Search Results

Search found 2136 results on 86 pages for 'dominik str'.

Page 75/86 | < Previous Page | 71 72 73 74 75 76 77 78 79 80 81 82  | Next Page >

  • How to Select Items in Dropdown in Selenium

    - by Marcus Gladir
    Firstly, I have been trying to get the dropdown from this web page: http://solutions.3m.com/wps/portal/3M/en_US/Interconnect/Home/Products/ProductCatalog/Catalog/?PC_Z7_RJH9U5230O73D0ISNF9B3C3SI1000000_nid=RFCNF5FK7WitWK7G49LP38glNZJXPCDXLDbl This is the code I have: import urllib2 from bs4 import BeautifulSoup import re from pprint import pprint import sys from selenium import common from selenium import webdriver import selenium.webdriver.support.ui as ui from boto.s3.key import Key import requests url = 'http://solutions.3m.com/wps/portal/3M/en_US/Interconnect/Home/Products/ProductCatalog/Catalog/?PC_Z7_RJH9U5230O73D0ISNF9B3C3SI1000000_nid=RFCNF5FK7WitWK7G49LP38glNZJXPCDXLDbl' element_xpath = '//*[@id="Component1"]' driver = webdriver.PhantomJS() driver.get(url) element = driver.find_element_by_xpath(element_xpath) element_xpath = '/option[@value="02"]' all_options = element.find_elements_by_tag_name("option") for option in all_options: print("Value is: %s" % option.get_attribute("value")) option.click() source = driver.page_source.encode('utf-8', 'ignore') driver.quit() source = str(source) soup = BeautifulSoup(source, 'html.parser') print soup What prints out is this: Traceback (most recent call last): File "../../../../test.py", line 58, in <module> Value is: XX main() File "../../../../test.py", line 46, in main option.click() File "/home/eric/dev/octocrawler-env/local/lib/python2.7/site-packages/selenium-2.33.0-py2.7.egg/selenium/webdriver/remote/webelement.py", line 54, in click self._execute(Command.CLICK_ELEMENT) File "/home/eric/dev/octocrawler-env/local/lib/python2.7/site-packages/selenium-2.33.0-py2.7.egg/selenium/webdriver/remote/webelement.py", line 228, in _execute return self._parent.execute(command, params) File "/home/eric/dev/octocrawler-env/local/lib/python2.7/site-packages/selenium-2.33.0-py2.7.egg/selenium/webdriver/remote/webdriver.py", line 165, in execute self.error_handler.check_response(response) File "/home/eric/dev/octocrawler-env/local/lib/python2.7/site-packages/selenium-2.33.0-py2.7.egg/selenium/webdriver/remote/errorhandler.py", line 158, in check_response raise exception_class(message, screen, stacktrace) selenium.common.exceptions.ElementNotVisibleException: Message: u'{"errorMessage":"Element is not currently visible and may not be manipulated","request":{"headers":{"Accept":"application/json","Accept-Encoding":"identity","Connection":"close","Content-Length":"81","Content-Type":"application/json;charset=UTF-8","Host":"127.0.0.1:51413","User-Agent":"Python-urllib/2.7"},"httpVersion":"1.1","method":"POST","post":"{\\"sessionId\\": \\"30e4fd50-f0e4-11e3-8685-6983e831d856\\", \\"id\\": \\":wdc:1402434863875\\"}","url":"/click","urlParsed":{"anchor":"","query":"","file":"click","directory":"/","path":"/click","relative":"/click","port":"","host":"","password":"","user":"","userInfo":"","authority":"","protocol":"","source":"/click","queryKey":{},"chunks":["click"]},"urlOriginal":"/session/30e4fd50-f0e4-11e3-8685-6983e831d856/element/%3Awdc%3A1402434863875/click"}}' ; Screenshot: available via screen And the weirdest most infuriating bit of it all is that sometimes it actually all works out. I have no clue what's going on here.

    Read the article

  • C# Why can't I find Sum() of this HashSet. says "Arithmetic operation resulted in an overflow."

    - by user2332665
    I was trying to solve this problem projecteuler,problem125 this is my solution in python(just for understanding the logic) import math lim=10**8 found=set() for start in xrange(1,int(math.sqrt(lim))): sos = start*start for i in xrange(start+1,int(math.sqrt(lim))): sos += (i*i) if sos >= lim: break s=str(int(sos)) if s==s[::-1]: found.add(sos) print sum(found) the same code I wrote in C# is as follows using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace ConsoleApplication1 { class Program { public static bool isPalindrome(string s) { string temp = ""; for (int i=s.Length-1;i>=0;i-=1){temp+=s[i];} return (temp == s); } static void Main(string[] args) { int lim = Convert.ToInt32(Math.Pow(10,8)); var found = new HashSet<int>(); for (int start = 1; start < Math.Sqrt(lim); start += 1) { int s = start *start; for (int i = start + 1; start < Math.Sqrt(lim); i += 1) { s += i * i; if (s > lim) { break; } if (isPalindrome(s.ToString())) { found.Add(s); } } } Console.WriteLine(found.Sum()); } } } the code debugs fine until it gives an exception at Console.WriteLine(found.Sum()); (line31). Why can't I find Sum() of the set found

