Search Results

Search found 19690 results on 788 pages for 'result partitioning'.

Page 735/788 | < Previous Page | 731 732 733 734 735 736 737 738 739 740 741 742  | Next Page >

• Slow MySQL query....only sometimes

  - by Shane N

  I have a query that's used in a reporting system of ours that sometimes runs quicker than a second, and other times takes 1 to 10 minutes to run. Here's the entry from the slow query log: # Query_time: 543 Lock_time: 0 Rows_sent: 0 Rows_examined: 124948974 use statsdb; SELECT count(distinct Visits.visitorid) as 'uniques' FROM Visits,Visitors WHERE Visits.visitorid=Visitors.visitorid and candidateid in (32) and visittime>=1275721200 and visittime<=1275807599 and (omit=0 or omit>=1275807599) AND Visitors.segmentid=9 AND Visits.visitorid NOT IN (SELECT Visits.visitorid FROM Visits,Visitors WHERE Visits.visitorid=Visitors.visitorid and candidateid in (32) and visittime<1275721200 and (omit=0 or omit>=1275807599) AND Visitors.segmentid=9); It's basically counting unique visitors, and it's doing that by counting the visitors for today and then substracting those that have been here before. If you know of a better way to do this, let me know. I just don't understand why sometimes it can be so quick, and other times takes so long - even with the same exact query under the same server load. Here's the EXPLAIN on this query. As you can see it's using the indexes I've set up: id select_type table type possible_keys key key_len ref rows Extra 1 PRIMARY Visits range visittime_visitorid,visitorid visittime_visitorid 4 NULL 82500 Using where; Using index 1 PRIMARY Visitors eq_ref PRIMARY,cand_visitor_omit PRIMARY 8 statsdb.Visits.visitorid 1 Using where 2 DEPENDENT SUBQUERY Visits ref visittime_visitorid,visitorid visitorid 8 func 1 Using where 2 DEPENDENT SUBQUERY Visitors eq_ref PRIMARY,cand_visitor_omit PRIMARY 8 statsdb.Visits.visitorid 1 Using where I tried to optimize the query a few weeks ago and came up with a variation that consistently took about 2 seconds, but in practice it ended up taking more time since 90% of the time the old query returned much quicker. Two seconds per query is too long because we are calling the query up to 50 times per page load, with different time periods. Could the quick behavior be due to the query being saved in the query cache? I tried running 'RESET QUERY CACHE' and 'FLUSH TABLES' between my benchmark tests and I was still getting quick results most of the time. Note: last night while running the query I got an error: Unable to save result set. My initial research shows that may be due to a corrupt table that needs repair. Could this be the reason for the behavior I'm seeing? In case you want server info: Accessing via PHP 4.4.4 MySQL 4.1.22 All tables are InnoDB We run optimize table on all tables weekly The sum of both the tables used in the query is 500 MB MySQL config: key_buffer = 350M max_allowed_packet = 16M thread_stack = 128K sort_buffer = 14M read_buffer = 1M bulk_insert_buffer_size = 400M set-variable = max_connections=150 query_cache_limit = 1048576 query_cache_size = 50777216 query_cache_type = 1 tmp_table_size = 203554432 table_cache = 120 thread_cache_size = 4 wait_timeout = 28800 skip-external-locking innodb_file_per_table innodb_buffer_pool_size = 3512M innodb_log_file_size=100M innodb_log_buffer_size=4M

  Read the article

• def constrainedMatchPair(firstMatch,secondMatch,length):

  - by smart

  matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

  Read the article

• Setting default values for inherited property without using accessor in Objective-C?

  - by Ben Stock

  I always see people debating whether or not to use a property's setter in the -init method. I don't know enough about the Objective-C language yet to have an opinion one way or the other. With that said, lately I've been sticking to ivars exclusively. It seems cleaner in a way. I don't know. I digress. Anyway, here's my problem … Say we have a class called Dude with an interface that looks like this: @interface Dude : NSObject { @private NSUInteger _numberOfGirlfriends; } @property (nonatomic, assign) NSUInteger numberOfGirlfriends; @end And an implementation that looks like this: @implementation Dude - (instancetype)init { self = [super init]; if (self) { _numberOfGirlfriends = 0; } } @end Now let's say I want to extend Dude. My subclass will be called Playa. And since a playa should have mad girlfriends, when Playa gets initialized, I don't want him to start with 0; I want him to have 10. Here's Playa.m: @implementation Playa - (instancetype)init { self = [super init]; if (self) { // Attempting to set the ivar directly will result in the compiler saying, // "Instance variable `_numberOfGirlfriends` is private." // _numberOfGirlfriends = 10; <- Can't do this. // Thus, the only way to set it is with the mutator: self.numberOfGirlfriends = 10; // Or: [self setNumberOfGirlfriends:10]; } } @end So what's a Objective-C newcomer to do? Well, I mean, there's only one thing I can do, and that's set the property. Unless there's something I'm missing. Any ideas, suggestions, tips, or tricks? Sidenote: The other thing that bugs me about setting the ivar directly — and what a lot of ivar-proponents say is a "plus" — is that there are no KVC notifications. A lot of times, I want the KVC magic to happen. 50% of my setters end in [self setNeedsDisplay:YES], so without the notification, my UI doesn't update unless I remember to manually add -setNeedsDisplay. That's a bad example, but the point stands. I utilize KVC all over the place, so without notifications, things can act wonky. Anyway, any info is much appreciated. Thanks!

  Read the article

• Greasemonkey is getting an empty document.body on select Google pages.

  - by Brock Adams

  Hi, I have a Greasemonkey script that processes Google search results. But it's failing in a few instances, when xpath searches (and document body) appear to be empty. Running the code in Firebug's console works every time. It only fails in a Greasemonkey script. Greasemonkey sees an empty document.body. I've boiled the problem down to a test, greasemonkey script, below. I'm using Firefox 3.5.9 and Greasemonkey 0.8.20100408.6 (but earlier versions had the same problem). Problem: Greasemonkey sees an empty document.body. Recipe to Duplicate: Install the Greasemonkey script. Open a new tab or window. Navigate to Google.com (http://www.google.com/). Search on a simple term like "cats". Check Firefox's Error console (Ctrl-shift-J) or Firebug's console. The script will report that document body is empty. Hit refresh. The script will show a good result (document body found). Note that the failure only reliably appears on Google results obtained this way, and on a new tab/window. Turn javascript off globally (javascript.enabled set to false in about:config). Repeat steps 2 thru 5. Only now the Greasemonkey script will work. It seems that Google javascript is killing the DOM tree for greasemonkey, somehow. I've tried a time-delayed retest and even a programmatic refresh; the script still fails to see the document body. Test Script: // // ==UserScript== // @name TROUBLESHOOTING 2 snippets // @namespace http://www.google.com/ // @description For code that has funky misfires and defies standard debugging. // @include http://*/* // ==/UserScript== // function LocalMain (sTitle) { var sUserMessage = ''; //var sRawHtml = unsafeWindow.document.body.innerHTML; //-- unsafeWindow makes no difference. var sRawHtml = document.body.innerHTML; if (sRawHtml) { sRawHtml = sRawHtml.replace (/^\s\s*/, ''). substr (0, 60); sUserMessage = sTitle + ', Doc body = ' + sRawHtml + ' ...'; } else { sUserMessage = sTitle + ', Document body seems empty!'; } if (typeof (console) != "undefined") { console.log (sUserMessage); } else { if (typeof (GM_log) != "undefined") GM_log (sUserMessage); else if (!sRawHtml) alert (sUserMessage); } } LocalMain ('Preload'); window.addEventListener ("load", function() {LocalMain ('After load');}, false);

