */ function editDays(date) { for (var i = 0; i < enabledDays.length; i++) { if (new Date(enabledDays[i]).toString() == date.toString()) { return [true]; } } return [false]; } /* create datepicker */ $(document).ready(function() { $('#<%= txtInHomeDate.ClientID %>').datepicker({ beforeShow: springDate, beforeShowDay: editDays, dateFormat: 'mm/dd/yy', buttonImage: 'images/cal.gif', buttonText: 'Choose date', firstDay: 1, buttonImageOnly: true, showOn: 'both', showAnim: 'fadeIn', onSelect: function() { $(this).trigger("onchange", null); } }); function springDate() { var defaultMin = new Date(); var defaultMax = new Date(); var Min = defaultMin; var Max = defaultMax; // make valid date from hiddenfied value format is MM/dd/yyyy dateMin = $('#<%= hfStDate.ClientID %>').val(); dateMin = new Date(dateMin); dateMax = $('#<%= hfEndDate.ClientID %>').val(); dateMax = new Date(dateMax); if (dateMin && dateMax) { Min = new Date(dateMin.getFullYear(), dateMin.getMonth(), dateMin.getDate()); Max = new Date(dateMax.getFullYear(), dateMax.getMonth(), dateMax.getDate()); } return { minDate: Min, maxDate: Max }; } }); } <.... <asp:TemplateField HeaderText="In-Home Date"> <ItemStyle HorizontalAlign="Center" /> <ItemTemplate> <asp:HiddenField ID="hfStDate" runat="server" Value="09/01/2011" /> <asp:HiddenField ID="hfEndDate" runat="server" Value="11/30/2011" /> <asp:TextBox ID="txtInHomeDate" runat="server" /> </ItemTemplate> </asp:TemplateField> Currently, it errors out since the jquery function won't find the txtInHomeDate. Could I get some help as I am pretty close to get this done? Thanks!!

    Read the article

  • Patterns: Local Singleton vs. Global Singleton?

    - by Mike Rosenblum
    There is a pattern that I use from time to time, but I'm not quite sure what it is called. I was hoping that the SO community could help me out. The pattern is pretty simple, and consists of two parts: A singleton factory, which creates objects based on the arguments passed to the factory method. Objects created by the factory. So far this is just a standard "singleton" pattern or "factory pattern". The issue that I'm asking about, however, is that the singleton factory in this case maintains a set of references to every object that it ever creates, held within a dictionary. These references can sometimes be strong references and sometimes weak references, but it can always reference any object that it has ever created. When receiving a request for a "new" object, the factory first searches the dictionary to see if an object with the required arguments already exits. If it does, it returns that object, if not, it returns a new object and also stores a reference to the new object within the dictionary. This pattern prevents having duplicative objects representing the same underlying "thing". This is useful where the created objects are relatively expensive. It can also be useful where these objects perform event handling or messaging - having one object per item being represented can prevent multiple messages/events for a single underlying source. There are probably other reasons to use this pattern, but this is where I've found this useful. My question is: what to call this? In a sense, each object is a singleton, at least with respect to the data it contains. Each is unique. But there are multiple instances of this class, however, so it's not at all a true singleton. In my own personal terminology, I tend to call the factory method a "global singleton". I then call the created objects "local singletons". I sometimes also say that the created objects have "reference equality", meaning that if two variables reference the same data (the same underlying item) then the reference they each hold must be to the same exact object, hence "reference equality". But these are my own invented terms, and I am not sure that they are good ones. Is there standard terminology for this concept? And if not, could some naming suggestions be made? Thanks in advance...

