Search Results

Search found 19975 results on 799 pages for 'disk queue length'.

Page 753/799 | < Previous Page | 749 750 751 752 753 754 755 756 757 758 759 760  | Next Page >

  • Reason why UIImageView gives me a 'distorted' image sometimes

    - by Cedric Vandendriessche
    I have a custom UIView with a UILabel and a UIImageView subview. (tried using UIImageView subclass aswell). I assign an image to it and add the view to the screen. I wrote a function which adds the amount of LetterBoxes to the screen as there are letters in the word: - (void)drawBoxesForWord:(NSString *)word { if(boxesContainer == nil) { /* Create a container for the LetterBoxes (animation purposes) */ boxesContainer = [[UIView alloc] initWithFrame:CGRectMake(0, 205, 320, 50)]; [self.view addSubview:boxesContainer]; } /* Calculate width of letterboxes */ NSInteger numberOfCharacters = [word length]; CGFloat totalWidth = numberOfCharacters * 28 + (numberOfCharacters - 1) * 3; CGFloat leftCap = (320 - totalWidth) / 2; [letters removeAllObjects]; /* Draw the boxes to the screen */ for (int i = 0; i < numberOfCharacters; i++) { LetterBox *letter = [[LetterBox alloc] initWithFrame:CGRectMake(leftCap + i * 31 , 0, 28, 40)]; [letters addObject:letter]; [boxesContainer addSubview:letter]; [letter release]; }} This gives me the image below: http://www.imgdumper.nl/uploads2/4ba3b2c72bb99/4ba3b2c72abfd-Goed.png But sometimes it gives me this: imgdumper.nl/uploads2/4ba3b2d888226/4ba3b2d88728a-Fout.png I add them to the same boxesContainer but they first remove themselves from the superview, so it's not like you see them double or something. What I find weird is that they are all good or all bad.. This is the init function for my LetterBox: if (self == [super initWithFrame:aRect]) { /* Create the box image with same frame */ boxImage = [[UIImageView alloc] initWithFrame:CGRectMake(0, 0, self.bounds.size.width, self.bounds.size.height)]; boxImage.contentMode = UIViewContentModeScaleAspectFit; boxImage.image = [UIImage imageNamed:@"SpaceOpen.png"]; [self addSubview:boxImage]; /* Create the label with same frame */ letterLabel = [[UILabel alloc] initWithFrame:CGRectMake(0, 0, self.bounds.size.width, self.bounds.size.height)]; letterLabel.backgroundColor = [UIColor clearColor]; letterLabel.font = [UIFont fontWithName:@"ArialRoundedMTBold" size:26]; letterLabel.textColor = [UIColor blackColor]; letterLabel.textAlignment = UITextAlignmentCenter; [self addSubview:letterLabel]; } return self;} Does anyone have an idea why this could be? I'd rather have them display correctly every time :)

    Read the article

  • Fast response on first Socket I/O request but slow every other time when communicating with remote serial port

    - by GreenGodot
    I'm using sockets to pass Serial commands to a remote device. And the response to that request is sent back and printed out. However, I am having a problem in that the first time it is instant but the rest of the time it can take up to 20 seconds to receive a reply. I think the problem is with my attempt at threading but I am not entirely sure. new Thread() { @Override public void run() { System.out.println("opened"); try { isSocketRetrieving.setText("Opening Socket"); socket = new Socket(getAddress(), getRemotePort())); DataOutput = new DataOutputStream(socket .getOutputStream()); inFromServer = new BufferedReader( new InputStreamReader(socket .getInputStream())); String line = ""; isSocketRetrieving.setText("Reading Stream......"); while ((line = inFromServer.readLine()) != null) { System.out.println(line); if (line.contains(getHandshakeRequest())) { DataOutput.write((getHandshakeResponse()toString() + "\r").getBytes()); DataOutput.flush(); DataOutput .write((getCommand().toString() + "\r").getBytes()); DataOutput.flush(); int pause = (line.length()*8*1000)/getBaud(); sleep(pause); } else if (line.contains(readingObject .getExpected())) { System.out.println(line); textArea.append("value = " + line + "\n"); textAreaScroll.revalidate(); System.out.println("Got Value"); break; } } System.out.println("Ended"); try { inFromServer.close(); DataOutput.close(); socket.close(); isSocketRetrieving.setText("Socket is inactive..."); rs232Table.addMouseListener(listener); interrupt(); join(); } catch (IOException e) { e.printStackTrace(); } catch (InterruptedException e) { System.out.println("Thread exited"); } } catch (NumberFormatException e1) { e1.printStackTrace(); } catch (UnknownHostException e1) { e1.printStackTrace(); } catch (IOException e1) { e1.printStackTrace(); } catch (InterruptedException e) { // TODO Auto-generated catch block e.printStackTrace(); } } }.start();

