Search Results

Search found 19186 results on 768 pages for 'sharepoint search'.

Page 745/768 | < Previous Page | 741 742 743 744 745 746 747 748 749 750 751 752  | Next Page >

  • session management: problem displaying username in the header

    - by aeonsleo
    hi, I am working on a simple login and logout module for my website without any security. I am using wamp on a windows xp machine. I am creating session when a user submits the login informaton it redirects to a process.php file which creates the session variables and starts session. Now if the login is successful user is redirected to the welcome page which includes a header file(which displays the header involving signin logout help options) The problem is the header is not changing the signin link to logout as the user logs successfully. The below code is from process.php which initiates a login. $username = $_POST['username']; $password = $_POST['password']; //echo "{$username}:{$password}"; $connection = mysql_connect("localhost","root",""); if(!$connection) { die("Database Connection Failed".mysql_error()); } $db_select = mysql_select_db("tester",$connection); if(!$db_select) { die("Database Selection Failed".mysql_error()); } $result = mysql_query("SELECT * FROM user",$connection); if(!$result) { die("Database Selection Failed".mysql_error()); } $q = "SELECT * FROM user " ."WHERE Name='".$username."' AND Password='".$password. "' "; // Run query $r = mysql_query($q); if ( $obj = @mysql_fetch_object($r) ) { session_start(); // Login good, create session variables $_SESSION["valid_id"] = session_id(); $_SESSION["valid_user"] = $_POST["username"]; $_SESSION["valid_time"] = time(); Header('Location: welcome.php'); The following code is from header.php which is included in welcome.php </div> <div id = "userdetail"> <?php if(isset($_SESSION["valid_user"])) { echo($_SESSION["valid_user"]." " ); echo("<a href=logout.php>Logout</a>"); } else { echo("<a href = login.php>Sign In</a>"); } ?> | Help | Search <input type = "text" name = "searchbox" value = "" /> </div> </div>

    Read the article

  • php imap save massage to sent folder after sending

    - by user1108279
    I am stucked with this for two days. I am trying to use imap_append from PHP but no luck so far. I was able to to implement this code for single attachment but multiple attachments not working. <?php $authhost="{000.000.000.000:993/validate-cert/ssl}Sent"; $user="sadasd"; $pass="sadasd"; if ($mbox=imap_open( $authhost, $user, $pass)) { $dmy=date("d-M-Y H:i:s"); $filename="filename.pdf"; $attachment = chunk_split(base64_encode($filestring)); $boundary = "------=".md5(uniqid(rand())); $msg = ("From: Somebody\r\n" . "To: [email protected]\r\n" . "Date: $dmy\r\n" . "Subject: This is the subject\r\n" . "MIME-Version: 1.0\r\n" . "Content-Type: multipart/mixed; boundary=\"$boundary\"\r\n" . "\r\n\r\n" . "--$boundary\r\n" . "Content-Type: text/html;\r\n\tcharset=\"ISO-8859-1\"\r\n" . "Content-Transfer-Encoding: 8bit \r\n" . "\r\n\r\n" . "Hello this is a test\r\n" . "\r\n\r\n" . "--$boundary\r\n" . "Content-Transfer-Encoding: base64\r\n" . "Content-Disposition: attachment; filename=\"$filename\"\r\n" . "\r\n" . $attachment . "\r\n" . "\r\n\r\n\r\n" . "--$boundary--\r\n\r\n"); imap_append($mbox,$authhost,$msg); imap_close($mbox); } else { echo "<h1>FAIL!</h1>\n"; } ?> Now that raw code above is working but I am unable to add multiple attachments. In some cases I got message body base64 decoded and in message body lot of strange letters. Something like R0lGODlhkAEfAOYAAPSeZPONtdSIu+u2vv/La+5Rj8AhYPvWhOjtkfvi7MRImcjYse5DM6O+dOnl ..... I search all the web i still got no luck. Since I have dedicated server I also tried to implement some procmail+ postfix examples but also no luck. Can someone help?

    Read the article

  • Scalable Database Tagging Schema

    - by Longpoke
    EDIT: To people building tagging systems. Don't read this. It is not what you are looking for. I asked this when I wasn't aware that RDBMS all have their own optimization methods, just use a simple many to many scheme. I have a posting system that has millions of posts. Each post can have an infinite number of tags associated with it. Users can create tags which have notes, date created, owner, etc. A tag is almost like a post itself, because people can post notes about the tag. Each tag association has an owner and date, so we can see who added the tag and when. My question is how can I implement this? It has to be fast searching posts by tag, or tags by post. Also, users can add tags to posts by typing the name into a field, kind of like the google search bar, it has to fill in the rest of the tag name for you. I have 3 solutions at the moment, but not sure which is the best, or if there is a better way. Note that I'm not showing the layout of notes since it will be trivial once I get a proper solution for tags. Method 1. Linked list tagId in post points to a linked list in tag_assoc, the application must traverse the list until flink=0 post: id, content, ownerId, date, tagId, notesId tag_assoc: id, tagId, ownerId, flink tag: id, name, notesId Method 2. Denormalization tags is simply a VARCHAR or TEXT field containing a tab delimited array of tagId:ownerId. It cannot be a fixed size. post: id, content, ownerId, date, tags, notesId tag: id, name, notesId Method 3. Toxi (from: http://www.pui.ch/phred/archives/2005/04/tags-database-schemas.html, also same thing here: http://stackoverflow.com/questions/20856/how-do-you-recommend-implementing-tags-or-tagging) post: id, content, ownerId, date, notesId tag_assoc: ownerId, tagId, postId tag: id, name, notesId Method 3 raises the question, how fast will it be to iterate through every single row in tag_assoc? Methods 1 and 2 should be fast for returning tags by post, but for posts by tag, another lookup table must be made. The last thing I have to worry about is optimizing searching tags by name, I have not worked that out yet. I made an ASCII diagram here: http://pastebin.com/f1c4e0e53