    Read the article

  • geocoder.getFromLocationName returns only null

    - by test
    Hello, I am going out of my mind for the last 2 days with an IllegalArgumentException error i receive in android code when trying to get a coordinates out of an address, or even reverse, get address out of longitude and latitude. this is the code, but i cannot see an error. is a standard code snippet that is easily found on a google search. public GeoPoint determineLatLngFromAddress(Context appContext, String strAddress) { Geocoder geocoder = new Geocoder(appContext, Locale.getDefault()); GeoPoint g = null; try { System.out.println("str addres: " + strAddress); List<Address> addresses = geocoder.getFromLocationName(strAddress, 5); if (addresses.size() > 0) { g = new GeoPoint((int) (addresses.get(0).getLatitude() * 1E6), (int) (addresses.get(0).getLongitude() * 1E6)); } } catch (Exception e) { throw new IllegalArgumentException("locationName == null"); } return g; } These are the permissions from manifest.xml file: <uses-permission android:name="android.permission.INTERNET" /> <uses-permission android:name="android.permission.ACCESS_FINE_LOCATION" /> <uses-permission android:name="android.permission.ACCESS_COARSE_LOCATION" /> <uses-permission android:name="android.permission.ACCESS_MOCK_LOCATION" /> I do have the Google Api key declared too: <uses-library android:name="com.google.android.maps" /> From the code snippet above, geo coder is not null, neither is the address or appContext, and i stumble here: geocoder.getFromLocationName(strAddress, 5); I did a lot of google searching and found nothing that worked, and the most important info i found is this: ""The Geocoder class requires a backend service that is not included in the core android framework." Sooo, i am confuzed now. What do I have to call, import, add, use in code.... to make this work? I am using Google Api2.2, Api level 8. If somebody has found a solution for this, or a pointer for documentation, something that i didn't discover, please let us know. Thank you for your time.

    Read the article

  • Extracting bool from istream in a templated function

    - by Thomas Matthews
    I'm converting my fields class read functions into one template function. I have field classes for int, unsigned int, long, and unsigned long. These all use the same method for extracting a value from an istringstream (only the types change): template <typename Value_Type> Value_Type Extract_Value(const std::string& input_string) { std::istringstream m_string_stream; m_string_stream.str(input_string); m_string_stream.clear(); m_string_stream >> value; return; } The tricky part is with the bool (Boolean) type. There are many textual representations for Boolean: 0, 1, T, F, TRUE, FALSE, and all the case insensitive combinations Here's the questions: What does the C++ standard say are valid data to extract a bool, using the stream extraction operator? Since Boolean can be represented by text, does this involve locales? Is this platform dependent? I would like to simplify my code by not writing my own handler for bool input. I am using MS Visual Studio 2008 (version 9), C++, and Windows XP and Vista.

    Read the article

  • Python interface to PayPal - urllib.urlencode non-ASCII characters failing

    - by krys
    I am trying to implement PayPal IPN functionality. The basic protocol is as such: The client is redirected from my site to PayPal's site to complete payment. He logs into his account, authorizes payment. PayPal calls a page on my server passing in details as POST. Details include a person's name, address, and payment info etc. I need to call a URL on PayPal's site internally from my processing page passing back all the params that were passed in abovem and an additional one called 'cmd' with a value of '_notify-validate'. When I try to urllib.urlencode the params which PayPal has sent to me, I get a: While calling send_response_to_paypal. Traceback (most recent call last): File "<snip>/account/paypal/views.py", line 108, in process_paypal_ipn verify_result = send_response_to_paypal(params) File "<snip>/account/paypal/views.py", line 41, in send_response_to_paypal params = urllib.urlencode(params) File "/usr/local/lib/python2.6/urllib.py", line 1261, in urlencode v = quote_plus(str(v)) UnicodeEncodeError: 'ascii' codec can't encode character u'\ufffd' in position 9: ordinal not in range(128) I understand that urlencode does ASCII encoding, and in certain cases, a user's contact info can contain non-ASCII characters. This is understandable. My question is, how do I encode non-ASCII characters for POSTing to a URL using urllib2.urlopen(req) (or other method) Details: I read the params in PayPal's original request as follows (the GET is for testing): def read_ipn_params(request): if request.POST: params= request.POST.copy() if "ipn_auth" in request.GET: params["ipn_auth"]=request.GET["ipn_auth"] return params else: return request.GET.copy() The code I use for sending back the request to PayPal from the processing page is: def send_response_to_paypal(params): params['cmd']='_notify-validate' params = urllib.urlencode(params) req = urllib2.Request(PAYPAL_API_WEBSITE, params) req.add_header("Content-type", "application/x-www-form-urlencoded") response = urllib2.urlopen(req) status = response.read() if not status == "VERIFIED": logging.warn("PayPal cannot verify IPN responses: " + status) return False return True Obviously, the problem only arises if someone's name or address or other field used for the PayPal payment does not fall into the ASCII range.