    Read the article

  • MySQL LEFT OUTER JOIN virtual table

    - by user1707323
    I am working on a pretty complicated query let me try to explain it to you. Here is the tables that I have in my MySQL database: students Table --- `students` --- student_id first_name last_name current_status status_change_date ------------ ------------ ----------- ---------------- -------------------- 1 John Doe Active NULL 2 Jane Doe Retread 2012-02-01 students_have_courses Table --- `students_have_courses` --- students_student_id courses_course_id s_date e_date int_date --------------------- ------------------- ---------- ---------- ----------- 1 1 2012-01-01 2012-01-04 2012-01-05 1 2 2012-01-05 NULL NULL 2 1 2012-01-10 2012-01-11 NULL students_have_optional_courses Table --- `students_have_optional_courses` --- students_student_id optional_courses_opcourse_id s_date e_date --------------------- ------------------------------ ---------- ---------- 1 1 2012-01-02 2012-01-03 1 1 2012-01-06 NULL 1 5 2012-01-07 NULL Here is my query so far SELECT `students_and_courses`.student_id, `students_and_courses`.first_name, `students_and_courses`.last_name, `students_and_courses`.courses_course_id, `students_and_courses`.s_date, `students_and_courses`.e_date, `students_and_courses`.int_date, `students_have_optional_courses`.optional_courses_opcourse_id, `students_have_optional_courses`.s_date, `students_have_optional_courses`.e_date FROM ( SELECT `c_s_a_s`.student_id, `c_s_a_s`.first_name, `c_s_a_s`.last_name, `c_s_a_s`.courses_course_id, `c_s_a_s`.s_date, `c_s_a_s`.e_date, `c_s_a_s`.int_date FROM ( SELECT `students`.student_id, `students`.first_name, `students`.last_name, `students_have_courses`.courses_course_id, `students_have_courses`.s_date, `students_have_courses`.e_date, `students_have_courses`.int_date FROM `students` LEFT OUTER JOIN `students_have_courses` ON ( `students_have_courses`.`students_student_id` = `students`.`student_id` AND (( `students_have_courses`.`s_date` >= `students`.`status_change_date` AND `students`.current_status = 'Retread' ) OR `students`.current_status = 'Active') ) WHERE `students`.current_status = 'Active' OR `students`.current_status = 'Retread' ) `c_s_a_s` ORDER BY `c_s_a_s`.`courses_course_id` DESC ) `students_and_courses` LEFT OUTER JOIN `students_have_optional_courses` ON ( `students_have_optional_courses`.students_student_id = `students_and_courses`.student_id AND `students_have_optional_courses`.s_date >= `students_and_courses`.s_date AND `students_have_optional_courses`.e_date IS NULL ) GROUP BY `students_and_courses`.student_id; What I want to be returned is the student_id, first_name, and last_name for all Active or Retread students and then LEFT JOIN the highest course_id, s_date, e_date, and int_date for the those students where the s_date is since the status_change_date if status is 'Retread'. Then LEFT JOIN the highest optional_courses_opcourse_id, s_date, and e_date from the students_have_optional_courses TABLE where the students_have_optional_courses.s_date is greater or equal to the students_have_courses.s_date and the students_have_optional_courses.e_date IS NULL Here is what is being returned: student_id first_name last_name courses_course_id s_date e_date int_date optional_courses_opcourse_id s_date_1 e_date_1 ------------ ------------ ----------- ------------------- ---------- ---------- ------------ ------------------------------ ---------- ---------- 1 John Doe 2 2012-01-05 NULL NULL 1 2012-01-06 NULL 2 Jane Doe NULL NULL NULL NULL NULL NULL NULL Here is what I want being returned: student_id first_name last_name courses_course_id s_date e_date int_date optional_courses_opcourse_id s_date_1 e_date_1 ------------ ------------ ----------- ------------------- ---------- ---------- ------------ ------------------------------ ---------- ---------- 1 John Doe 2 2012-01-05 NULL NULL 5 2012-01-07 NULL 2 Jane Doe NULL NULL NULL NULL NULL NULL NULL Everything is working except one thing, I cannot seem to get the highest students_have_optional_courses.optional_courses_opcourse_id no matter how I form the query Sorry, I just solved this myself after writing this all out I think it helped me think of the solution. Here is the solution query: SELECT `students_and_courses`.student_id, `students_and_courses`.first_name, `students_and_courses`.last_name, `students_and_courses`.courses_course_id, `students_and_courses`.s_date, `students_and_courses`.e_date, `students_and_courses`.int_date, `students_optional_courses`.optional_courses_opcourse_id, `students_optional_courses`.s_date, `students_optional_courses`.e_date FROM ( SELECT `c_s_a_s`.student_id, `c_s_a_s`.first_name, `c_s_a_s`.last_name, `c_s_a_s`.courses_course_id, `c_s_a_s`.s_date, `c_s_a_s`.e_date, `c_s_a_s`.int_date FROM ( SELECT `students`.student_id, `students`.first_name, `students`.last_name, `students_have_courses`.courses_course_id, `students_have_courses`.s_date, `students_have_courses`.e_date, `students_have_courses`.int_date FROM `students` LEFT OUTER JOIN `students_have_courses` ON ( `students_have_courses`.`students_student_id` = `students`.`student_id` AND (( `students_have_courses`.`s_date` >= `students`.`status_change_date` AND `students`.current_status = 'Retread' ) OR `students`.current_status = 'Active') ) WHERE `students`.current_status = 'Active' OR `students`.current_status = 'Retread' ) `c_s_a_s` ORDER BY `c_s_a_s`.`courses_course_id` DESC ) `students_and_courses` LEFT OUTER JOIN ( SELECT * FROM `students_have_optional_courses` ORDER BY `students_have_optional_courses`.optional_courses_opcourse_id DESC ) `students_optional_courses` ON ( `students_optional_courses`.students_student_id = `students_and_courses`.student_id AND `students_optional_courses`.s_date >= `students_and_courses`.s_date AND `students_optional_courses`.e_date IS NULL ) GROUP BY `students_and_courses`.student_id;