  Read the article

• PHP 5.3: Late static binding doesn't work for properties when defined in parent class while missing in child class

  - by DavidPesta

  Take a look at this example, and notice the outputs indicated. <?php class Mommy { protected static $_data = "Mommy Data"; public static function init( $data ) { static::$_data = $data; } public static function showData() { echo static::$_data . "<br>"; } } class Brother extends Mommy { } class Sister extends Mommy { } Brother::init( "Brother Data" ); Sister::init( "Sister Data" ); Brother::showData(); // Outputs: Sister Data Sister::showData(); // Outputs: Sister Data ?> My understanding was that using the static keyword would refer to the child class, but apparently it magically applies to the parent class whenever it is missing from the child class. (This is kind of a dangerous behavior for PHP, more on that explained below.) I have the following two things in mind for why I want to do this: I don't want the redundancy of defining all of the properties in all of the child classes. I want properties to be defined as defaults in the parent class and I want the child class definition to be able to override these properties wherever needed. The child class needs to exclude properties whenever the defaults are intended, which is why I don't define the properties in the child classes in the above example. However, if we are wanting to override a property at runtime (via the init method), it will override it for the parent class! From that point forward, child classes initialized earlier (as in the case of Brother) unexpectedly change on you. Apparently this is a result of child classes not having their own copy of the static property whenever it isn't explicitly defined inside of the child class--but instead of throwing an error it switches behavior of static to access the parent. Therefore, is there some way that the parent class could dynamically create a property that belongs to the child class without it appearing inside of the child class definition? That way the child class could have its own copy of the static property and the static keyword can refer to it properly, and it can be written to take into account parent property defaults. Or is there some other solution, good, bad, or ugly?

  Read the article

• Trappings MySQL Warnings on Calls Wrapped in Classes -- Python

  - by chernevik

  I can't get Python's try/else blocks to catch MySQL warnings when the execution statements are wrapped in classes. I have a class that has as a MySQL connection object as an attribute, a MySQL cursor object as another, and a method that run queries through that cursor object. The cursor is itself wrapped in a class. These seem to run queries properly, but the MySQL warnings they generate are not caught as exceptions in a try/else block. Why don't the try/else blocks catch the warnings? How would I revise the classes or method calls to catch the warnings? Also, I've looked through the prominent sources and can't find a discussion that helps me understand this. I'd appreciate any reference that explains this. Please see code below. Apologies for verbosity, I'm newbie. #!/usr/bin/python import MySQLdb import sys import copy sys.path.append('../../config') import credentials as c # local module with dbase connection credentials #============================================================================= # CLASSES #------------------------------------------------------------------------ class dbMySQL_Connection: def __init__(self, db_server, db_user, db_passwd): self.conn = MySQLdb.connect(db_server, db_user, db_passwd) def getCursor(self, dict_flag=True): self.dbMySQL_Cursor = dbMySQL_Cursor(self.conn, dict_flag) return self.dbMySQL_Cursor def runQuery(self, qryStr, dict_flag=True): qry_res = runQueryNoCursor(qryStr=qryStr, \ conn=self, \ dict_flag=dict_flag) return qry_res #------------------------------------------------------------------------ class dbMySQL_Cursor: def __init__(self, conn, dict_flag=True): if dict_flag: dbMySQL_Cursor = conn.cursor(MySQLdb.cursors.DictCursor) else: dbMySQL_Cursor = conn.cursor() self.dbMySQL_Cursor = dbMySQL_Cursor def closeCursor(self): self.dbMySQL_Cursor.close() #============================================================================= # QUERY FUNCTIONS #------------------------------------------------------------------------------ def runQueryNoCursor(qryStr, conn, dict_flag=True): dbMySQL_Cursor = conn.getCursor(dict_flag) qry_res =runQueryFnc(qryStr, dbMySQL_Cursor.dbMySQL_Cursor) dbMySQL_Cursor.closeCursor() return qry_res #------------------------------------------------------------------------------ def runQueryFnc(qryStr, dbMySQL_Cursor): qry_res = {} qry_res['rows'] = dbMySQL_Cursor.execute(qryStr) qry_res['result'] = copy.deepcopy(dbMySQL_Cursor.fetchall()) qry_res['messages'] = copy.deepcopy(dbMySQL_Cursor.messages) qry_res['query_str'] = qryStr return qry_res #============================================================================= # USAGES qry = 'DROP DATABASE IF EXISTS database_of_armaments' dbConn = dbMySQL_Connection(**c.creds) def dbConnRunQuery(): # Does not trap an exception; warning displayed to standard error. try: dbConn.runQuery(qry) except: print "dbConn.runQuery() caught an exception." def dbConnCursorExecute(): # Does not trap an exception; warning displayed to standard error. dbConn.getCursor() # try/except block does catches error without this try: dbConn.dbMySQL_Cursor.dbMySQL_Cursor.execute(qry) except Exception, e: print "dbConn.dbMySQL_Cursor.execute() caught an exception." print repr(e) def funcRunQueryNoCursor(): # Does not trap an exception; no warning displayed try: res = runQueryNoCursor(qry, dbConn) print 'Try worked. %s' % res except Exception, e: print "funcRunQueryNoCursor() caught an exception." print repr(e) #============================================================================= if __name__ == '__main__': print '\n' print 'EXAMPLE -- dbConnRunQuery()' dbConnRunQuery() print '\n' print 'EXAMPLE -- dbConnCursorExecute()' dbConnCursorExecute() print '\n' print 'EXAMPLE -- funcRunQueryNoCursor()' funcRunQueryNoCursor() print '\n'

