Search Results

Search found 31681 results on 1268 pages for 'javascript engine'.

Page 729/1268 | < Previous Page | 725 726 727 728 729 730 731 732 733 734 735 736  | Next Page >

  • How do I cache jQuery selections?

    - by David
    I need to cache about 100 different selections for animating. The following is sample code. Is there a syntax problem in the second sample? If this isn't the way to cache selections, it's certainly the most popular on the interwebs. So, what am I missing? note: p in the $.path.bezier(p) below is a correctly declared object passed to jQuery.path.bezier (awesome animation library, by the way) This works $(document).ready(function() { animate1(); animate2(); }) function animate1() { $('#image1').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $('#image2').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); } This doesn't work var $one = $('#image1'); //problem with syntax here?? var $two = $('#image2'); $(document).ready(function() { animate1(); animate2(); }) function animate1() { $one.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $two.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); }

    Read the article

  • Is this possible?

    - by Stud33
    I want to incorporate some Accelerometer code into a Android application im working and want to see if this is possible. Basically what I need is for the code to detect car acceleration motion. I am not wanting to determine speed with the code but just distinguish if the phone is in a car and has accelerated motion (Hence the car is moving for the first time). I have gone through many different accelerometer applications to see if this motion produces a viable profile to go off of and it appears it does. Just looking for something that popups a "Hello World" dialog when it detects your in the car and its moving for the first time down the street. Any help would be appreciated and a simple yes or no its possible would work. I would also be interested in compensating anyone that is capable of doing this as well. I need this done like yesterday so please let me know. Thank You, JTW

    Read the article

  • Define and send a JSON object array

    - by Eric
    I'm looking for a way to define and send a JSON object array. I've figured out how to define a single JSON object, turn it into a string and send it, but what about an array of this type? Probably something simple I'm overlooking... var myColumnSetting = { "ColumnName": name, "ColumnIndex": index } convert it to a string var myJSONText = JSON.stringify(myColumnSetting, false);

    Read the article

  • Looking for a jquery plugin to serialize a form to an object

    - by John
    I'm looking for a jQuery function or plugin that serializes form inputs to an object using the naming convention for deep-serialization supported by param() in jQuery 1.4: <form> <input name="a[b]" value="1"/> <input name="a[c]" value="2"/> <input name="d[]" value="3"/> <input name="d[]" value="4"/> <input name="d[2][e]" value="5"/> </form> $('form').serializeObject(); // { a: { b:1,c:2 }, d: [3,4,{ e:5 }] } Prototype's Form.serialize method can do exactly this. What's the jQuery equivalent? I found this plugin but it doesn't follow this naming convention.

    Read the article

  • onclick from an Object's button doesn't work

    - by 730
    I instantiate an object, with an argument which is a button. When the button of an instance is clicked, it should run a function, but it doesn't. In the full version of the code, Chrome gives this message in the console: "Uncaught TypeError: Cannot read property 'onclick' of undefined" HTML: <textarea id='txt' readonly rows='5' cols='40'></textarea> <button id='btn' type='button'>click</button> JS: var btn = document.getElementById('btn'); var txt = document.getElementById('txt'); var foo = new Foo(btn); function Foo(btn) { this.button = btn; } Foo.prototype.buy = function() { txt.value = 'Foo Bar'; }; Foo.button.onclick = function() { foo.buy(); }; Fiddle

    Read the article

  • Page does update with details from the database after i hit a button

    - by swathi
    I have a code and the way it should work is,when they click on NEW CUSTOMER,it takes them to test1.php where in they enter the details and they hit submit.it saves all the details in properly in the database and when i go back and hit REFRESH ,it should come up with the customer details which they had entered in previously. But what happens is, when i click on the REFRESH,it refreshes the same old page which is empty.I wanted to find out where am i missing the logic.Thanks in advance. The sample code would be <tr> <td class="tdvisitbig" colspan="5">THIS IS A TEST</td> </tr> <tr> <td class='tdvisitbig' colspan="5"><input type="button" onClick="openVisit('test1.php?id=<?=$key?>&name=<?=$name?>');return false;" value="NEW CUSTOMER" class="submit">&nbsp;<input type="button" value="REFRESH" name="add_xyz" class="submit" onClick="document.add.target='_self';document.add.action='test3.php?redirect=visit&section=test page';document.add.submit();"></td> </tr> <? $q = "SELECT address,customernum,status FROM customer WHERE name='$name' ORDER BY customernum"; $r = mysql_query( $q , $Link ); while( $rw = mysql_fetch_assoc( $r ) ) { extract( $rw ); ?> <tr> <? } ?>