    Read the article

  • FancyURLOpener failing since moving to python 3.1.2

    - by Andrew Shepherd
    I had an application that was downloading a .CSV file from a password-protected website then processing it futher. I was using FancyURLOpener, and simply hardcoding the username and password. (Obviously, security is not a high priority in this particular instance). Since downloading Python 3.1.2, this code has stopped working. Does anyone know of the changes that have happened to the implementation? Here is a cut down version of the code: import urllib.request; class TracOpener (urllib.request.FancyURLopener) : def prompt_user_passwd(self, host, realm) : return ('andrew_ee', '_my_unenctryped_password') csvUrl='http://mysite/report/19?format=csv@USER=fred_nukre' opener = TracOpener(); f = opener.open(csvUrl); s = f.read(); f.close(); s; For the sake of completeness, here's the entire call stack: Traceback (most recent call last): File "C:\reporting\download_csv_file.py", line 12, in <module> f = opener.open(csvUrl); File "C:\Program Files\Python31\lib\urllib\request.py", line 1454, in open return getattr(self, name)(url) File "C:\Program Files\Python31\lib\urllib\request.py", line 1628, in open_http return self._open_generic_http(http.client.HTTPConnection, url, data) File "C:\Program Files\Python31\lib\urllib\request.py", line 1624, in _open_generic_http response.status, response.reason, response.msg, data) File "C:\Program Files\Python31\lib\urllib\request.py", line 1640, in http_error result = method(url, fp, errcode, errmsg, headers) File "C:\Program Files\Python31\lib\urllib\request.py", line 1878, in http_error_401 return getattr(self,name)(url, realm) File "C:\Program Files\Python31\lib\urllib\request.py", line 1950, in retry_http_basic_auth return self.open(newurl) File "C:\Program Files\Python31\lib\urllib\request.py", line 1454, in open return getattr(self, name)(url) File "C:\Program Files\Python31\lib\urllib\request.py", line 1628, in open_http return self._open_generic_http(http.client.HTTPConnection, url, data) File "C:\Program Files\Python31\lib\urllib\request.py", line 1590, in _open_generic_http auth = base64.b64encode(user_passwd).strip() File "C:\Program Files\Python31\lib\base64.py", line 56, in b64encode raise TypeError("expected bytes, not %s" % s.__class__.__name__) TypeError: expected bytes, not str

    Read the article

  • Django: Odd mark_safe behaviour?

    - by Mark
    I wrote this little function for writing out HTML tags: def html_tag(tag, content=None, close=True, attrs={}): lst = ['<',tag] for key, val in attrs.iteritems(): lst.append(' %s="%s"' % (key, escape_html(val))) if close: if content is None: lst.append(' />') else: lst.extend(['>', content, '</', tag, '>']) else: lst.append('>') return mark_safe(''.join(lst)) Which worked great, but then I read this article on efficient string concatenation (I know it doesn't really matter for this, but I wanted consistency) and decided to update my script: def html_tag(tag, body=None, close=True, attrs={}): s = StringIO() s.write('<%s'%tag) for key, val in attrs.iteritems(): s.write(' %s="%s"' % (key, escape_html(val))) if close: if body is None: s.write(' />') else: s.write('>%s</%s>' % (body, tag)) else: s.write('>') return mark_safe(s.getvalue()) But now my HTML get escaped when I try to render it from my template. Everything else is exactly the same. It works properly if I replace the last line with return mark_safe(unicode(s.getvalue())). I checked the return type of s.getvalue(). It should be a str, just like the first function, so why is this failing?? Also fails with SafeString(s.getvalue()) but succeeds with SafeUnicode(s.getvalue()). I'd also like to point out that I used return mark_safe(s.getvalue()) in a different function with no odd behavior. The "call stack" looks like this: class Input(Widget): def render(self): return html_tag('input', attrs={'type':self.itype, 'id':self.id, 'name':self.name, 'value':self.value, 'class':self.itype}) class Field: def __unicode__(self): return mark_safe(self.widget.render()) And then {{myfield}} is in the template. So it does get mark_safed'd twice, which I thought might have been the problem, but I tried removing that too..... I really have no idea what's causing this, but it's not too hard to work around, so I guess I won't fret about it.

    Read the article

  • XamlWriter fails to serialize objects in WinForms app

    - by Eddie
    Apparently XamlWriter doesn't works correctly in a WinForms application. XamlWriter uses MarkupWriter.GetMarkupObjectFor(object obj). I suppose that there's a problem to determine the full list of properties to serialize. var ar = new AssemblyReference(AppDomain.CurrentDomain.GetAssemblies().First()); var str = XamlWriter.Save(ar); Running an ASP.NET or WPF application I got this result: <AssemblyReference AssemblyName="mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089" HintPath="file:///c:/WINDOWS/Microsoft.NET/Framework/v2.0.50727/mscorlib.dll" SpecificVersion="False" xmlns="clr-namespace:Ivolutia.TypeModel;assembly=ivoTypeModel" /> But running the same code in a WinForms application I got this: <AssemblyReference xmlns="clr-namespace:Ivolutia.TypeModel;assembly=ivoTypeModel" /> this is the class definition: public class AssemblyReference : DependencyObject { public string AssemblyName { get; set; } public string HintPath { get; set; } public bool SpecificVersion { get; set; } public AssemblyReference() { } public AssemblyReference(Assembly assembly) { AssemblyName = assembly.FullName; HintPath = assembly.CodeBase; } public override string ToString() { return AssemblyName; } }