  Read the article

• WebServices does not interact with App

  - by daemonfire300

  I got a Silverlight App with-in a Web Project Web Silverlight The web contains a service: [WebService(Namespace = "svChat")] [WebServiceBinding(ConformsTo = WsiProfiles.BasicProfile1_1)] // To allow this Web Service to be called from script, using ASP.NET AJAX, uncomment the following line. //[System.Web.Script.Services.ScriptService] public class GetIPService : System.Web.Services.WebService { public GetIPService () { //Uncomment the following line if using designed components //InitializeComponent(); } [WebMethod] public string GetIp() { return HttpContext.Current.Request.ServerVariables["HTTP_X_FORWARDED_FOR"]; } } And I got a class in my Silverlight App using the Service: public class Client { private string ip; private string created; #region Properties public string Ip { get { return ip; } set { ip = value; } } public string Created { get { return created; } set { created = value; } } #endregion public Client() { } public void SetIp() { ServiceReference1.GetIPServiceSoapClient scIpClient = new svChat.ServiceReference1.GetIPServiceSoapClient(); scIpClient.GetIpCompleted += new EventHandler<svChat.ServiceReference1.GetIpCompletedEventArgs>(IpService_Completed); scIpClient.GetIpAsync(); } private void IpService_Completed(object sender, ServiceReference1.GetIpCompletedEventArgs e) { this.ip = e.Result; } } After Client is created, SetIp() is called, and Client.Ip is added to a text box. Nothing happens. Ip = null. Service itselfs works, tested it. Getting Ip by the above code works. Gettings Ip via service through Silverlight App does not work. <configuration> <system.serviceModel> <bindings> <basicHttpBinding> <binding name="GetIPServiceSoap" maxBufferSize="2147483647" maxReceivedMessageSize="2147483647"> <security mode="None" /> </binding> </basicHttpBinding> </bindings> <client> <endpoint address="http://localhost:2090/svChat.Web/GetIPService.asmx" binding="basicHttpBinding" bindingConfiguration="GetIPServiceSoap" contract="ServiceReference1.GetIPServiceSoap" name="GetIPServiceSoap" /> </client> </system.serviceModel> </configuration> Any ideas? regards,

  Read the article

• How to use command bindings in user controls in wpf?

  - by Sam

  In MainWindow the commandbinding works fine. In UserControl1 it doesnt work. Note the datacontext is set correctly as is evidenced by the content of the button which is the result of a binding. I am not trying to bind the command in the usercontrol to a command in mainwindow or any other such trickery. I am just trying to replicate what I did in MainWindow in UserControl1. // MainWindow xaml <StackPanel> <Button Content="Click Here" Command="{Binding ClickHereCommand}" Height="25" Width="90"></Button> <local:UserControl1></local:UserControl1> </StackPanel> // MainWindow public partial class MainWindow : Window { public static RoutedCommand ClickHereCommand { get; set; } public MainWindow() { InitializeComponent(); this.DataContext = this; ClickHereCommand = new RoutedCommand(); CommandBindings.Add(new CommandBinding(ClickHereCommand, ClickHereExecuted)); } public void ClickHereExecuted(object sender, ExecutedRoutedEventArgs e) { System.Windows.MessageBox.Show("hello"); } } // UserControl1 xaml <UserControl x:Class="CommandBindingTest.UserControl1" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:mc="http://schemas.openxmlformats.org/markup-compatibility/2006" xmlns:d="http://schemas.microsoft.com/expression/blend/2008" mc:Ignorable="d" d:DesignHeight="300" d:DesignWidth="300" x:Name="root"> <Grid DataContext="{Binding ElementName=root}" > <Button Content="{Binding ButtonContent}" Command="{Binding ClickHereCommand}" Height="25" Width="90"></Button> </Grid> </UserControl> // UserControl1 public partial class UserControl1 : UserControl, INotifyPropertyChanged { private string _ButtonContent; public string ButtonContent { get { return _ButtonContent; } set { if (_ButtonContent != value) { _ButtonContent = value; OnPropertyChanged("ButtonContent"); } } } public static RoutedCommand ClickHereCommand { get; set; } public UserControl1() { InitializeComponent(); ClickHereCommand = new RoutedCommand(); CommandBindings.Add(new CommandBinding(ClickHereCommand, ClickHereExecuted)); ButtonContent = "Click Here"; } public void ClickHereExecuted(object sender, ExecutedRoutedEventArgs e) { System.Windows.MessageBox.Show("hello from UserControl1"); } #region INotifyPropertyChanged Members public event PropertyChangedEventHandler PropertyChanged; public void OnPropertyChanged(string name) { if (PropertyChanged != null) { PropertyChanged(this, new PropertyChangedEventArgs(name)); } } #endregion }

  Read the article

• Need help helping in converting jquery, ajax, json and asp.net

  - by Haja Mohaideen

  I am tying out this tutorial, http://www.ezzylearning.com/tutorial.aspx?tid=5869127. It works perfectly. What I am now trying to do is to host the aspx contents as html file. This html file is hosted on my wampserver which is on my laptop. The asp.net code hosted on my test server. When I try to access, I get the following error, Resource interpreted as Script but transferred with MIME type text/html: "http://201.x.x.x/testAjax/Default.aspx/AddProductToCart?callback=jQuery17103264484549872577_1346923699990&{%20pID:%20%226765%22,%20qty:%20%22100%22,%20lblType:%20%2220%22%20}&_=1346923704482". jquery.min.js:4 Uncaught SyntaxError: Unexpected token < I am not sure how to solve this problem. index.html code $(function () { $('#btnAddToCart').click(function () { var result = $.ajax({ type: "POST", url: "http://202.161.45.124/testAjax/Default.aspx/AddProductToCart", crossDomain: true, data: '{ pID: "6765", qty: "100", lblType: "20" }', contentType: "application/json; charset=utf-8", dataType: "jsonp", success: succeeded, failure: function (msg) { alert(msg); }, error: function (xhr, err) { alert(err); } }); }); }); function succeeded(msg) { alert(msg.d); } function btnAddToCart_onclick() { } </script> </head> <body> <form name="form1" method="post"> <div> <input type="button" id="btnAddToCart" onclick="return btnAddToCart_onclick()" value="Button" /> </div> </form> aspx.vb Imports System.Web.Services Imports System.Web.Script.Services <ScriptService()> Public Class WebForm1 Inherits Page Protected Sub Page_Load(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.Load Session("test") = "" End Sub <WebMethod()> <ScriptMethod(UseHttpGet:=False, ResponseFormat:=ResponseFormat.Json)> Public Shared Function AddProductToCart(pID As String, qty As String, lblType As String) As String Dim selectedProduct As String = String.Format("+ {0} - {1} - {2}", pID, qty, lblType) HttpContext.Current.Session("test") += selectedProduct Return HttpContext.Current.Session("test").ToString() End Function End Class