    Read the article

  • Assembly Load and loading the "sub-modules" dependencies - "cannot fild the file specified"

    - by Ted
    There are several questions out there that ask the same question. However the answers they received I cannot understand, so here goes: Similar questions: http://stackoverflow.com/questions/1874277/dynamically-load-assembly-and-manually-force-path-to-get-referenced-assemblies ; http://stackoverflow.com/questions/22012/loading-assemblies-and-its-dependencies-closed The question in short: I need to figure out how dependencies, ie References in my modules can be loaded dynamically. Right now I am getting "The system cannot find the file specified" on Assemblies referenced in my so called modules. I cannot really get how to use the AssemblyResolve event... The longer version I have one application, MODULECONTROLLER, that loads separate modules. These "separate modules" are located in well-known subdirectories, like appBinDir\Modules\Module1 appBinDir\Modules\Module2 Each directory contains all the DLLs that exists in the bin-directory of those projects after a build. So the MODULECONTROLLER loads all the DLLs contained in those folders using this code: byte[] bytes = File.ReadAllBytes(dllFileFullPath); Assembly assembly = null; assembly = Assembly.Load(bytes); I am, as you can see, loading the byte[]-array (so I dont lock the DLL-files). Now, in for example MODULE1, I have a static reference called MyGreatXmlProtocol. The MyGreatXmlProtocol.dll then also exists in the directory appBinDir\Modules\Module1 and is loaded using the above code When code in the MODULE1 tries to use this MyGreatXmlProtocol, I get: Could not load file or assembly 'MyGreatXmlProtocol, Version=1.0.3797.26527, Culture=neutral, PublicKeyToken=null' or one of its dependencies. The system cannot find the file specified. So, in a post (like this one) they say that To my understanding reflection will load the main assembly and then search the GAC for the referenced assemblies, if it cannot find it there, you can then incorparate an assemblyResolve event: First; is it really needed to use the AssemblyResolve-event to make this work? Shouldnt my different MODULEs themself load their DLLs, as they are statically referenced? Second; if AssemblyResolve is the way to go - how do I use it? I have attached a handler to the Event but I never get anything on MyGreatXmlProctol... === EDIT === CODE regarding the AssemblyResolve-event handler: public GUI() { InitializeComponent(); AppDomain.CurrentDomain.AssemblyResolve += new ResolveEventHandler(CurrentDomain_AssemblyResolve); ... } // Assembly CurrentDomain_AssemblyResolve(object sender, ResolveEventArgs args) { Console.WriteLine(args.Name); return null; } Hope I wasnt too fuzzy =) Thx

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • apply style to range of text with javascript in uiwebview

    - by drawnonward
    I am displaying some simple styled text as html in a UIWebView on iPhone. It is basically a series of paragraphs with the occasional strong or emphasized phrase. At runtime I need to apply styles to ranges of text. There are a few similar scenarios, one of which is highlighting search results. If the user has searched for "something" I would like to change the background color behind occurrences of the word, then later restore the original background. Is it possible to apply styles to ranges of text using javascript? A key part of this is also being able to unset the styles. There seem to be two likely paths to follow. One would be modifying some html in Objective-C and passing it through javascript as the new innerHTML of some container. The other would be to use javascript to directly manipulate DOM nodes. I could manipulate html, but that sounds tedious in Objective-C so I would rather manipulate the DOM if that is a reasonable approach. I am not that familiar with javascript and DOM so I do not know if it is a reasonable approach. I wrote some routines to translate between text ranges and node ranges with offsets. So if I start with text range 100-200 and that starts in one paragraph and ends in a third, I can get the text nodes and the offsets within the nodes that represent the given text range. I just need a way to split a text node at an offset in the text. Currently I just apply styles to the paragraphs containing the text range. A few notes: straight javascript please, no external frameworks like jquery. the changes never need to be written to disk. the changes should be undoable or at least removable. the styles to apply already exist in a css file. it needs to work in iPhone 3.0 and forward. all the source files are shipped with the app. please be verbose. Thanks for any suggestions.

    Read the article

  • which way is correct to retrive data from oracle??