    Read the article

  • Python API for VirtualBox

    - by jessica
    I have made a command-line interface for virtualbox such that the virtualbox can be controlled from a remote machine. now I am trying to implement the commmand-line interface using python virtualbox api. For that I have downloaded the pyvb package (python api documentation shows functions that can be used for implementing this under pyvb package). but when I give pyvb.vb.VB.startVM(instance of VB class,pyvb.vm.vbVM) SERVER SIDE CODE IS from pyvb.constants import * from pyvb.vm import * from pyvb.vb import * import xpcom import pyvb import os import socket import threading class ClientThread ( threading.Thread ): # Override Thread's init method to accept the parameters needed: def init ( self, channel, details ): self.channel = channel self.details = details threading.Thread.__init__ ( self ) def run ( self ): print 'Received connection:', self.details [ 0 ] while 1: s= self.channel.recv ( 1024 ) if(s!='end'): if(s=='start'): v=VB() pyvb.vb.VB.startVM(v,pyvb.vm.vbVM) else: self.channel.close() break print 'Closed connection:', self.details [ 0 ] server = socket.socket ( socket.AF_INET, socket.SOCK_STREAM ) server.bind ( ( '127.0.0.1', 2897 ) ) server.listen ( 5 ) while True: channel, details = server.accept() ClientThread ( channel, details ).start() it shows an error Exception in thread Thread-1: Traceback (most recent call last): File "/usr/lib/python2.5/threading.py", line 486, in __bootstrap_inner self.run() File "news.py", line 27, in run pyvb.vb.VB.startVM(v,pyvb.vm.vbVM.getUUID(m)) File "/usr/lib/python2.5/site-packages/pyvb-0.0.2-py2.5.egg/pyvb/vb.py", line 65, in startVM cmd='%s %s'%(VB_COMMAND_STARTVM, vm.getUUID()) AttributeError: 'str' object has no attribute 'getUUID'

    Read the article

  • What does this code from AuthKit do? (where are these functions and methods defined?)

    - by Beau Simensen
    I am trying to implement my own authentication method for AuthKit and am trying to figure out how some of the built-in methods work. In particular, I'm trying to figure out how to update the REMOTE_USER for environ correctly. This is how it is handled inside of authkit.authenticate.basic but it is pretty confusing. I cannot find anyplace where REMOTE_USER and AUTH_TYPE are defined. Is there something strange going on here and if so, what is it? def __call__(self, environ, start_response): environ['authkit.users'] = self.users result = self.authenticate(environ) if isinstance(result, str): AUTH_TYPE.update(environ, 'basic') REMOTE_USER.update(environ, result) return self.application(environ, start_response) There are actually a number of all uppercase things like this that I cannot find a definition for. For example, where does AUTHORIZATION come from below: def authenticate(self, environ): authorization = AUTHORIZATION(environ) if not authorization: return self.build_authentication() (authmeth, auth) = authorization.split(' ',1) if 'basic' != authmeth.lower(): return self.build_authentication() auth = auth.strip().decode('base64') username, password = auth.split(':',1) if self.authfunc(environ, username, password): return username return self.build_authentication() I feel like maybe I am missing some special syntax handling for the environ dict, but it is possible that there is something else really weird going on here that isn't immediately obvious to someone as new to Python as myself.

    Read the article

  • How do you invoke a python script inside a jar file using python ?

    - by Trevor
    I'm working on an application that intersperses a bunch of jython and java code. Due to the nature of the program (using wsadmin) we are really restricted to Python 2.1 We currently have a jar containing both java source and .py modules. The code is currently invoked using java, but I'd like to remove this in favor of migrating as much functionality as possible to jython. The problem I have is that I want to either import or execute python modules inside the existing jar file from a calling jython script. I've tried a couple of different ways without success. My directory structure looks like: application.jar |-- com |--example |-- action |-- MyAction.class |-- pre_myAction.py The 1st approach I tried was to do imports from the jar. I added the jar to my sys.path and tried to import the module using both import com.example.action.myAction and import myAction. No success however, even when I put init.py files into the directory at each level. The 2nd approach I tried was to load the resource using the java class. So I wrote the below code: import sys import os import com.example.action.MyAction as MyAction scriptName = str(MyAction.getResource('/com/example/action/myAction.py')) scriptStr = MyAction.getResourceAsStream('/com/example/action/myAction.py') try: print execfile(scriptStr) except: print "failed 1" try: print execfile(scriptName) except: print "failed 2" Both of these failed. I'm at a bit of a loss now as to how I should proceed. Any ideas ? cheers, Trevor

    Read the article

  • How do I compose an existing Moose role into a class at runtime?

    - by Oesor
    Say I define an abstract My::Object and concrete role implementations My::Object::TypeA and My::Object::TypeB. For maintainability reasons, I'd like to not have a hardcoded table that looks at the object type and applies roles. As a DWIMmy example, I'm looking for something along these lines in My::Object: has => 'id' (isa => 'Str', required => 1); sub BUILD { my $self = shift; my $type = $self->lookup_type(); ## Returns 'TypeB' {"My::Object::$type"}->meta->apply($self); } Letting me get a My::Object with My::Object::TypeB role applied by doing the following: my $obj = My::Object(id = 'foo') Is this going to do what I want or am I on the entirely wrong track? Edit: I simplified this too much; I don't want to have to know the type when I instantiate the object, I want the object to determine its type and apply the correct role's methods appropriately. I've edited my question to make this clearer.