  Read the article

• Inserting checkbox values

  - by rabeea

  hey i have registration form that has checkboxes along with other fields. i cant insert the selected checkbox values into the data base. i have made one field in the database for storing all checked values. this is the code for checkbox part in the form: Websites, IT and Software Writing and Content <pre><input type="checkbox" name="expertise[]" value="Design and Media"> Design and Media <input type="checkbox" name="expertise[]" value="Data entry and Admin"> Data entry and Admin </pre> <pre><input type="checkbox" name="expertise[]" value="Engineering and Skills"> Engineering and Science <input type="checkbox" name="expertise[]" value="Seles and Marketing"> Sales and Marketing </pre> <pre><input type="checkbox" name="expertise[]" value="Business and Accounting"> Business and Accounting <input type="checkbox" name="expertise[]" value="Others"> Others </pre> and this is the corresponding php code for inserting data $checkusername=mysql_query("SELECT * FROM freelancer WHERE fusername='{$_POST['username']}'"); if (mysql_num_rows($checkusername)==1) { echo "username already exist"; } else { $query = "insert into freelancer(ffname,flname,fgender,femail,fusername,fpwd,fphone,fadd,facc,facc_name,fbank_details,fcity,fcountry,fexpertise,fprofile,fskills,fhourly_rate,fresume) values ('".$_POST['first_name']."','".$_POST['last_name']."','".$_POST['gender']."','".$_POST['email']."','".$_POST['username']."','".$_POST['password']."','".$_POST['phone']."','".$_POST['address']."','".$_POST['acc_num']."','".$_POST['acc_name']."','".$_POST['bank']."','".$_POST['city']."','".$_POST['country']."','".implode(',',$_POST['expertise'])."','".$_POST['profile']."','".$_POST['skills']."','".$_POST['rate']."','".$_POST['resume']."')"; $result = ($query) or die (mysql_error()); this code inserts data for all fields but the checkbox value field remains empty???

  Read the article

• output with "Private`" Content in Mathematica Package

  - by madalina

  Hello everyone, I am trying to solve the following implementation problem in Mathematica 7.0 for some days now and I do not understand exactly what is happening so I hope someone can give me some hints. I have 3 functions that I implemented in Mathematica in a source file with extension *.nb. They are working okay to all the examples. Now I want to put these functions into 3 different packages. So I created three different packages with extension .*m in which I put all the desired Mathematica function. An example in the "stereographic.m" package which contain the code: BeginPackage["stereographic`"] stereographic::usage="The package stereographic...." formEqs::usage="The function formEqs[complexBivPolyEqn..." makePoly::usage="The function makePoly[algebraicEqn] ..." getFixPolys::usage="The function..." milnorFibration::usage="The function..." Begin["Private`"] Share[]; formEqs[complex_,{m_,n_}]:=Block[{complexnew,complexnew1, realeq, imageq, expreal, expimag, polyrealF, polyimagF,s,t,u,v,a,b,c,epsilon,x,y,z}, complexnew:=complex/.{m->s+I*t,n->u+I*v}; complexnew1:=complexnew/.{s->(2 a epsilon)/(1+a^2+b^2+c^2),t->(2 b epsilon)/(1+a^2+b^2+c^2),u->(2 c epsilon)/(1+a^2+b^2+c^2),v->(- epsilon+a^2 epsilon+b^2 epsilon+c^2 epsilon)/(1+a^2+b^2+c^2)}; realeq:=ComplexExpand[Re[complexnew1]]; imageq:=ComplexExpand[Im[complexnew1]]; expreal:=makePoly[realeq]; expimag:=makePoly[imageq]; polyrealF:=expreal/.{a->x,b->y,c->z}; polyimagF:=expimag/.{a->x,b->y,c->z}; {polyrealF,polyimagF} ] End[] EndPackage[] Now to test the function I load the package Needs["stereographic`"] everything is okay. But when I test the function for example with formEqs[x^2-y^2,{x,y}] I get the following ouput: {Private`epsilon^2 + 2 Private`x^2 Private`epsilon^2 + Private`x^4 Private`epsilon^2 - 6 Private`y^2 Private`epsilon^2 + 2 Private`x^2 Private`y^2 Private`epsilon^2 + Private`y^4 Private`epsilon^2 - 6 Private`z^2 Private`epsilon^2 + 2 Private`x^2 Private`z^2 Private`epsilon^2 + 2 Private`y^2 Private`z^2 Private`epsilon^2 + Private`z^4 Private`epsilon^2, 8 Private`x Private`y Private`epsilon^2 + 4 Private`z Private`epsilon^2 - 4 Private`x^2 Private`z Private`epsilon^2 - 4 Private`y^2 Private`z Private`epsilon^2 - 4 Private`z^3 Private`epsilon^2} Of course I do not understand why Private` appears in front of any local variable which I returned in the final result. I would want not to have this Private` in the computed output. Any idea or better explanations which could indicate me why this happens? Thank you very much for your help. Best wishes, madalina

  Read the article

• How to set background in OpenGL captured image from OpenCV

  - by user325487

  Hey All, i'm relatively new to Artoolkitplus and openGL i'm having a tough time getting the image i capture through openCV to be set as the background image in OpenGL ... I also cannot convert the image i take through the camera using opencv to be scaled to 320x280 from 640x480 .. i also have to save my image and load if for things to work... here's my code //////////// int findMarker() { IplImage* image = cvQueryFrame( capture ); if( !capture ) { fprintf( stderr, "ERROR: capture is NULL \n" ); getchar(); return -1; } if( !image ) { fprintf( stderr, "ERROR: frame is null...\n" ); getchar(); } //cvShowImage( "Capture", frame ); //image = cvCloneImage( frame ); try{ if(!cvSaveImage("immagineTmp.jpg",image)) printf("Could not save\n"); } catch(void*) {} image = cvLoadImage("immagineTmp.jpg", 1); cvShowImage( "Image", image ); glLoadIdentity(); ////////////// glDisable(GL_DEPTH_TEST); glOrtho(0,640,0,480,-1,1); glGenTextures(1, &bgid); glBindTexture(GL_TEXTURE_2D, bgid); // Create Linear Filtered Texture glBindTexture(GL_TEXTURE_2D, bgid); glTexParameteri(GL_TEXTURE_2D,GL_TEXTURE_MAG_FILTER,GL_LINEAR); glTexParameteri(GL_TEXTURE_2D,GL_TEXTURE_MIN_FILTER,GL_LINEAR); glTexImage2D(GL_TEXTURE_2D, 0, 3, image-width, image-height, 0, GL_RGB, GL_UNSIGNED_BYTE, image-imageData); glBindTexture(GL_TEXTURE_2D, bgid); glBegin(GL_QUADS); glTexCoord2f(0.0f, 0.0f); glVertex3f(-1.2f, -1.0f, -2.0f); glTexCoord2f(1.0f, 0.0f); glVertex3f( 1.2f, -1.0f, -2.0f); glTexCoord2f(1.0f, 1.0f); glVertex3f( 1.2f, 1.0f, -2.0f); glTexCoord2f(0.0f, 1.0f); glVertex3f(-1.2f, 1.0f, -2.0f); glEnd(); glEnable(GL_DEPTH_TEST); glLoadIdentity(); //////////// // do the OpenGL camera setup glMatrixMode(GL_PROJECTION); glLoadMatrixf(tracker-getProjectionMatrix()); int markerId = tracker-calc((unsigned char *)(image-imageData)); float conf = tracker-getConfidence(); // use the result of calc() to setup the OpenGL transformation glMatrixMode(GL_MODELVIEW); glLoadMatrixf(tracker-getModelViewMatrix()); if(markerId!=-1) { printf("\n\nFound marker %d (confidence %d%%)\n\nPose-Matrix:\n ", markerId, (int(conf*100.0f))); for(int i=0; i<16; i++) printf("%.2f %s", tracker-getModelViewMatrix()[i], (i%4==3)?"\n " : ""); } cvReleaseImage(&image); return 0; }