    - by rima
    before answer me plz thinking about the futures of these kind of program and answer me plz. I wanna get some data from oracle server like: 1-get all the function,package,procedure and etc for showing them or drop them & etc... 2-compile my *.sql files,get the result if they have problem & etc... becuz I was beginner in oracle first of all I for solve the second problem I try to connect to sqlPlus by RUN sqlplus and trace the output(I mean,I change the output stream of shell and trace what happend and handle the assigned message to customer. NOW THIS PART SUCCEED. just a little bit I have problem with get all result because the output is asynchronous.any way... [in this case I log in to oracle Server by send argument to the sqlplus by make a process in c#] after that I try to get all function,package or procedure name,but I have problem in speed!so I try to use oracle.DataAccess.dll to connect the database. now I m so confusing about: which way is correct way to build a program that work like Oracle Developer! I do not have any experience for like these program how work. If Your answer is I must use the second way follow this part plz: I search a little bit the Golden,PLedit (Benthic software),I have little bit problem how I must create the connection string?because I thinking about how I can find the host name or port number that oracle work on them?? am I need read the TNSNames.Ora file? IF your answer is I must use the first way follow this part plz: do u have any Idea for how I parse the output?because for example the result of a table is so confusing...[i can handle & program it but I really need someone experience,because the important things to me learn how such software work so nice and with quick response?] All of the has different style in output... If you are not sure Can u help me which book can help me in this way i become expert? becuz for example all the C# write just about how u can connect to DB and the DB books write how u can use this DB program,I looking for a book that give me some Idea how develop an interface for do transaction between these two.not simple send and receive data,for example how write a compiler for them. the language of book is not different for me i know C#,java,VB,sql,Oracle Thanks.

    Read the article

  • Hibernate Communications Link Failure in Restlet-Hibernate Based Java application powered by MySQL

    - by Vatsala
    Let me describe my question - I have a Java application - Hibernate as the DB interfacing layer over MySQL. I get the communications link failure error in my application. The occurence of this error is a very specific case. I get this error , When I leave mysql server unattended for more than approximately 6 hours (i.e. when there are no queries issued to MySQL for more than approximately 6 hours). I am pasting a top 'exception' level description below, and adding a pastebin link for a detailed stacktrace description. javax.persistence.PersistenceException: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: java.net.ConnectException: Connection refused: connect the link to the pastebin for further investigation - http://pastebin.com/4KujAmgD What I understand from these exception statements is that MySQL is refusing to take in any connections after a period of idle/nil activity. I have been reading up a bit about this via google search, and came to know that one of the possible ways to overcome this is to set values for c3p0 properties as c3p0 comes bundled with Hibernate. Specifically, I read from here http://www.mchange.com/projects/c3p0/index.html that setting two properties idleConnectionTestPeriod and preferredTestQuery will solve this for me. But these values dont seem to have had an effect. Is this the correct approach to fixing this? If not, what is the right way to get over this? The following are related Communications Link Failure questions at stackoverflow.com, but I've not found a satisfactory answer in their answers. http://stackoverflow.com/questions/2121829/java-db-communications-link-failure http://stackoverflow.com/questions/298988/how-to-handle-communication-link-failure Note 1 - i dont get this error when I am using my application continuosly. Note 2 - I use JPA with Hibernate and hence my hibernate.dialect,etc hibernate properties reside within the persistence.xml in the META-INF folder (does that prevent the c3p0 properties from working?)

    Read the article

  • Objective-C++ Memory Problem

    - by Stephen Furlani
    Hello, I'm having memory woes. I've got a C++ Library (Equalizer from Eyescale) and they use the Traversal Visitor Pattern to allow you to add new functionality to their classes. I've finally figured out how it works, and I've got a Visitor that just returns the properties from one of the objects. (since I don't know how they're allocated). so. My little code does this: VisitorResult AGLContextVisitor::visit( Channel* channel ) { // Search through Nodes, Pipes until we get to the right window. // Add some code to make sure we find the right one? // Not executing the following code as C++ in gdb? eq::Window* w = channel->getWindow(); OSWindow* osw = w->getOSWindow(); AGLWindow* aw = (AGLWindow *)osw; AGLContext agl_ctx = aw->getAGLContext(); this->setContext(agl_ctx); return TRAVERSE_PRUNE; } So here's the problem. eq::Window* w = channel->getWindow(); (gdb) print w 0x0 BUT If I do this: (gdb) set objc-non-blocking-mode off (gdb) print w=channel->getWindow() 0x300effb9 // an honest memory location, and sets w as verified in the Debugger window of XCode. It does the same thing for osw. I don't get it. Why would something work in (gdb) but not in the code? The file is completely a cpp file, but it seems to be running in objc++, since I need to turn blocking off. Help!? I feel like I'm missing some memory-management basic thing here, either with C++ or Obj-C. [edit] channel-getWindow() is supposed to do this: /** @return the parent window. @version 1.0 */ Window* getWindow() { return _window; } The code also executes fine if I run it from a C++-only application. [edit] No... I tried creating a simple stand-alone program since I was tired of running it as a plugin. Messy to debug. And no, it doesn't run in the C++ program either. So I'm really at a loss as to what I'm doing wrong. Thanks, -- Stephen Furlani

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • why this sql code dont work

    - by magy
    <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=windows-1256"> <title>??? ?????? ???? ????</title> </head> <body> <table width="100%" border="1"> <tr> <td>name</td> <td>number</td> <td>math</td> <td>arab</td> <td>history</td> <td>geo</td> </tr> <?php require_once "conf.php"; $sql2=("SELECT * FROM student WHERE snum = $ss"); $rs2 = mysql_query($sql2) or die(mysql_error()); $num = mysql_num_rows($rs2); $ss= $_POST["ss"]; if (empty($ss)) { echo "please write your search words";} else if ($num < 1 ) { echo "not found any like "; }else { $sql=("SELECT * FROM student WHERE snum = $ss "); $rs = mysql_query($sql) or die(mysql_error()); while($data=mysql_fetch_array($rs)){ $name=$data["sname"]; $number=$data["snum"]; $math=$data["math"]; $arab=$data["arab"]; $history=$data["history"]; $geo=$data["geo"]; echo" <tr> <td>$name</td> <td>$number</td> <td>$math</td> <td>$arab</td> <td>$history</td> <td>$geo</td> </tr> "; } }; ?> </table> </body> </html>