    Read the article

  • Beginner problems with references to arrays in python 3.1.1

    - by Protean
    As part of the last assignment in a beginner python programing class, I have been assigned a traveling sales man problem. I settled on a recursive function to find each permutation and the sum of the distances between the destinations, however, I am have a lot of problems with references. Arrays in different instances of the Permute and Main functions of TSP seem to be pointing to the same reference. from math import sqrt class TSP: def __init__(self): self.CartisianCoordinates = [['A',[1,1]], ['B',[2,2]], ['C',[2,1]], ['D',[1,2]], ['E',[3,3]]] self.Array = [] self.Max = 0 self.StoredList = ['',0] def Distance(self, i1, i2): x1 = self.CartisianCoordinates[i1][1][0] y1 = self.CartisianCoordinates[i1][1][1] x2 = self.CartisianCoordinates[i2][1][0] y2 = self.CartisianCoordinates[i2][1][1] return sqrt(pow((x2 - x1), 2) + pow((y2 - y1), 2)) def Evaluate(self): temparray = [] Data = [] for i in range(len(self.CartisianCoordinates)): Data.append([]) for i1 in range(len(self.CartisianCoordinates)): for i2 in range(len(self.CartisianCoordinates)): if i1 != i2: temparray.append(self.Distance(i1, i2)) else: temparray.append('X') Data[i1] = temparray temparray = [] self.Array = Data self.Max = len(Data) def Permute(self,varray,index,vcarry,mcarry): #Problem Class array = varray[:] carry = vcarry[:] for i in range(self.Max): print ('ARRAY:', array) print (index,i,carry,array[index][i]) if array[index][i] != 'X': carry[0] += self.CartisianCoordinates[i][0] carry[1] += array[index][i] if len(carry) != self.Max: temparray = array[:] for j in range(self.Max):temparray[j][i] = 'X' index = i mcarry += self.Permute(temparray,index,carry,mcarry) else: return mcarry print ('pass',mcarry) return mcarry def Main(self): out = [] self.Evaluate() for i in range(self.Max): array = self.Array[:] #array appears to maintain the same reference after each copy, resulting in an incorrect array being passed to Permute after the first iteration. print (self.Array[:]) for j in range(self.Max):array[j][i] = 'X' print('I:', i, array) out.append(self.Permute(array,i,[str(self.CartisianCoordinates[i][0]),0],[])) return out SalesPerson = TSP() print(SalesPerson.Main()) It would be greatly appreciated if you could provide me with help in solving the reference problems I am having. Thank you.

    Read the article

  • How to handle custom Java exception in Flex app.

    - by mico
    Hello, we are using BlazeDS as a proxy between Flex and Java. The approach is the same as in (http://www.flexpasta.com/index.php/2008/05/16/exception-handling-with-blazeds-and-flex/) Java exception declaration: public class FlexException extends RuntimeException { private String name = 'John'; public FlexException(String message) { super(message); } public String getName() { return name; } } Then, we are throwing it: public void testMethod(String str) throws Exception { throw new FlexException("Custom exception"); } Flex part: private function faultHandler(event:FaultEvent):void { var errorMessage:ErrorMessage = event.message as ErrorMessage; trace("error++"); } and remote object is instantiated here: <mx:RemoteObject id="mySample" destination="mySample" channelSet="{cs1}" fault="faultHandler(event)" /> But in event.fault I get "Server.Processing" and event.faultString equals "There was an unhandled failure on the server. Custom exception" How can I receive the data is specified in exception props ? BlazeDS log is similar to the log that was mentioned in the comment [BlazeDS] 11:28:13.906 [DEBUG] Serializing AMF/HTTP response Version: 3 (Message #0 targetURI=/2/onStatus, responseUR|-) (Typed Object #0 ‘flex.messaging.messages.ErrorMessage’) headers = (Object #1) rootCause = null body = null correlationId = “2F1126D7-5658-BE40-E27C-7B43F3C5DCDD” faultDetail = null faultString = “Login required before authorization can proceed.” clientId = “C4F0E77C-3208-ECDD-1497-B8D070884830? timeToLive = 0.0 destination = “books” timestamp = 1.204658893906E12 extendedData = null faultCode = “Client.Authentication” messageId = “C4F0E77C-321E-6FCE-E17D-D9F1C16600A8? So the quesion is why rootClause is null? How can I get that Exception object not just a string 'Custom exception'?

    Read the article

  • C# Client to Consume Google App Engine RESTful Webservice (rpc XML)

    - by Ngu Soon Hui
    I think I hit a problem when using C# client to consume Google App Engine Webservice. The Google App Engine code I use is here. This is how the python script on server would look like: from google.appengine.ext import webapp from google.appengine.ext.webapp.util import run_wsgi_app import logging from StringIO import StringIO import traceback import xmlrpclib from xmlrpcserver import XmlRpcServer class Application: def __init__(self): pass def getName(self,meta): return 'example' class XMLRpcHandler(webapp.RequestHandler): rpcserver = None def __init__(self): self.rpcserver = XmlRpcServer() app = Application() self.rpcserver.register_class('app',app) def post(self): request = StringIO(self.request.body) request.seek(0) response = StringIO() try: self.rpcserver.execute(request, response, None) except Exception, e: logging.error('Error executing: '+str(e)) for line in traceback.format_exc().split('\n'): logging.error(line) finally: response.seek(0) rstr = response.read() self.response.headers['Content-type'] = 'text/xml' self.response.headers['Content-length'] = "%d"%len(rstr) self.response.out.write(rstr) application = webapp.WSGIApplication( [('/xmlrpc/', XMLRpcHandler)], debug=True) def main(): run_wsgi_app(application) if __name__ == "__main__": main() The client side ( in Python) is this: import xmlrpclib s = xmlrpclib.Server('http://localhost:8080/xmlrpc/') print s.app.getName() I have no problem in using Python client to retrieve values from Google App Engine, but I do have difficulties in using a C# client to retrieve the values. The error I got was 404 method not found when I am trying to GetResponse from the web request. This is my code var request = (HttpWebRequest)WebRequest.Create("http://localhost:8080/xmlrpc/app"); request.Method = "GET"; request.ContentLength = 0; request.ContentType = "text/xml"; using (HttpWebResponse response = request.GetResponse() as HttpWebResponse) //404 method not found error here. { } I think it must be that the url is wrong, but I don't know how to get it right. Any idea?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Read line and change the line that not consist of certain words and not end with dot