    Read the article

  • Toggeling between image

    - by Binaryrespawn
    Hi all, I have two images with which I am using in an anchor tag. I am using jquery toggle on the click event of the anchor tag to swap between images. $(document).ready(function(){ $('#registrationForm').hide(); $('#callform').append("<a id='formlink'>IMAGE 1</a>"); $("#formlink").click(function(){ $('#registrationForm').toggle(function(){ $('#formlink').empty().append(IMAGE 2); }); }); }); This works fine the first time around, however i want to toggle between the two images whenever the other is clicked. Any ideas ?

    Read the article

  • IE Hanging on jQuery code

    - by OrangeRind
    Here's another clichéd problem, but I couldn't find an exact match to this. I haven't posted any source here, as you can freely see all that is there on the link. :-) Statement:I have a web page at http://agrimgupta.com/antaragni/ Disclaimer: Pardon me for the pathetic coding on that page. ;-) It was done on a very short interval. Improvements will be done at a later stage. Observation: This page is functioning normally on my localhost on all browsers. Problem: IE 8 is crawling (nearly hanging) while loading this page from the website. Although it is working fine on localhost. When on the website, It fails to render the mouseover effects, doing them in almost what seems like a minute. Question: How to resolve this stuck up of IE? It is necessary to resolve this. Thanks in Advance

    Read the article

  • It is the arranging game in which

    - by bachchan
    1 2 3 13 5 4 7 10 6 14 11 9 8 15 12 1.Every time when we refresh the page the numbers in the cells will change but the These numbers will remain unique n from 1 to 15 2.Whenever we double click the number in the cell which is surrounded the empty cell then it will replace the empty cell with that number n that number cell become empty. 3.If we double click the cell which is not surrounded the empty cell then it will not replace the empty cell. 4.e.g. if we click 8 then it will not move to empty cell But if we click either 13, 7 , or 11 then it will move to empty cell 5.And every time when we click the cell it’s num color will change for a moment

    Read the article

  • I want to style within JS

    - by 422
    Issue I have is I can use tags, but I would like to style particular words. Adding a class doesnt work, is it because I am within script dom ? Example: var config = [ { "name" : "tour_1", "bgcolor" : "black", "color" : "white", "position" : "BR", "text" : "Customize your user profile, it's easy. This is your shop window on <strong>here</strong> and <strong>there</strong>", "time" : 4000 } Instead of strong, I would like to apply class, like <p class="orange"> But it wont have it, any suggestions... please

    Read the article

  • Simple Ticker (jQuery)

    - by Nimbuz
    <ul> <li><a href="#">one</a></li> <li><a href="#">two</a></li> <li><a href="#">three</a></li> </ul> I'd like to show only one li at a time using slide effect, thats it. I'd like to avoid using plugins for something as simple as this. Thanks in advance for your help.

    Read the article

  • Get an array of forms in java script using prototype

    - by Saurabh
    My document contains more than one forms. How can I get an array of all forms using prototype? <html> <head></head> <body> <form id="form1"> <!-- Other stuffs here --> </form> <form id="form2"> <!-- Other stuffs here --> </form> <form id="form3"> <!-- Other stuffs here --> </form> </body> </html>

    Read the article

  • Google Chrome && (cache || memory leaks).