    Read the article

  • C++ using cdb_read returns extra characters on some reads

    - by Moe Be
    Hi All, I am using the following function to loop through a couple of open CDB hash tables. Sometimes the value for a given key is returned along with an additional character (specifically a CTRL-P (a DLE character/0x16/0o020)). I have checked the cdb key/value pairs with a couple of different utilities and none of them show any additional characters appended to the values. I get the character if I use cdb_read() or cdb_getdata() (the commented out code below). If I had to guess I would say I am doing something wrong with the buffer I create to get the result from the cdb functions. Any advice or assistance is greatly appreciated. char* HashReducer::getValueFromDb(const string &id, vector <struct cdb *> &myHashFiles) { unsigned char hex_value[BUFSIZ]; size_t hex_len; //construct a real hex (not ascii-hex) value to use for database lookups atoh(id,hex_value,&hex_len); char *value = NULL; vector <struct cdb *>::iterator my_iter = myHashFiles.begin(); vector <struct cdb *>::iterator my_end = myHashFiles.end(); try { //while there are more databases to search and we have not found a match for(; my_iter != my_end && !value ; my_iter++) { //cerr << "\n looking for this MD5:" << id << " hex(" << hex_value << ") \n"; if (cdb_find(*my_iter, hex_value, hex_len)){ //cerr << "\n\nI found the key " << id << " and it is " << cdb_datalen(*my_iter) << " long\n\n"; value = (char *)malloc(cdb_datalen(*my_iter)); cdb_read(*my_iter,value,cdb_datalen(*my_iter),cdb_datapos(*my_iter)); //value = (char *)cdb_getdata(*my_iter); //cerr << "\n\nThe value is:" << value << " len is:" << strlen(value)<< "\n\n"; }; } } catch (...){} return value; }

    Read the article

  • JavaScript regular expression literal persists between function calls

    - by Charles Anderson
    I have this piece of code: function func1(text) { var pattern = /([\s\S]*?)(\<\?(?:attrib |if |else-if |else|end-if|search |for |end-for)[\s\S]*?\?\>)/g; var result; while (result = pattern.exec(text)) { if (some condition) { throw new Error('failed'); } ... } } This works, unless the throw statement is executed. In that case, the next time I call the function, the exec() call starts where it left off, even though I am supplying it with a new value of 'text'. I can fix it by writing var pattern = new RegExp('.....'); instead, but I don't understand why the first version is failing. How is the regular expression persisting between function calls? (This is happening in the latest versions of Firefox and Chrome.) Edit Complete test case: <!DOCTYPE HTML> <html> <head> <meta http-equiv="Content-type" content="text/html;charset=UTF-8"> <title>Test Page</title> <style type='text/css'> body { font-family: sans-serif; } #log p { margin: 0; padding: 0; } </style> <script type='text/javascript'> function func1(text, count) { var pattern = /(one|two|three|four|five|six|seven|eight)/g; log("func1"); var result; while (result = pattern.exec(text)) { log("result[0] = " + result[0] + ", pattern.index = " + pattern.index); if (--count <= 0) { throw "Error"; } } } function go() { try { func1("one two three four five six seven eight", 3); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } try { func1("one two three four five six seven eight", 99); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } } function log(msg) { var log = document.getElementById('log'); var p = document.createElement('p'); p.innerHTML = msg; log.appendChild(p); } </script> </head> <body><div> <input type='button' id='btnGo' value='Go' onclick='go();'> <hr> <div id='log'></div> </div></body> </html> The regular expression continues with 'four' as of the second call on FF and Chrome, not on IE7 or Opera.

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • can this code be broken?

    - by user105165
    Consider the below html string <p>This is a paragraph tag</p> <font>This is a font tag</font> <div>This is a div tag</div> <span>This is a span tag</span> This string is processed to tokanize the text found in it and we get 2 results as below 1) Token Array : $tokenArray == array( 'This is a paragraph tag', 'This is a div tag', '<font>This is a font tag</font>', '<span>This is a span tag</span>' ); 2) Tokenized template : $templateString == "<p>{0}</p>{2}<div>{1}</div>{3}"; If you observe, the sequence of the text strings segments from the original HTML strings is different from the tokenized template The PHP code below is used to order the tokenized template and accordingly the token array to match the original html string class CreateTemplates { public static $tokenArray = array(); public static $tokenArrayNew = array(); function foo($templateString,$tokenArray) { CreateTemplates::$tokenArray = $tokenArray; $ptn = "/{[0-9]*}*/"; // Search Pattern from the template string $templateString = preg_replace_callback($ptn,array(&$this, 'callbackhandler') ,$templateString); // function call return $templateString; } // Function defination private static function callbackhandler($matches) { static $newArr = array(); static $cnt; $tokenArray = CreateTemplates::$tokenArray; array_push($newArr, $matches[0]); CreateTemplates::$tokenArrayNew[count($newArr)] = $tokenArray[substr($matches[0],1,(strlen($matches[0])-2))]; $cnt = count($newArr)-1; return '{'.$cnt.'}'; } // function ends } // class ends Final output is (ordered template and token array) $tokenArray == array('This is a paragraph tag', '<font>This is a font tag</font>', 'This is a div tag', '<span>This is a span tag</span>' ); $templateString == "<p>{0}</p>{1}<div>{2}</div>{3}"; Which is the expected result. Now, I am not confident whether this is the right way to achieve this. I want to see how this code can be broken or not. Under what conditions will this code break? (important) Is there any other way to achieve this? (less important)