    - by igo
    I wanna read some text files in a folder line by line. for example of 1 txt : Fast and Effective Text Mining Using Linear-time Document Clustering Bjornar Larsen WORD2 Chinatsu Aone SRA International AK, Inc. 4300 Fair Lakes Cow-l Fairfax, VA 22033 {bjornar-larsen, WORD1 I wanna remove line that does not contain of words = word, word2, word3, and does not end with dot . so. from the example, the result will be : Bjornar Larsen WORD2 Chinatsu Aone SRA International, Inc. {bjornar-larsen, WORD1 I am confused, hw to remove the line? it that possible? or can we replace them with a space? here's the code : $url = glob($savePath.'*.txt'); foreach ($url as $file => $files) { $handle = fopen($files, "r") or die ('can not open file'); $ori_content= file_get_contents($files); foreach(preg_split("/((\r?\n)|(\r\n?))/", $ori_content) as $buffer){ $pos1 = stripos($buffer, $word1); $pos2 = stripos($buffer, $word2); $pos3 = stripos($buffer, $word3); $last = $str[strlen($buffer)-1];//read the las character if (true !== $pos1 OR true !== $pos2 OR true !==$pos3 && $last != '.'){ //how to remove } } } please help me, thank you so much :)

    Read the article

  • Reordering arguments using recursion (pro, cons, alternatives)

    - by polygenelubricants
    I find that I often make a recursive call just to reorder arguments. For example, here's my solution for endOther from codingbat.com: Given two strings, return true if either of the strings appears at the very end of the other string, ignoring upper/lower case differences (in other words, the computation should not be "case sensitive"). Note: str.toLowerCase() returns the lowercase version of a string. public boolean endOther(String a, String b) { return a.length() < b.length() ? endOther(b, a) : a.toLowerCase().endsWith(b.toLowerCase()); } I'm very comfortable with recursions, but I can certainly understand why some perhaps would object to it. There are two obvious alternatives to this recursion technique: Swap a and b traditionally public boolean endOther(String a, String b) { if (a.length() < b.length()) { String t = a; a = b; b = t; } return a.toLowerCase().endsWith(b.toLowerCase()); } Not convenient in a language like Java that doesn't pass by reference Lots of code just to do a simple operation An extra if statement breaks the "flow" Repeat code public boolean endOther(String a, String b) { return (a.length() < b.length()) ? b.toLowerCase().endsWith(a.toLowerCase()) : a.toLowerCase().endsWith(b.toLowerCase()); } Explicit symmetry may be a nice thing (or not?) Bad idea unless the repeated code is very simple ...though in this case you can get rid of the ternary and just || the two expressions So my questions are: Is there a name for these 3 techniques? (Are there more?) Is there a name for what they achieve? (e.g. "parameter normalization", perhaps?) Are there official recommendations on which technique to use (when)? What are other pros/cons that I may have missed?

    Read the article

  • How to use SQLAlchemy to dump an SQL file from query expressions to bulk-insert into a DBMS?

    - by Mahmoud Abdelkader
    Please bear with me as I explain the problem, how I tried to solve it, and my question on how to improve it is at the end. I have a 100,000 line csv file from an offline batch job and I needed to insert it into the database as its proper models. Ordinarily, if this is a fairly straight-forward load, this can be trivially loaded by just munging the CSV file to fit a schema, but I had to do some external processing that requires querying and it's just much more convenient to use SQLAlchemy to generate the data I want. The data I want here is 3 models that represent 3 pre-exiting tables in the database and each subsequent model depends on the previous model. For example: Model C --> Foreign Key --> Model B --> Foreign Key --> Model A So, the models must be inserted in the order A, B, and C. I came up with a producer/consumer approach: - instantiate a multiprocessing.Process which contains a threadpool of 50 persister threads that have a threadlocal connection to a database - read a line from the file using the csv DictReader - enqueue the dictionary to the process, where each thread creates the appropriate models by querying the right values and each thread persists the models in the appropriate order This was faster than a non-threaded read/persist but it is way slower than bulk-loading a file into the database. The job finished persisting after about 45 minutes. For fun, I decided to write it in SQL statements, it took 5 minutes. Writing the SQL statements took me a couple of hours, though. So my question is, could I have used a faster method to insert rows using SQLAlchemy? As I understand it, SQLAlchemy is not designed for bulk insert operations, so this is less than ideal. This follows to my question, is there a way to generate the SQL statements using SQLAlchemy, throw them in a file, and then just use a bulk-load into the database? I know about str(model_object) but it does not show the interpolated values. I would appreciate any guidance for how to do this faster. Thanks!