  Read the article

• Equivalent of System.Windows.Forms.Cursor in Web Application

  - by Vishwa

  Hi I have a code in windows application now i am trying to implement in web Application but it is showimg that it ths no cursor class (System.Windows.Forms.Cursor )so..wat is the equivalent in web application. Here is my code private void btnGo_Click(System.Object sender, System.EventArgs e) { this.Cursor = Cursors.WaitCursor; Application.DoEvents(); // Load the images. Bitmap bm1 = (Bitmap) (Image.FromFile(txtFile1.Text)); Bitmap bm2 = (Bitmap) (Image.FromFile(txtFile2.Text)); // Make a difference image. int wid = Math.Min(bm1.Width, bm2.Width); int hgt = Math.Min(bm1.Height, bm2.Height); Bitmap bm3 = new Bitmap(wid, hgt); // Create the difference image. bool are_identical = true; int r1; int g1; int b1; int r2; int g2; int b2; int r3; int g3; int b3; Color eq_color = Color.White; Color ne_color = Color.Transparent; for (int x = 0; x <= wid - 1; x++) { for (int y = 0; y <= hgt - 1; y++) { if (bm1.GetPixel(x, y).Equals(bm2.GetPixel(x, y))) { bm3.SetPixel(x, y, eq_color); } else { bm1.SetPixel(x, y, ne_color); are_identical = false; } } } // Display the result. picResult.Image = bm1; Bitmap Logo = new Bitmap(picResult.Image); Logo.MakeTransparent(Logo.GetPixel(1, 1)); picResult.Image = (Image)Logo; this.Cursor = Cursors.Default; if ((bm1.Width != bm2.Width) || (bm1.Height != bm2.Height)) { are_identical = false; } if (are_identical) { MessageBox.Show("The images are identical"); } else { MessageBox.Show("The images are different"); } //bm1.Dispose() // bm2.Dispose() }

  Read the article

• Why are these two sql statements deadlocking? (Deadlock graph + details included).

  - by Pure.Krome

  Hi folks, I've got the following deadlock graph that describes two sql statements that are deadlocking each other. I'm just not sure how to analyse this and then fix up my sql code to prevent this from happening. Main deadlock graph Click here for a bigger image. Left side, details Click here for a bigger image. Right side, details Click here for a bigger image. What is the code doing? I'm reading in a number of files (eg. lets say 3, for this example). Each file contains different data BUT the same type of data. I then insert data into LogEntries table and then (if required) I insert or delete something from the ConnectedClients table. Here's my sql code. using (TransactionScope transactionScope = new TransactionScope()) { _logEntryRepository.InsertOrUpdate(logEntry); // Now, if this log entry was a NewConnection or an LostConnection, then we need to make sure we update the ConnectedClients. if (logEntry.EventType == EventType.NewConnection) { _connectedClientRepository.Insert(new ConnectedClient { LogEntryId = logEntry.LogEntryId }); } // A (PB) BanKick does _NOT_ register a lost connection .. so we need to make sure we handle those scenario's as a LostConnection. if (logEntry.EventType == EventType.LostConnection || logEntry.EventType == EventType.BanKick) { _connectedClientRepository.Delete(logEntry.ClientName, logEntry.ClientIpAndPort); } _unitOfWork.Commit(); transactionScope.Complete(); } Now each file has it's own UnitOfWork instance (which means it has it's own database connection, transaction and repository context). So i'm assuming this means there's 3 different connections to the db all happening at the same time. Finally, this is using Entity Framework as the repository, but please don't let that stop you from having a think about this problem. Using a profiling tool, the Isolation Level is Serializable. I've also tried ReadCommited and ReadUncommited, but they both error :- ReadCommited: same as above. Deadlock. ReadUncommited: different error. EF exception that says it expected some result back, but got nothing. I'm guessing this is the LogEntryId Identity (scope_identity) value that is expected but not retrieve because of the dirty read. Please help! PS. It's Sql Server 2008, btw.

  Read the article

• How to implement a caching model without violating MVC pattern?

  - by RPM1984

  Hi Guys, I have an ASP.NET MVC 3 (Razor) Web Application, with a particular page which is highly database intensive, and user experience is of the upmost priority. Thus, i am introducing caching on this particular page. I'm trying to figure out a way to implement this caching pattern whilst keeping my controller thin, like it currently is without caching: public PartialViewResult GetLocationStuff(SearchPreferences searchPreferences) { var results = _locationService.FindStuffByCriteria(searchPreferences); return PartialView("SearchResults", results); } As you can see, the controller is very thin, as it should be. It doesn't care about how/where it is getting it's info from - that is the job of the service. A couple of notes on the flow of control: Controllers get DI'ed a particular Service, depending on it's area. In this example, this controller get's a LocationService Services call through to an IQueryable<T> Repository and materialize results into T or ICollection<T>. How i want to implement caching: I can't use Output Caching - for a few reasons. First of all, this action method is invoked from the client-side (jQuery/AJAX), via [HttpPost], which according to HTTP standards should not be cached as a request. Secondly, i don't want to cache purely based on the HTTP request arguments - the cache logic is a lot more complicated than that - there is actually two-level caching going on. As i hint to above, i need to use regular data-caching, e.g Cache["somekey"] = someObj;. I don't want to implement a generic caching mechanism where all calls via the service go through the cache first - i only want caching on this particular action method. First thought's would tell me to create another service (which inherits LocationService), and provide the caching workflow there (check cache first, if not there call db, add to cache, return result). That has two problems: The services are basic Class Libraries - no references to anything extra. I would need to add a reference to System.Web here. I would have to access the HTTP Context outside of the web application, which is considered bad practice, not only for testability, but in general - right? I also thought about using the Models folder in the Web Application (which i currently use only for ViewModels), but having a cache service in a models folder just doesn't sound right. So - any ideas? Is there a MVC-specific thing (like Action Filter's, for example) i can use here? General advice/tips would be greatly appreciated.