    Read the article

  • Learning... anything really

    - by WebDevHobo
    I'm particularly interested in Windows PowerShell, but here's a somewhat more general complaint: When asking for help on learning something new, be it a small subject on PHP or understanding a class in Java, what usually happens is that people direct me towards the documentation pages. What I'm looking for is somewhat of a course. A deep explanation of why something works the way it does. I know my basic programming, like Java and C#. I've never seen C or C++, though I have seen a bit of assembler. I know what the Stack and Heap are, how boxing and unboxing works, why you have to deep-copy an array instead of copying the pointer and some other things. Windows PowerShell on the other hand, I know nothing about. And I notice that when reading the small document or some code, I usually forget what it does or why it works. What I am looking for is preferably, a nice tutorial that explains the beginnings, the concepts, and goes to more difficult things at a steady pace. The only thing documentation can do is explain what a function does. That's no good to me since I don't know what I want to do yet. I could read about a thousand functions, and forget about most of them, because I don't need to implement them right after it. Randomly wandering through the documentation doesn't do me any good. So conclude, what is a good tutorial on Windows Powershell? One which explains in clear language what is happening, one which builds on previous things learned. I don't think googling this is a good idea. Doing a Google search on this would turn up numerous tutorials. And experience tells me that you have to look long and hard to find the gem you're looking for. That's why I'm asking here. Because this is the place where you can find more experienced people. Many of the PowerShell guys among you will know the good ones already, and by asking you, I avoid wasting time that could be spent learning. So to summarize: I will not google this!

    Read the article

  • j2me bluetooth client. Function startInquiry nothing found.

    - by Hugi
    I develop simple j2me bluetooth client and have problem with bluetooth device search. Function startInquiry nothing found. Client : nokia 5220 Server : my pc with bluetooth adapter All bluetooth devices is on. /* * To change this template, choose Tools | Templates * and open the template in the editor. */ import javax.microedition.midlet.*; import javax.bluetooth.*; import java.util.Vector; import javax.microedition.lcdui.*; /** * @author ????????????? */ public class Midlet extends MIDlet implements DiscoveryListener { private static Vector vecDevices=new Vector(); private static String connectionURL=null; private LocalDevice localDevice; private DiscoveryAgent agent; private RemoteDevice remoteDevice; private RemoteDevice[] devList; private Display display; private Form form; public void startApp() { display = Display.getDisplay(this); form = new Form( "Client" ); try { localDevice = LocalDevice.getLocalDevice(); } catch( BluetoothStateException e ) { e.printStackTrace(); } form.append("Address: "+localDevice.getBluetoothAddress()+"\n\n"); form.append("Name: "+localDevice.getFriendlyName()+"\n\n"); try { agent = localDevice.getLocalDevice().getDiscoveryAgent(); form.append("Starting device inquiry... \n\n"); boolean si = agent.startInquiry(DiscoveryAgent.GIAC, this); if ( si ) { form.append("true"); } else { form.append("false"); } } catch( BluetoothStateException e ) { } int deviceCount = vecDevices.size(); if(deviceCount <= 0){ form.append("No Devices Found ."); } else{ //print bluetooth device addresses and names in the format [ No. address (name) ] form.append("Bluetooth Devices: "); for (int i = 0; i < deviceCount; i++) { remoteDevice=(RemoteDevice)vecDevices.elementAt(i); form.append( remoteDevice.getBluetoothAddress() ); } } display.setCurrent(form); } public void pauseApp() { } public void destroyApp(boolean unconditional) { } public void deviceDiscovered(RemoteDevice btDevice, DeviceClass cod) { //add the device to the vector if(!vecDevices.contains(btDevice)){ vecDevices.addElement(btDevice); } } public void inquiryCompleted(int discType) { } //implement this method since services are not being discovered public void servicesDiscovered(int transID, ServiceRecord[] servRecord) { if(servRecord!=null && servRecord.length>0){ connectionURL=servRecord[0].getConnectionURL(0,false); } } //implement this method since services are not being discovered public void serviceSearchCompleted(int transID, int respCode) { } }

    Read the article

  • Is it possible to create a service like Feed My Inbox on my own server?