    Read the article

  • HttpError 502 with Google Wave Active Robot API fetch_wavelet()

    - by Drew LeSueur
    I am trying to use the Google Wave Active Robot API fetch_wavelet() and I get an HTTP 502 error example: from waveapi import robot import passwords robot = robot.Robot('gae-run', 'http://images.com/fake-image.jpg') robot.setup_oauth(passwords.CONSUMER_KEY, passwords.CONSUMER_SECRET, server_rpc_base='http://www-opensocial.googleusercontent.com/api/rpc') wavelet = robot.fetch_wavelet('googlewave.com!w+dtuZi6t3C','googlewave.com!conv+root') robot.submit(wavelet) self.response.out.write(wavelet.creator) But the error I get is this: Traceback (most recent call last): File "/base/python_runtime/python_lib/versions/1/google/appengine/ext/webapp/__init__.py", line 511, in __call__ handler.get(*groups) File "/base/data/home/apps/clstff/gae-run.342467577023864664/main.py", line 23, in get robot.submit(wavelet) File "/base/data/home/apps/clstff/gae-run.342467577023864664/waveapi/robot.py", line 486, in submit res = self.make_rpc(pending) File "/base/data/home/apps/clstff/gae-run.342467577023864664/waveapi/robot.py", line 251, in make_rpc raise IOError('HttpError ' + str(code)) IOError: HttpError 502 Any ideas? Edit: When [email protected] is not a member of the wave I get the correct error message Error: RPC Error500: internalError: [email protected] is not a participant of wave id: [WaveId:googlewave.com!w+Pq1HgvssD] wavelet id: [WaveletId:googlewave.com!conv+root]. Unable to apply operation: {'method':'robot.fetchWave','id':'655720','waveId':'googlewave.com!w+Pq1HgvssD','waveletId':'googlewave.com!conv+root','blipId':'null','parameters':{}} But when [email protected] is a member of the wave I get the http 502 error. IOError: HttpError 502

    Read the article

  • Am I correctly extracting JPEG binary data from this mysqldump?

    - by Glenn
    I have a very old .sql backup of a vbulletin site that I ran around 8 years ago. I am trying to see the file attachments that are stored in the DB. The script below extracts them all and is verified to be JPEG by hex dumping and checking the SOI (start of image) and EOI (end of image) bytes (FFD8 and FFD9, respectively) according to the JPEG wiki page. But when I try to open them with evince, I get this message "Error interpreting JPEG image file (JPEG datastream contains no image)" What could be going on here? Some background info: sqldump is around 8 years old vbulletin 2.x was the software that stored the info most likely php 4 was used most likely mysql 4.0, possibly even 3.x the column datatype these attachments are stored in is mediumtext My Python 3.1 script: #!/usr/bin/env python3.1 import re trim_l = re.compile(b"""^INSERT INTO attachment VALUES\('\d+', '\d+', '\d+', '(.+)""") trim_r = re.compile(b"""(.+)', '\d+', '\d+'\);$""") extractor = re.compile(b"""^(.*(?:\.jpe?g|\.gif|\.bmp))', '(.+)$""") with open('attachments.sql', 'rb') as fh: for line in fh: data = trim_l.findall(line)[0] data = trim_r.findall(data)[0] data = extractor.findall(data) if data: name, data = data[0] try: filename = 'files/%s' % str(name, 'UTF-8') ah = open(filename, 'wb') ah.write(data) except UnicodeDecodeError: continue finally: ah.close() fh.close() update The JPEG wiki page says FF bytes are section markers, with the next byte indicating the section type. I see some that are not listed in the wiki page (specifically, I see a lot of 5C bytes, so FF5C). But the list is of "common markers" so I'm trying to find a more complete list. Any guidance here would also be appreciated.

    Read the article

  • Python: Networked IDLE/Redo IDLE front-end while using the same back-end?

    - by Rosarch
    Is there any existing web app that lets multiple users work with an interactive IDLE type session at once? Something like: IDLE 2.6.4 Morgan: >>> letters = list("abcdefg") Morgan: >>> # now, how would you iterate over letters? Jack: >>> for char in letters: print "char %s" % char char a char b char c char d char e char f char g Morgan: >>> # nice nice If not, I would like to create one. Is there some module I can use that simulates an interactive session? I'd want an interface like this: def class InteractiveSession(): ''' An interactive Python session ''' def putLine(line): ''' Evaluates line ''' pass def outputLines(): ''' A list of all lines that have been output by the session ''' pass def currentVars(): ''' A dictionary of currently defined variables and their values ''' pass (Although that last function would be more of an extra feature.) To formulate my problem another way: I'd like to create a new front end for IDLE. How can I do this? UPDATE: Or maybe I can simulate IDLE through eval()? UPDATE 2: What if I did something like this: I already have a simple GAE Python chat app set up, that allows users to sign in, make chat rooms, and chat with each other. Instead of just saving incoming messages to the datastore, I could do something like this: def putLine(line, user, chat_room): ''' Evaluates line for the session used by chat_room ''' # get the interactive session for this chat room curr_vars = InteractiveSession.objects.where("chatRoom = %s" % chat_room).get() result = eval(prepared_line, curr_vars.state, {}) curr_vars.state = curr_globals curr_vars.lines.append((user, line)) if result: curr_vars.lines.append(('SELF', result.__str__())) curr_vars.put() The InteractiveSession model: def class InteractiveSession(db.Model): # a dictionary mapping variables to values # it looks like GAE doesn't actually have a dictionary field, so what would be best to use here? state = db.DictionaryProperty() # a transcript of the session # # a list of tuples of the form (user, line_entered) # # looks something like: # # [('Morgan', '# hello'), # ('Jack', 'x = []'), # ('Morgan', 'x.append(1)'), # ('Jack', 'x'), # ('SELF', '[1]')] lines = db.ListProperty() Could this work, or am I way off/this approach is infeasible/I'm duplicating work when I should use something already built?