  Read the article

• PHP Copy-Paste Detector

  - by user1615069

  My problem is that when I run phpcpd command I always get 0% doubled code result, no matter if it's my project, if it's any php module's files, or if it's a file I created to check if phpcpd works...For example when I check the file below it also displays 0%: phpcpd folder/file.php: <?php class Class_Two { public function aaa() { if(2 == 2) { echo 'ok'; } } public function aaa() { if(2 == 2) { echo 'ok'; echo 'ok'; echo 'ok'; echo 'ok'; echo 'ok'; echo 'ok'; } } public function aaa() { if(2 == 2) { echo 'ok'; } } public function aaa() { if(2 == 2) { echo 'ok'; echo 'ok'; echo 'ok'; echo 'ok'; echo 'ok'; echo 'ok'; } } public function aaa() { if(2 == 2) { echo 'ok'; } } public function aaa() { if(2 == 2) { echo 'ok'; echo 'ok'; echo 'ok'; echo 'ok'; echo 'ok'; echo 'ok'; } } public function aaa() { if(2 == 2) { echo 'ok'; } } public function aaa() { if(2 == 2) { echo 'ok'; echo 'ok'; echo 'ok'; echo 'ok'; echo 'ok'; echo 'ok'; } } public function aaa() { if(2 == 2) { echo 'ok'; } } public function aaa() { if(2 == 2) { echo 'ok'; echo 'ok'; echo 'ok'; echo 'ok'; echo 'ok'; echo 'ok'; } } public function aaa() { if(2 == 2) { echo 'ok'; } } public function aaa() { if(2 == 2) { echo 'ok'; echo 'ok'; echo 'ok'; echo 'ok'; echo 'ok'; echo 'ok'; } } } class Class_Two { public function aaa() { if(2 == 2) { echo 'ok'; } } public function aaa() { if(2 == 2) { echo 'ok'; } } } Any suggestions on why isn't it working properly? Or maybe it is supposed to do some other tasks?

  Read the article

• Windows Phone period task, function not executing

  - by Special K.

  I'm trying to execute a code (to parse an XML to be more precisely, and after that I'll toast message the user with some new info's), but the class function AccDetailsDownloaded is not executed (is simply skipped), also the memory usage is ~2mb out of 6, here is my code: if (task is PeriodicTask) { getData(); } else { getData(); } // If debugging is enabled, launch the agent again in one minute. #if DEBUG_AGENT ScheduledActionService.LaunchForTest(task.Name, TimeSpan.FromSeconds(60)); #endif // Call NotifyComplete to let the system know the agent is done working. NotifyComplete(); } public void getData() { var settings = IsolatedStorageSettings.ApplicationSettings; string url = "http://example.com/example.xml"; if (!System.Net.NetworkInformation.NetworkInterface.GetIsNetworkAvailable()) { MessageBox.Show("No network connection available!"); return; } // start loading XML-data WebClient downloader = new WebClient(); Uri uri = new Uri(url, UriKind.Absolute); downloader.DownloadStringCompleted += new DownloadStringCompletedEventHandler(AccDetailsDownloaded); downloader.DownloadStringAsync(uri); string toastTitle = ""; toastTitle = "Periodic "; string toastMessage = "Mem usage: " + DeviceStatus.ApplicationPeakMemoryUsage + "/" + DeviceStatus.ApplicationMemoryUsageLimit; // Launch a toast to show that the agent is running. // The toast will not be shown if the foreground application is running. ShellToast toast = new ShellToast(); toast.Title = toastTitle; toast.Content = toastMessage; toast.Show(); } void AccDetailsDownloaded(object sender, DownloadStringCompletedEventArgs e) { if (e.Result == null || e.Error != null) { MessageBox.Show("There was an error downloading the XML-file!"); } else { string toastTitle = ""; toastTitle = "Periodic "; string toastMessage = "Mem usage: " + DeviceStatus.ApplicationPeakMemoryUsage + "/" + DeviceStatus.ApplicationMemoryUsageLimit; // Launch a toast to show that the agent is running. // The toast will not be shown if the foreground application is running. ShellToast toast = new ShellToast(); toast.Title = toastTitle; toast.Content = toastMessage; toast.Show(); } } Thank you.

  Read the article

• Any thoughts on how to create a true 'punch-out' area in a Sprite?

  - by rhtx

  I've been working on this for awhile, now. You might also call it a 'reverse mask', or an 'inverse mask'. Basically, I'm creating a view window within a display object. I need to allow objects on the stage that are under the window to be able to interact with the mouse. This is similar to a WPF question: http://stackoverflow.com/questions/740994/use-wpf-object-to-punch-hole-in-another, which has a much shorter write-up. I've got a Class called PunchOutShield, which creates a Sprite that covers the stage (or over some desired area). The Sprite's Graphics object is filled using the color and transparency of Flex's modal screen. The result is a screen that looks like the screen which appears behind a modal PopUp. PunchOutShield has a method called punch, which takes two arguments - the first is a Shape object, which defines the shape of the punch-through area; the second is a Point object, which indicates where to position the punch-through area. It took some experimenting, but I found that I can successfully create a punch-out area (i.e. - the modal screen does not display within the bounds of the given Shape). To do this, I set cacheAsBitmap to true on the Sprite that is used to create the modal screen, and also on the Shape object, which is added to the modal screen Sprite's displayList. If I set the blend mode of the Shape to ERASE, a completely transparent area is created in the modal screen. So far, great. The problem is that Shape does not subclass InteractiveObject, so there is no way to set mouseEnabled = false on it. And so, it prevents interaction between the mouse and any objects that are visible through the punch-out area. On top of that, InteractiveObject isn't available to look at, so I can't see if there is a way to borrow what it's doing to provide the mouseEnabled functionality and apply it to a subclass of Shape. I've tried using another Sprite object, rather than a Shape object, but the blending doesn't work out correctly. I'm not sure why there is a difference, but the Shape object seems to somehow combine with the parenting Sprite, allowing the ERASE blendMode to effect the desired punch-out visual appearance. It wouldn't be the end of the world if I had to draw up the screen with a series of rectangles so that the punch-out area was just simply not drawn, but that approach won't work if the punch-out area is complex. Or round. Any thoughts on this approach, or on an alternative approach?