    - by Alexey Ogarkov
    Hello All, I have a big problem with Google Chrome and its memory. My app is displaying to user several image charts and reloads them every 10s. In the interval i have code like that var image = new Image(); var src = 'myurl/image'+new Date().getTime(); image.onload = function() { document.getElementById('myimage').src = src; image.onload = image.onabort = image.onerror = null; } image.src = src; So i have no memory leaks in Firefox and IE. Here the response headers for images Server Apache-Coyote/1.1 Vary * Cache-Control no-store (// I try no-cache, must-revalidate and so on here) Content-Type image/png Content-Length 11131 Date Mon, 31 May 2010 14:00:28 GMT Vary * taken from here In about:cache page there is no my cached images. If i enable purge-memory-button for chrome (--purge-memory-button parameter) it`s not help. Images is in PNG24. So i think that the problem is not in cache. May be Google Chrome is not releasing memory for old images. Please help. Any suggestions. Thanks.

    Read the article

  • Uncaught TypeError: Property 'dist2' of object [object Object] is not a function

    - by Radu Vlad
    I have this functions that should return me the distance from point p to segment line v-w. The problem i have is after some time i receive the following error: Uncaught TypeError: Property 'dist2' of object [object Object] is not a function. I receive it in distToSegmentSquared directly,not even calling the function dist2().Is it any other dist2() anywhere in jquery?I found none... function sqr(x) { return x * x; } function dist2(v, w) { console.log(v); console.log(w); return sqr(v.x - w.x) + sqr(v.y - w.y); } function distToSegmentSquared(p, v, w) { var l2 = dist2(v, w); if (l2 == 0) return dist2(p, v); var t = ((p.x - v.x) * (w.x - v.x) + (p.y - v.y) * (w.y - v.y)) / l2; if (t < 0) return dist2(p, v); if (t > 1) return dist2(p, w); return dist2(p, {x: v.x + t * (w.x - v.x), y: v.y + t * (w.y - v.y)}); } function distToSegment(p, v, w) { return Math.sqrt(distToSegmentSquared(p, v, w)); } The values that are given in for that error are: p: Object x: 461 y: 333 v: Object x: 80 y: 120 w: Object x: 260 y: 120

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Is there a way to catch an attempt to access a non existant property or method?

    - by Tor Valamo
    For instance this code: function stuff() { this.onlyMethod = function () { return something; } } // some error is thrown stuff().nonExistant(); Is there a way to do something like PHP's __call as a fallback from inside the object? function stuff() { this.onlyMethod = function () { return something; } this.__call__ = function (name, params) { alert(name + " can't be called."); } } // would then raise the alert "nonExistant can't be called". stuff().nonExistant();

    Read the article

  • Why is the page still caching even after the no-cache headers have been sent?

    - by Matthew Grasinger
    I've done a ton of research on this and have asked many people with help and still no success. Here are the details... I'm involved in developing a website that pulls data from various data files, combines them in a temp .csv file, and then is graphed using a popular graphing library: dygraphs. The bulk of the website is written in PHP. The parameters that determine the data that is graphed are stored in the users session, the .csv is named after the users session and available for download, and then the .csv file is written in a script that passes it to the dygraphs object. And we've found, even with the no-cache headers sent: header("Cache-Control: no-cache, must-revalidate"); header("Expires: Sat, 26 Jul 1997 05:00:00 GMT"); Many users experience in the middle of a session, (if enough different graphs are generated) the page displaying an older, static rendering of the page (data they had graphed earlier in the session) as if it were cached and loaded instead of getting a new request. It only gets weirder though: I've checked using developer tools in both Firefox and Chrome and both browsers are receiving the no-cache headers just fine; Even when the problem occurs if you view the page source, the source is the correct content (a table/legend is also dynamically created using php, the source shows the correct table, but what is rendered is older content); the page begins to render correctly until the graph is about to be display, and then shows the older content; the older content displays as if it were a completely static overlay--the cached graph does not have the same dynamic features (roll over data point display, zoom and pan, etc.) And it is as if the correct page were somewhere beneath it (the download button for the csv file moves depending on how large the table is. The older, static page does nothing if you click the download .csv button, but if you can manage to find the one in the page beneath it you can click and still download the .csv. The data in the .csv is correct) It is one of the strangest things I've seen in development thus far. Some other relevant facts are that all the problems I've personally experience occurred while I was using Chrome. Non of these symptoms have been reported by Firefox users. IE users have had the same problems (IE users are forced to use chrome frame). I'm at my wits end at this point. We've sent the php headers; we've tried setting the cache profile for php on IIS as "DisableCache" (or whatever); we've tried sending a random query string to the results page; we've tried all the appropriate meta tags--all with no success.