    Read the article

  • dynamically created radiobuttonlist

    - by Janet
    Have a master page. The content page has a list with hyperlinks containing request variables. You click on one of the links to go to the page containing the radiobuttonlist (maybe). First problem: When I get to the new page, I use one of the variables to determine whether to add a radiobuttonlist to a placeholder on the page. I tried to do it in page)_load but then couldn't get the values selected. When I played around doing it in preInit, the first time the page is there, I can't get to the page's controls. (Object reference not set to an instance of an object.) I think it has something to do with the MasterPage and page content? The controls aren't instantiated until later? (using vb by the way) Second problem: Say I get that to work, once I hit a button, can I still access the passed request variable to determine the selected item in the radiobuttonlist? Protected Sub Page_PreInit(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.PreInit 'get sessions for concurrent Dim Master As New MasterPage Master = Me.Master Dim myContent As ContentPlaceHolder = CType(Page.Master.FindControl("ContentPlaceHolder1"), ContentPlaceHolder) If Request("str") = "1" Then Dim myList As dsSql = New dsSql() ''''instantiate the function to get dataset Dim ds As New Data.DataSet ds = myList.dsConSessionTimes(Request("eid")) If ds.Tables("conSessionTimes").Rows.Count > 0 Then Dim conY As Integer = 1 CType(myContent.FindControl("lblSidCount"), Label).Text = ds.Tables("conSessionTimes").Rows.Count.ToString Sorry to be so needy - but maybe someone could direct me to a page with examples? Maybe seeing it would help it make sense? Thanks....JB

    Read the article

  • Using perl to split a line that may contain whitespace

    - by Tommy Fisk
    Okay, so I'm using perl to read in a file that contains some general configuration data. This data is organized into headers based on what they mean. An example follows: [vars] # This is how we define a variable! $var = 10; $str = "Hello thar!"; # This section contains flags which can be used to modify module behavior # All modules read this file and if they understand any of the flags, use them [flags] Verbose = true; # Notice the errant whitespace! [path] WinPath = default; # Keyword which loads the standard PATH as defined by the operating system. Append with additonal values. LinuxPath = default; Goal: Using the first line as an example "$var = 10;", I'd like to use the split function in perl to create an array that contains the characters "$var" and "10" as elements. Using another line as an example: Verbose = true; # Should become [Verbose, true] aka no whitespace is present This is needed because I will be outputting these values to a new file (which a different piece of C++ code will read) to instantiate dictionary objects. Just to give you a little taste of what it might look like (just making it up as I go along): define new dictionary name: [flags] # Start defining keys => values new key name: Verbose new value val: 10 # End dictionary Oh, and here is the code I currently have along with what it is doing (incorrectly): sub makeref($) { my @line = (split (/=/)); # Produces ["Verbose", " true"]; }

    Read the article

  • Trying to build the basic python extension example fails (windows)

    - by Alexandros
    Hello, I have Python 2.6 and Visual Studio 2008 running on a Win7 x64 machine. When I try to build the basic python extension example in c "example_nt" as found in the python 2.6 sources distribution, it fails: python setup.py build And this results in: running build running build_ext building 'aspell' extension Traceback (most recent call last): File "setup.py", line 7, in <module> ext_modules = [module1]) File "C:\Python26\lib\distutils\core.py", line 152, in setup dist.run_commands() File "C:\Python26\lib\distutils\dist.py", line 975, in run_commands self.run_command(cmd) File "C:\Python26\lib\distutils\dist.py", line 995, in run_command cmd_obj.run() File "C:\Python26\lib\distutils\command\build.py", line 134, in run self.run_command(cmd_name) File "C:\Python26\lib\distutils\cmd.py", line 333, in run_command self.distribution.run_command(command) File "C:\Python26\lib\distutils\dist.py", line 995, in run_command cmd_obj.run() File "C:\Python26\lib\distutils\command\build_ext.py", line 343, in run self.build_extensions() File "C:\Python26\lib\distutils\command\build_ext.py", line 469, in build_extensions self.build_extension(ext) File "C:\Python26\lib\distutils\command\build_ext.py", line 534, in build_extension depends=ext.depends) File "C:\Python26\lib\distutils\msvc9compiler.py", line 448, in compile self.initialize() File "C:\Python26\lib\distutils\msvc9compiler.py", line 358, in initialize vc_env = query_vcvarsall(VERSION, plat_spec) File "C:\Python26\lib\distutils\msvc9compiler.py", line 274, in query_vcvarsall raise ValueError(str(list(result.keys()))) ValueError: [u'path'] What can I do to fix this? Any help will be appreciated

    Read the article

< Previous Page | 71 72 73 74 75 76 77 78 79 80 81 82  | Next Page >