  Read the article

• how to fix protocol violation in c#

  - by Jeremy Styers

  I have a c# "client" and a Java "server". The java server has a wsdl it serves to the client. So far it works for c# to make a request for the server to perform a soap action. My server gets the soap request executes the method and tries to return the result back to the client. When I send the response to c# however, I get "The server committed a protocol violation. Section=ResponseStatusLine". I have spent all day trying to fix this and have come up with nothing that works. If I explain what i did, this post would be very long, so I'll keep it brief. i Googled for hours and everything tells me my "response line" is correct. I tried shutting down Skype, rearranging the response line, adding things, taking things away, etc, etc. All to no avail. This is for a class assignment so no, I can not use apis to help. I must do everything manually on the server side. That means parsing by hand, creating the soap response and the http response by hand. Just thought you'd like to know that before you say to use something that does it for me. I even tried making sure my server was sending the correct header by creating a java client that "mimicked" the c# one so I could see what the server returned. However, it's returning exactly what i told it to send. I tried telling my java client to do the same thing but to an actuall running c# service, to see what a real service returns, and it returned basically the same thing. To be safe, I copied it's response and tried sending it to the c# client and it still threw the error. Can anyone help? I've tried all i can think of, including adding the useUnsafeHeaderParsing to my app config. Nothing is working though. I send it exactly what a real service sends it and it yells at me. I send it what i want and it yells. I'm sending this: "200 OK HTTP/1.0\r\n" + "Content-Length: 201\r\n" + "Cache-Control: private\r\n" + "Content-Type: text/xml; charset=utf-8\r\n\r\n";

  Read the article

• problem to create session of facebook

  - by khoyendra

  try { HttpClient http = new HttpClient(); http.setParams(new HttpClientParams()); //http.getHostConfiguration().setHost("http://www.facebook.com/"); http.setState(new HttpState()); String api_key = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"; String secret = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"; // String appId=124812364218050; //http://www.facebook.com/developers/editapp.php?app_id=124812364218050 FacebookRestClient client = new FacebookRestClient(api_key, secret); client.setIsDesktop(true); // String sessionKey = request.getParameter(FacebookParam.SESSION_KEY.toString()); // boolean b = client.users_setStatus("This is a test..."); // System.out.println("User Status RESULT : " + b); String token = client.auth_createToken(); final String loginId = "http://www.facebook.com/login.php"; GetMethod get = new GetMethod(loginId + "?api_key=" + api_key + "&v=1.0&auth_token=" +token); System.out.println("Get="+get); http.executeMethod(get); PostMethod post = new PostMethod(loginId); post.addParameter(new NameValuePair("api_key", api_key)); post.addParameter(new NameValuePair("v", "1.0")); post.addParameter(new NameValuePair("auth_token", token)); post.addParameter(new NameValuePair("fbconnect","true")); post.addParameter(new NameValuePair("return_session","true")); post.addParameter(new NameValuePair("session_key_only","true")); post.addParameter(new NameValuePair("req_perms","read_stream,publish_stream")); post.addParameter(new NameValuePair("email", email)); post.addParameter(new NameValuePair("pass", password)); System.out.println("Token ="+token); int postStatus = http.executeMethod(post); System.out.println("Response : " + postStatus); session = client.auth_getSession(token); // Here I am getting error System.out.println("Session string: " + session); long userid = client.users_getLoggedInUser(); System.out.println("User Id is : " + userid); } catch (Exception e) { e.printStackTrace(); } please solve my problem i cannot create session of facebook.

  Read the article

• C++ using cdb_read returns extra characters on some reads

  - by Moe Be

  Hi All, I am using the following function to loop through a couple of open CDB hash tables. Sometimes the value for a given key is returned along with an additional character (specifically a CTRL-P (a DLE character/0x16/0o020)). I have checked the cdb key/value pairs with a couple of different utilities and none of them show any additional characters appended to the values. I get the character if I use cdb_read() or cdb_getdata() (the commented out code below). If I had to guess I would say I am doing something wrong with the buffer I create to get the result from the cdb functions. Any advice or assistance is greatly appreciated. char* HashReducer::getValueFromDb(const string &id, vector <struct cdb *> &myHashFiles) { unsigned char hex_value[BUFSIZ]; size_t hex_len; //construct a real hex (not ascii-hex) value to use for database lookups atoh(id,hex_value,&hex_len); char *value = NULL; vector <struct cdb *>::iterator my_iter = myHashFiles.begin(); vector <struct cdb *>::iterator my_end = myHashFiles.end(); try { //while there are more databases to search and we have not found a match for(; my_iter != my_end && !value ; my_iter++) { //cerr << "\n looking for this MD5:" << id << " hex(" << hex_value << ") \n"; if (cdb_find(*my_iter, hex_value, hex_len)){ //cerr << "\n\nI found the key " << id << " and it is " << cdb_datalen(*my_iter) << " long\n\n"; value = (char *)malloc(cdb_datalen(*my_iter)); cdb_read(*my_iter,value,cdb_datalen(*my_iter),cdb_datapos(*my_iter)); //value = (char *)cdb_getdata(*my_iter); //cerr << "\n\nThe value is:" << value << " len is:" << strlen(value)<< "\n\n"; }; } } catch (...){} return value; }

  Read the article

• How to access a field's value in an object using reflection

  - by kentcdodds

  My Question: How to overcome an IllegalAccessException to access the value of a an object's field using reflection. Expansion: I'm trying to learn about reflection to make some of my projects more generic. I'm running into an IllegalAccessException when trying to call field.getValue(object) to get the value of that field in that object. I can get the name and type just fine. If I change the declaration from private to public then this works fine. But in an effort to follow the "rules" of encapsulation I don't want to do this. Any help would be greatly appreciated! Thanks! My Code: package main; import java.lang.reflect.Field; public class Tester { public static void main(String args[]) throws Exception { new Tester().reflectionTest(); } public void reflectionTest() throws Exception { Person person = new Person("John Doe", "555-123-4567", "Rover"); Field[] fields = person.getClass().getDeclaredFields(); for (Field field : fields) { System.out.println("Field Name: " + field.getName()); System.out.println("Field Type: " + field.getType()); System.out.println("Field Value: " + field.get(person)); //The line above throws: Exception in thread "main" java.lang.IllegalAccessException: Class main.Tester can not access a member of class main.Tester$Person with modifiers "private final" } } public class Person { private final String name; private final String phoneNumber; private final String dogsName; public Person(String name, String phoneNumber, String dogsName) { this.name = name; this.phoneNumber = phoneNumber; this.dogsName = dogsName; } } } The Output: run: Field Name: name Field Type: class java.lang.String Exception in thread "main" java.lang.IllegalAccessException: Class main.Tester can not access a member of class main.Tester$Person with modifiers "private final" at sun.reflect.Reflection.ensureMemberAccess(Reflection.java:95) at java.lang.reflect.AccessibleObject.slowCheckMemberAccess(AccessibleObject.java:261) at java.lang.reflect.AccessibleObject.checkAccess(AccessibleObject.java:253) at java.lang.reflect.Field.doSecurityCheck(Field.java:983) at java.lang.reflect.Field.getFieldAccessor(Field.java:927) at java.lang.reflect.Field.get(Field.java:372) at main.Tester.reflectionTest(Tester.java:17) at main.Tester.main(Tester.java:8) Java Result: 1 BUILD SUCCESSFUL (total time: 0 seconds)