    Read the article

  • Extend argparse to write set names in the help text for optional argument choices and define those sets once at the end

    - by Kent
    Example of the problem If I have a list of valid option strings which is shared between several arguments, the list is written in multiple places in the help string. Making it harder to read: def main(): elements = ['a', 'b', 'c', 'd', 'e', 'f'] parser = argparse.ArgumentParser() parser.add_argument( '-i', nargs='*', choices=elements, default=elements, help='Space separated list of case sensitive element names.') parser.add_argument( '-e', nargs='*', choices=elements, default=[], help='Space separated list of case sensitive element names to ' 'exclude from processing') parser.parse_args() When running the above function with the command line argument --help it shows: usage: arguments.py [-h] [-i [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]]] [-e [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]]] optional arguments: -h, --help show this help message and exit -i [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]] Space separated list of case sensitive element names. -e [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]] Space separated list of case sensitive element names to exclude from processing What would be nice It would be nice if one could define an option list name, and in the help output write the option list name in multiple places and define it last of all. In theory it would work like this: def main_optionlist(): elements = ['a', 'b', 'c', 'd', 'e', 'f'] # Two instances of OptionList are equal if and only if they # have the same name (ALFA in this case) ol = OptionList('ALFA', elements) parser = argparse.ArgumentParser() parser.add_argument( '-i', nargs='*', choices=ol, default=ol, help='Space separated list of case sensitive element names.') parser.add_argument( '-e', nargs='*', choices=ol, default=[], help='Space separated list of case sensitive element names to ' 'exclude from processing') parser.parse_args() And when running the above function with the command line argument --help it would show something similar to: usage: arguments.py [-h] [-i [ALFA [ALFA ...]]] [-e [ALFA [ALFA ...]]] optional arguments: -h, --help show this help message and exit -i [ALFA [ALFA ...]] Space separated list of case sensitive element names. -e [ALFA [ALFA ...]] Space separated list of case sensitive element names to exclude from processing sets in optional arguments: ALFA {a,b,c,d,e,f} Question I need to: Replace the {'l', 'i', 's', 't', 's'} shown with the option name, in the optional arguments. At the end of the help text show a section explaining which elements each option name consists of. So I ask: Is this possible using argparse? Which classes would I have to inherit from and which methods would I need to override? I have tried looking at the source for argparse, but as this modification feels pretty advanced I don´t know how to get going.

    Read the article

  • What regular expression(s) would I use to remove escaped html from large sets of data.