    - by Mark Bowen
    I was just wondering if it's at all possible to create a service like Feed My Inbox on my own server using PHP? Basically I have a site which has RSS feeds which are dynamic in nature and can search from thousands of posts based on many different criteria. I have the RSS feed working fine and bringing back data dynamically for whatever criteria I want so that bits fine. I am using the ExpressionEngine CMS to handle the site and there will be thousands of users on the site (currently there are around 2,0000) but that number is exponentially growing every single day. What I want to be able to do is allow the users to choose from certain criteria which will then build a dynamic RSS URL which will then be stored in a database table (one row for each user). This bit I will be able to do myself but then I want to be able to send out new RSS feed items via e-mail to each user. This is the part I'm a little stuck on. I'm guessing I would somehow need to run a cron job to hit a page which would check each users RSS feed and then if there are new items to send them to the user via e-mail. That's where I am totally stuck though and I'm just wondering what the best way to go about it would be? That or any software in PHP that already does this sort of thing would be great. I tried out phpList but it has severe problems working with RSS and I only ever got it to work once and now never again and I've read that lots of people have had this same problem so unfortunately it's not just me :-( I know there are services such as Feed My Inbox which I could easily set up so that users click a link and their RSS feed URL is added to go and use that service but I want to keep users from seeing the dynamic nature of the feed or they will easily be able to modify it to get at other items in the feed. I need this so that I can charge for access to the feeds but if people can see the URL of the feed then I will be totally unstuck as they will be able to get at whatever they want very easily. Therefore I'd like to be able to send the items out to them. Would really love to hear if anyone knows if this kind of thing is possible at all and what would be involved?

    Read the article

  • sed - trying to replace first occurrence after a match

    - by wakkaluba
    I am facing a situation that drives me nuts. I am setting up an update server which uses a json file. Don't ask why or how, it sucks and is my only possibility to achieve it. I have been trying and researching for HOURS (many) because I went ballistic and wanted to crack this on my own. But I have to realize I got stuck and need help. So sorry for this chunk but I think it is somewhat important to see... The file is a one liner and repeating the following sequence with changing values (of course). "plugin_name_foo_bar": {"buildDate": "bla", "dependencies": [{"name": "bla", "optional": true, "version": "1.00"}], "developers": [{"developerId": "bla", "email": "[email protected]", "name": "Bla bla2nd"}], "excerpt": "some text {excerpt} !bla.png|thumbnail,border=1! ", "gav": "bla", "labels": ["report", "scm-related"], "name": "plugin_name_foo_bar", "previousTimestamp": "bla", "previousVersion": "1.0", "releaseTimestamp": "bla", "requiredCore": "1", "scm": "github.com", "sha1": "ynnBM2jWo25ZLDdP3ybBOnV/Pio=", "title": "bla", "url": "http://bla.org", "version": "1.0", "wiki": "https://bla.org"}, "Exclusion": {"buildDate": "bla", "dependencies": [], and the next plugin block is glued straight afterwards. What I now want to do is to search for "plugin_foo_bar": {" as this is the unique identifier for a new plugin description block. I want to replace the first sha1 value occuring afterwards. That's where I keep failing. I always grab the first,last or any occurrence in the entire file and not the block :( "title" is the unique identifier after the sha1 value. So I tried to make the .* less greedy but it ain't working out. last attempt was heading towards: sed -i 's/("name": "plugin_name_foo_bar.*sha1": ")([a-zA-Z0-9!@#\$%^&*()\[\]]*)(", "title"\)/\1blablabla\2/1' default.json to find the sha1 value of that plugin but still no joy. I hope someone knows - preferably a simpler approach - before I now continue with trial and error until I have to puke and freakout. I am working with SED on Windows, so Unix approach might help me to figure out how to achieve this in batch but please make it as one-liner if possible. Scripts are a real pain to convert. And I just need SED and no other solution with other tools like AWK. That is absolutely out of discussion. Any help is appreciated :) Cheers Jan

    Read the article

  • match "//" comments with regex but not inside a quote

    - by Wireless102
    I need to match and replace some comments. for example: $test = "the url is http://www.google.com";// comment "<-- that quote needs to be matched I want to match the comments outside of the quotes, and replace any "'s in the comments with &quot;'s. I have tried a number of patterns and different ways of running them but with no luck. The regex will be run with javascript to match php "//" comments UPDATE: I took the regex from borkweb below and modified it. used a function from http://ejohn.org/blog/search-and-dont-replace/ and came up with this: <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"> <html> <head> <title></title> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript"> function t_replace(data){ var q = {}, ret = ""; data.replace(/(?:((["'\/]*(("[^"]*")|('[^']*'))?[\s]*)?[\/\/|#][^"|^']*))/g, function(value){ q[key] = value; }); for ( var key in q ){ ret = q[key]; } var text = data.split(ret); var out = ret + text[1]; out = out.replace(/"/g,"&quot;"); out = out.replace(/'/g,"&apos;"); return text[0] + out; } </script> </head> <body> <script type="text/javascript"> document.write(t_replace("$test = \"the url is http://www.google.com\";// c'o\"mment \"\"\"<-- that quote needs to be matched")+"<br>"); document.write(t_replace("$test = 'the url is http://www.google.com';# c'o\"mment \"\"\"<-- that quote needs to be matched")); </script> </body> </html> it handles all the line comments outside of single or double quotes. Is there anyway I could optimize this function?