    Read the article

  • Finding all the URL requests from a firefox extension

    - by user303052
    I am building a firefox extension. In this extension, I want to see the URLs of any new webpage that the user visits. The webpage can be in a different tab or window than the current tab that the user is viewing (this should also catch the URL of pop-ups). Is there a way to find when firefox makes a GET or POST request and grab the URL? An alternative that I am trying to avoid is going through all the tabs and manually check to see if they have loaded a new page. Thanks

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • Call a function every hour

    - by user2961971
    I am trying to update information from a weather service on my page. The info should be updated every hour on the hour. How exactly do I go about calling a function on the hour every hour? I kind of had an idea but im not sure of how to actually refine it so it works... What I had in mind was something like creating an if statement, such as: (pseudo code) //get the mins of the current time var mins = datetime.mins(); if(mins == "00"){ function(); }

    Read the article

  • jquery autocomplete get selected item text

    - by rlee923
    I am wondering how to grab the selected item's text value on jquery autocomplete. I have initialised jquery as following : $(document).ready(function (){ $("input#autocomplete").autocomplete({ source: postcodelist, select: function (event, ui) { AutoCompleteSelectHandler(event, ui) } }); }); And I have created a function function AutoCompleteSelectHandler(event, ui) { }. Inside this function I want to some extra handling to feed data into correct textboxes but I can't figure out how to grab the text value of the selected item. I did google a bit and tried examples but I can't seem to get it working. Any help will be much appreciated. Thanks a lot advance.

    Read the article

  • jQuery bug when trying to insert partial elements before() / after() ?

    - by RedGlobe
    I'm trying to wrap a div around an element (my 'template' div) by using jQuery's before() and after(). When I try to insert a closing after the selected element, it actually gets placed before the target. Example: <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8" /> <title>Div Wrap</title> <script src="http://code.jquery.com/jquery-1.4.4.min.js"></script> <script> $('document').ready(function() { var beforestr = "<div id=\"wrap\"><div id=\"header\">Top</div><div id=\"page\">"; var afterstr = "</div><div id=\"footer\">Bottom</div></div>"; $('#template').before(beforestr); $('#template').after(afterstr); }); </script> </head> <body> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. <script>document.write('This script should still work and might contain variables. Please don\'t recommend concatenation.');</script> Donec non enim in turpis pulvinar facilisis.</p> </div> </body> </html> The result is: <div id="wrap"> <div id="header">Top</div> <div id="page"> </div> </div> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. This script should still work and might contain variables. Please don't recommend concatenation. Donec non enim in turpis pulvinar facilisis.</p> </div> <div id="footer">Bottom</div> Why are my closing wrap and page divs getting placed before the target, when I'm trying to place them after() ? Is there an alternative way to accomplish this (keeping in mind I may need to call script functions within the template div)? As I'm sure you're aware, best practices aren't what I'm going for here.

    Read the article

  • Can jquery capture the dynamic dom events and perform actions

    - by Zombie15
    I just wanted to know if something like this is possible. Jquery should fire some action on certian custom event. Like Whenever a new row is added to dom dynamically to table then i have certain action like change the background color to example red. That should work across the whole site. Somethings like Event listeners in Doctrine2 or Signals in Django EDIT: Basically i want some thing like where i can create custom event $.AddnewEvent(newRowAdded); Then i can customise that event with my own functions like $.newRowAdded(function(){ blah blah });

    Read the article

< Previous Page | 725 726 727 728 729 730 731 732 733 734 735 736  | Next Page >