    - by Elizabeth Buckwalter
    Our database is filled with articles retrieved from RSS feeds. I was unsure of what data I would be getting, and how much filtering was already setup (WP-O-Matic Wordpress plugin using the SimplePie library). This plugin does some basic encoding before insertion using Wordpress's built in post insert function which also does some filtering. I've figured out most of the filters before insertion, but now I have whacko data that I need to remove. This is an example of whacko data that I have data in one field which the content I want in the front, but this part removed which is at the end: <img src="http://feeds.feedburner.com/~ff/SoundOnTheSound?i=xFxEpT2Add0:xFbIkwGc-fk:V_sGLiPBpWU" border="0"></img> <img src="http://feeds.feedburner.com/~ff/SoundOnTheSound?d=qj6IDK7rITs" border="0"></img> &lt;img src=&quot;http://feeds.feedburner.com/~ff/SoundOnTheSound?i=xFxEpT2Add0:xFbIkwGc-fk:D7DqB2pKExk&quot; Notice how some of the images are escape and some aren't. I believe this has to do with the last part being cut off so as to be unrecognizable as an html tag, which then caused it to be html endcoded. Another field has only this which is now filtered before insertion, but I have to get rid of the others: &lt;img src=&quot;http://farm3.static.flickr.com/2183/2289902369_1d95bcdb85.jpg&quot; alt=&quot;post_img&quot; width=&quot;80&quot; (all examples are on one line, but broken up for readability) Question: What is the best way to work with the above escaped html (or portion of an html tag)? I can do it in Perl, PHP, SQL, Ruby, and even Python. I believe Perl to be the best at text parsing, so that's why I used the Perl tag. And PHP times out on large database operations, so that's pretty much out unless I wanted to do batch processing and what not. PS One of the nice things about using Wordpress's insert post function, is that if you use php's strip_tags function to strip out all html, insert post function will insert <p> at the paragraph points. Let me know if there's anything more that I can answer. Some article that didn't quite answer my questions. (http://stackoverflow.com/questions/2016751/remove-text-from-within-a-database-text-field) (http://stackoverflow.com/questions/462831/regular-expression-to-escape-html-ampersands-while-respecting-cdata)

    Read the article

  • BufferedReader no longer buffering after a while?

    - by BobTurbo
    Sorry I can't post code but I have a bufferedreader with 50000000 bytes set as the buffer size. It works as you would expect for half an hour, the HDD light flashing every two minutes or so, reading in the big chunk of data, and then going quiet again as the CPU processes it. But after about half an hour (this is a very big file), the HDD starts thrashing as if it is reading one byte at a time. It is still in the same loop and I think I checked free ram to rule out swapping (heap size is default). Probably won't get any helpful answers, but worth a try. OK I have changed heap size to 768mb and still nothing. There is plenty of free memory and java.exe is only using about 300mb. Now I have profiled it and heap stays at about 200MB, well below what is available. CPU stays at 50%. Yet the HDD starts thrashing like crazy. I have.. no idea. I am going to rewrite the whole thing in c#, that is my solution. Here is the code (it is just a throw-away script, not pretty): BufferedReader s = null; HashMap<String, Integer> allWords = new HashMap<String, Integer>(); HashSet<String> pageWords = new HashSet<String>(); long[] pageCount = new long[78592]; long pages = 0; Scanner wordFile = new Scanner(new BufferedReader(new FileReader("allWords.txt"))); while (wordFile.hasNext()) { allWords.put(wordFile.next(), Integer.parseInt(wordFile.next())); } s = new BufferedReader(new FileReader("wikipedia/enwiki-latest-pages-articles.xml"), 50000000); StringBuilder words = new StringBuilder(); String nextLine = null; while ((nextLine = s.readLine()) != null) { if (a.matcher(nextLine).matches()) { continue; } else if (b.matcher(nextLine).matches()) { continue; } else if (c.matcher(nextLine).matches()) { continue; } else if (d.matcher(nextLine).matches()) { nextLine = s.readLine(); if (e.matcher(nextLine).matches()) { if (f.matcher(s.readLine()).matches()) { pageWords.addAll(Arrays.asList(words.toString().toLowerCase().split("[^a-zA-Z]"))); words.setLength(0); pages++; for (String word : pageWords) { if (allWords.containsKey(word)) { pageCount[allWords.get(word)]++; } else if (!word.isEmpty() && allWords.containsKey(word.substring(0, word.length() - 1))) { pageCount[allWords.get(word.substring(0, word.length() - 1))]++; } } pageWords.clear(); } } } else if (g.matcher(nextLine).matches()) { continue; } words.append(nextLine); words.append(" "); }

    Read the article

< Previous Page | 724 725 726 727 728 729 730 731 732 733 734 735  | Next Page >