    Read the article

  • whats wrong with this php mysql_real_escape_string

    - by skyhigh
    Hi Atomic Number Latin English Abbreviation * check the variables for content */ /*** a list of filters ***/ $filters = array( 'searchtext' => array( 'filter' => FILTER_CALLBACK, 'options' => 'mysql_real_escape_string'), 'fieldname' => array( 'filter' => FILTER_CALLBACK, 'options' => 'mysql_real_escape_string') ); /*** escape all POST variables ***/ $input = filter_input_array(INPUT_POST, $filters); /*** check the values are not empty ***/ if(empty($input['fieldname']) || empty($input['searchtext'])) { echo 'Invalid search'; } else { /*** mysql hostname ***/ $hostname = 'localhost'; /*** mysql username ***/ $username = 'username'; /*** mysql password ***/ $password = 'password'; /*** mysql database name ***/ $dbname = 'periodic_table'; /*** connect to the database ***/ $link = @mysql_connect($hostname, $username, $password); /*** check if the link is a valid resource ***/ if(is_resource($link)) { /*** select the database we wish to use ***/ if(mysql_select_db($dbname, $link) === TRUE) { /*** sql to SELECT information***/ $sql = sprintf("SELECT * FROM elements WHERE %s = '%s'", $input['fieldname'], $input['searchtext']); /*** echo the sql query ***/ echo '<h3>'.$sql.'</h3>'; /*** run the query ***/ $result = mysql_query($sql); /*** check if the result is a valid resource ***/ if(is_resource($result)) { /*** check if we have more than zero rows ***/ if(mysql_num_rows($result) !== 0) { echo '<table>'; while($row=mysql_fetch_array($result)) { echo '<tr> <td>'.$row['atomicnumber'].'</td> <td>'.$row['latin'].'</td> <td>'.$row['english'].'</td> <td>'.$row['abbr'].'</td> </tr>'; } echo '</table>'; } else { /*** if zero results are found.. ***/ echo 'Zero results found'; } } else { /*** if the resource is not valid ***/ 'No valid resource found'; } } /*** if we are unable to select the database show an error ****/ else { echo 'Unable to select database '.$dbname; } /*** close the connection ***/ mysql_close($link); } else { /*** if we fail to connect ***/ echo 'Unable to connect'; } } } else { echo 'Please Choose An Element'; } ? I got this code from phppro.org tutorials site and i tried to run it. It gives Warning: mysql_real_escape_string() [function.mysql-real-escape-string]: A link to the server could not be established. .... Warning: mysql_real_escape_string() [function.mysql-real-escape-string]: Access denied for user 'ODBC'@'localhost' (using password: NO).... I went to php.net and look it up "Note: A MySQL connection is required before using mysql_real_escape_string() otherwise an error of level E_WARNING is generated, and FALSE is returned. If link_identifier isn't defined, the last MySQL connection is used." My questions are: 1-why they put single quotation around mysql_real_escape_string ? 2-They should establish a connection first, then use the $filter array statement with mysql_real_escape_string ?

    Read the article

  • VB.NET looping through XML to store in singleton

    - by rockinthesixstring
    I'm having a problem with looping through an XML file and storing the value in a singleton My XML looks like this <values> <value></value> <value>$1</value> <value>$5,000</value> <value>$10,000</value> <value>$15,000</value> <value>$25,000</value> <value>$50,000</value> <value>$75,000</value> <value>$100,000</value> <value>$250,000</value> <value>$500,000</value> <value>$750,000</value> <value>$1,000,000</value> <value>$1,250,000</value> <value>$1,500,000</value> <value>$1,750,000</value> <value>$2,000,000</value> <value>$2,500,000</value> <value>$3,000,000</value> <value>$4,000,000</value> <value>$5,000,000</value> <value>$7,500,000</value> <value>$10,000,000</value> <value>$15,000,000</value> <value>$25,000,000</value> <value>$50,000,000</value> <value>$100,000,000</value> <value>$100,000,000+</value> </values> And my function looks like this Public Class LoadValues Private Shared SearchValuesInstance As List(Of SearchValues) = Nothing Public Shared ReadOnly Property LoadSearchValues As List(Of SearchValues) Get Dim sv As New List(Of SearchValues) If SearchValuesInstance Is Nothing Then Dim objDoc As XmlDocument = New XmlDataDocument Dim objRdr As XmlTextReader = New XmlTextReader(HttpContext.Current.Server.MapPath("~/App_Data/Search-Values.xml")) objRdr.Read() objDoc.Load(objRdr) Dim root As XmlElement = objDoc.DocumentElement Dim itemNodes As XmlNodeList = root.SelectNodes("/values") For Each n As XmlNode In itemNodes sv.Add(New SearchValues(n("@value").InnerText, n("@value").InnerText)) Next SearchValuesInstance = sv Else : sv = SearchValuesInstance End If Return sv End Get End Property End Class My problem is that I'm getting an object not set to an instance of an object on the sv.Add(New SearchValues(n("@value").InnerText, n("@value").InnerText)) line.