  Read the article

• UCA + Natural Sorting

  - by Alix Axel

  I recently learnt that PHP already supports the Unicode Collation Algorithm via the intl extension: $array = array ( 'al', 'be', 'Alpha', 'Beta', 'Álpha', 'Àlpha', 'Älpha', '????', 'img10.png', 'img12.png', 'img1.png', 'img2.png', ); if (extension_loaded('intl') === true) { collator_asort(collator_create('root'), $array); } Array ( [0] => al [2] => Alpha [4] => Álpha [5] => Àlpha [6] => Älpha [1] => be [3] => Beta [11] => img1.png [9] => img10.png [8] => img12.png [10] => img2.png [7] => ???? ) As you can see this seems to work perfectly, even with mixed case strings! The only drawback I've encountered so far is that there is no support for natural sorting and I'm wondering what would be the best way to work around that, so that I can merge the best of the two worlds. I've tried to specify the Collator::SORT_NUMERIC sort flag but the result is way messier: collator_asort(collator_create('root'), $array, Collator::SORT_NUMERIC); Array ( [8] => img12.png [7] => ???? [9] => img10.png [10] => img2.png [11] => img1.png [6] => Älpha [5] => Àlpha [1] => be [2] => Alpha [3] => Beta [4] => Álpha [0] => al ) However, if I run the same test with only the img*.png values I get the ideal output: Array ( [3] => img1.png [2] => img2.png [1] => img10.png [0] => img12.png ) Can anyone think of a way to preserve the Unicode sorting while adding natural sorting capabilities?

  Read the article

• How to implement best matching logic in TSQL (SQL Server 2000)

  - by sanjay-kumar1911

  I have two tables X and Y: Table X C1 C2 C3 1 A 13 2 B 16 3 C 8 Table Y C1 C2 C3 C4 1 A 2 N 2 A 8 N 3 A 12 N 4 A 5 N 5 B 7 N 6 B 16 N 7 B 9 N 8 B 5 N 9 C 8 N 10 C 2 N 11 C 8 N 12 C 6 N Records in Table Y can be n number CREATE TABLE X(C1 INT, C2 CHAR(1), C3 INT); CREATE TABLE Y(C1 INT, C2 CHAR(1), C3 INT, C4 CHAR(1)); with following data: INSERT INTO X VALUES (1 'A',13 ); INSERT INTO X VALUES (2 'B',16 ); INSERT INTO X VALUES (3 'C',8 ); INSERT INTO Y VALUES (1,'A', 2,'N'); INSERT INTO Y VALUES (2,'A', 8,'N'); INSERT INTO Y VALUES (3,'A', 12,'N'); INSERT INTO Y VALUES (4,'A', 5,'N'); INSERT INTO Y VALUES (5,'B', 7,'N'); INSERT INTO Y VALUES (6,'B', 16,'N'); INSERT INTO Y VALUES (7,'B', 9,'N'); INSERT INTO Y VALUES (8,'B', 5,'N'); INSERT INTO Y VALUES (9,'C', 8,'N'); INSERT INTO Y VALUES (10,'C', 2,'N'); INSERT INTO Y VALUES (11,'C', 8,'N'); INSERT INTO Y VALUES (12,'C', 6,'N'); EXPECTED RESULT Table Y C1 C2 C3 C4 1 A 2 N 2 A 8 Y 3 A 12 N 4 A 5 Y 5 B 7 N 6 B 16 Y 7 B 9 N 8 B 5 N 9 C 8 Y 10 C 2 N 11 C 8 N 12 C 6 N How do I compare value of column C3 in Table X with all possible matches of column C3 of Table Y and to mark records as matched and unmatched in column C4 of Table Y? Possible matches for A (i.e. value of column C2 in Table X) would be (where R is row number i.e. value of column C1 in Table Y): R1, R2, R3, R4, R1+R2, R1+R3, R1+R4, R2+R3, R2+R4, R3+R4, R4+R5, R1+R2+R3, R1+R2+R4, R2+R3+R4, R1+R2+R3+R4

  Read the article

• C strange array behaviour

  - by LukeN

  After learning that both strncmp is not what it seems to be and strlcpy not being available on my operating system (Linux), I figured I could try and write it myself. I found a quote from Ulrich Drepper, the libc maintainer, who posted an alternative to strlcpy using mempcpy. I don't have mempcpy either, but it's behaviour was easy to replicate. First of, this is the testcase I have #include <stdio.h> #include <string.h> #define BSIZE 10 void insp(const char* s, int n) { int i; for (i = 0; i < n; i++) printf("%c ", s[i]); printf("\n"); for (i = 0; i < n; i++) printf("%02X ", s[i]); printf("\n"); return; } int copy_string(char *dest, const char *src, int n) { int r = strlen(memcpy(dest, src, n-1)); dest[r] = 0; return r; } int main() { char b[BSIZE]; memset(b, 0, BSIZE); printf("Buffer size is %d", BSIZE); insp(b, BSIZE); printf("\nFirst copy:\n"); copy_string(b, "First", BSIZE); insp(b, BSIZE); printf("b = '%s'\n", b); printf("\nSecond copy:\n"); copy_string(b, "Second", BSIZE); insp(b, BSIZE); printf("b = '%s'\n", b); return 0; } And this is its result: Buffer size is 10 00 00 00 00 00 00 00 00 00 00 First copy: F i r s t b = 46 69 72 73 74 00 62 20 3D 00 b = 'First' Second copy: S e c o n d 53 65 63 6F 6E 64 00 00 01 00 b = 'Second' You can see in the internal representation (the lines insp() created) that there's some noise mixed in, like the printf() format string in the inspection after the first copy, and a foreign 0x01 in the second copy. The strings are copied intact and it correctly handles too long source strings (let's ignore the possible issue with passing 0 as length to copy_string for now, I'll fix that later). But why are there foreign array contents (from the format string) inside my destination? It's as if the destination was actually RESIZED to match the new length.

  Read the article

< Previous Page | 731 732 733 734 735 736 737 738 739 740 741 742  | Next Page >