    Read the article

  • Best practices for displaying large number of images as thumbnails in c#

    - by andySF
    I got to a point where it's very difficult to get answers by debugging and tracing object, so i need some help. What I'm trying to do: A history form for my screen capture pet project. The history must list all images as thumbnails (ex: picasa). What I've done: I created a HistoryItem:UserControl. This history item has a few buttons, a check box, a label and a picture box. The buttons are for delete/edit/copy image. The check box is used for selecting one or more images and the label is for some info text. The picture box is getting the image from a public property that is a path and a method creates a proportional thumbnail to display it when the control has been loaded. This user control has two public events. One for deleting the image and one for bubbling the events for mouse enter and mouse leave trough all controls. For this I use EventBroadcastProvider. The bubbling is useful because wherever I move the mouse over the control, the buttons appear. The dispose method has been extended and I manually remove the events. All images are loaded by looping a xml file that contains the path of all images. For each image in this XML I create a new HitoryItem that is added (after a little coding to sort and limit the amount of images loaded) to a flow layout panel. The problem: When I lunch the history form, and the flow layout panel is populated with my HistoryItem custom control, my memory usage increases drastically.From 14Mb to around 100MB with 100 images loaded. By closing the history form and disposing whatever I could dispose and even trying to call GC.Collect() the memory increase remain. I search for any object that could not be disposed properly like an image or event but wherever I used them they are disposed. The problem seams to be from multiple sources. One is that the events for bubbling are not disposing properly, and the other is from the picture box itself. All of this i could see by commenting all the code to a limited version when only the custom control without any image processing and even events is loaded. Without the events the memory consumption is reduced by axiomatically 20%. So my real question is if this logic, flow layout panels and custom controls with picture boxes, is the best solution for displaying large amounts of images as thumbnails. Thank you!

    Read the article

  • Issues in Ajax based applications

    - by Sinuhe
    I'm very interested in developing Ajax based applications. This is, loading almost all of the content of the application via XMLHttpRequest, instead of only some combos and widgets. But if I try to do this form scratch, soon I find some problems without an easy solution. I wonder if there is some framework (both client and server side) to deal with this issues. As far as I know, there isn't (but I've searched mainly in Java world). So I am seriously thinking of doing my own framework, at least for my projects. Therefore, in this question I ask for several things. First, the possible problems of an ajax based development. Then, I'm looking for some framework or utility in order to deal with them. Finally, if there is no framework available, what features must it have. Here are the issues I thought: 1 - JavaScript must be enabled. Security paranoia isn't the only problem: a lot of mobile devices couldn't use the application, too. 2 - Sometimes you need to update more than one DIV (e.g. main content, menu and breadcrumbs). 3 - Unknown response type: when you make an Ajax call, you set the callback function too, usually specifying if expected response is a javascript object or in which DIV put the result. But this fails when you get another type of response: for example when the session has expired and the user must log in again. 4 - Browser's refresh, back and forward buttons can be a real pain. User will expect different behaviors depending on the situation. 5 - When search engines indexes a site, only follow links. Thus, content load by Ajax won't "exist" for who doesn't know about it yet. 6 - Users can ask for open a link in a different window/tab. 7 - Address bar doesn't show the "real" page you are in. So, you can't copy the location and send it to a friend or bookmark the page. 8 - If you want to monetize the site, you can put some advertisings. As you don't refresh entire page and you want to change the ad after some time, you have to refresh only the DIV where the ad is. But this can violate the Terms and Conditions of your ad service. In fact, it can go against AdSense TOS. 9 - When you refresh an entire page, all JavaScript gets "cleaned". But in Ajax calls, all JavaScript objects will remain. 10 - You can't easily change your CSS properties.

    Read the article

  • Configuring a html page from an original demo page

    - by Wold
    I forked into rainyday.js through github, an awesome javascript program made by maroslaw at this link: https://github.com/maroslaw/rainyday.js. Basically I tried taking his demo page and my own photo city.jpg and changed the applicable fields so that I could run it on my own site, but only the picture loads and the script itself doesn't start to run. I'm pretty new to html and javascript so I'm probably omitting something very simple, but here is the script for the demo code: <script src="rainyday.js"></script> <script> function getURLParameter(name) { return decodeURIComponent((new RegExp('[?|&]' + name + '=' + '([^&;]+?)(&|#|;|$)').exec(location.search)||[,''])[1].replace(/\+/g, '%20'))||null; } function demo() { var image = document.getElementById('background'); image.onload = function () { var engine = null; var preset = getURLParameter('preset') || '1'; if (preset === '1') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.rain([ [1, 2, 8000] ]); engine.rain([ [3, 3, 0.88], [5, 5, 0.9], [6, 2, 1] ], 100); } else if (preset === '2') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.VARIABLE_GRAVITY_ANGLE = Math.PI / 8; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 50); } else if (preset === '3') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.trail = engine.TRAIL_SMUDGE; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 100); } }; image.crossOrigin = 'anonymous'; if (getURLParameter('imgur')) { image.src = 'http://i.imgur.com/' + getURLParameter('imgur') + '.jpg'; } else if (getURLParameter('img')) { image.src = getURLParameter('img') + '.jpg'; } var youtube = getURLParameter('youtube'); if (youtube) { var div = document.getElementById('sound'); var player = document.createElement('iframe'); player.frameborder = '0'; player.height = '1'; player.width = '1'; player.src = 'https://youtube.com/embed/' + youtube + '?autoplay=1&controls=0&showinfo=0&autohide=1&loop=1'; div.appendChild(player); } } </script> This is where I am naming my background and specifying the photo from within the directory. <body onload="demo();"> <div id="sound" style="z-index: -1;"></div> <div id="parent"> <img id='background' alt="background" src="city.jpg" /> </div> </body> The actual code for the whole entire rainyday.js script can be found here: https://github.com/maroslaw/rainyday.js/blob/master/rainyday.js Thanks in advance for any help and advice!

    Read the article

< Previous Page | 741 742 743 744 745 746 747 748 749 750 751 752  | Next Page >