    Read the article

  • xml append issue in ie,chrome

    - by 3gwebtrain
    Hi, I am creating a html page, using xml data. in which i am using the following function. It works fine with firefox,opera,safari. but in case of ie7,ie8, and chrome the data what i am getting from xml, is not appending properly. any one help me to solve this issue? in case any special thing need to concentrate on append funcation as well let me know.. $(function(){ var thisPage; var parentPage; $('ul.left-navi li a').each(function(){ $('ul.left-navi li a').removeClass('current'); var pathname = (window.location.pathname.match(/[^\/]+$/)[0]); var currentPage = $(this).attr('href'); var pathArr = new Array(); pathArr = pathname.split("."); var file = pathArr[pathArr.length - 2]; thisPage = file; if(currentPage==pathname){ $(this).addClass("active"); } }) $.get('career-utility.xml',function(myData){ var myXml = $(myData).find(thisPage); parentPage = thisPage; var overviewTitle = myXml.find('overview').attr('title'); var description = myXml.find('discription').text(); var mainsublinkTitle = myXml.find('mainsublink').attr('title'); var thisTitle = myXml.find("intro").attr('title'); var thisIntro = myXml.find("introinfo").text(); $('<h3>'+overviewTitle+'</h3>').appendTo('.overViewInfo'); $('<p>'+description+'</p>').appendTo('.overViewInfo'); var sublinks = myXml.find('mainsublink').children('sublink'); $('#intro h3').append(thisTitle); $('#intro').append(thisIntro); sublinks.each(function(numsub){ var newSubLink = $(this); var sublinkPage = $(this).attr('pageto'); var linkInfo = $(this).text(); $('ul.career-link').append('<li><a href="'+sublinkPage+'">'+linkInfo+'</a></li>'); }) $(myXml).find('listgroup').each(function(index){ var count = index; var listGroup = $(this); var listGroupTitle = $(this).attr('title'); var shortNote = $(this).attr('shortnote'); var subLink = $(this).find('sublist'); var firstList = $(this).find('list'); $('.grouplist').append('<div class="list-group"><h3>'+listGroupTitle+'</h3><ul class="level-one level' + count + '"></ul></div>'); firstList.each(function(listnum) { $(this).wrapInner('<li>') .find('sublistgroup').wrapInner('<ul>').children().unwrap() .find('sublist').wrapInner('<li>').children().unwrap(); $('ul.level'+count).append($(this).children()); }); }); }); }) Thanks for advance..

    Read the article

  • What are the pros and cons of using manual list iteration vs recursion through fail

    - by magus
    I come up against this all the time, and I'm never sure which way to attack it. Below are two methods for processing some season facts. What I'm trying to work out is whether to use method 1 or 2, and what are the pros and cons of each, especially large amounts of facts. methodone seems wasteful since the facts are available, why bother building a list of them (especially a large list). This must have memory implications too if the list is large enough ? And it doesn't take advantage of Prolog's natural backtracking feature. methodtwo takes advantage of backtracking to do the recursion for me, and I would guess would be much more memory efficient, but is it good programming practice generally to do this? It's arguably uglier to follow, and might there be any other side effects? One problem I can see is that each time fail is called, we lose the ability to pass anything back to the calling predicate, eg. if it was methodtwo(SeasonResults), since we continually fail the predicate on purpose. So methodtwo would need to assert facts to store state. Presumably(?) method 2 would be faster as it has no (large) list processing to do? I could imagine that if I had a list, then methodone would be the way to go.. or is that always true? Might it make sense in any conditions to assert the list to facts using methodone then process them using method two? Complete madness? But then again, I read that asserting facts is a very 'expensive' business, so list handling might be the way to go, even for large lists? Any thoughts? Or is it sometimes better to use one and not the other, depending on (what) situation? eg. for memory optimisation, use method 2, including asserting facts and, for speed use method 1? season(spring). season(summer). season(autumn). season(winter). % Season handling showseason(Season) :- atom_length(Season, LenSeason), write('Season Length is '), write(LenSeason), nl. % ------------------------------------------------------------- % Method 1 - Findall facts/iterate through the list and process each %-------------------------------------------------------------- % Iterate manually through a season list lenseason([]). lenseason([Season|MoreSeasons]) :- showseason(Season), lenseason(MoreSeasons). % Findall to build a list then iterate until all done methodone :- findall(Season, season(Season), AllSeasons), lenseason(AllSeasons), write('Done'). % ------------------------------------------------------------- % Method 2 - Use fail to force recursion %-------------------------------------------------------------- methodtwo :- % Get one season and show it season(Season), showseason(Season), % Force prolog to backtrack to find another season fail. % No more seasons, we have finished methodtwo :- write('Done').

    Read the article

  • Using jQuery or javascript to render json into multi-column table

    - by Scott Yu - UX designer
    I am trying to render a JSON into a HTML table. But the difficulty is making it so it loops through JSON and renders multiple columns if necessary. For the example below, what I want is this: Result wanted Result Wanted <table> <tr><th>AppName</th><td>App 1</td><td>App 2</td></tr> <tr><th>Last Modified</th><td>10/1/2012</td><td></td></tr> <tr><th>App Logo</th><td>10/1/2012</td><td></td></tr> blahblah </table> <table> <tr><th>AppName</th><td>App 1</td></tr> blahblah </table> JSON Example "Records": [ { "AppName": "App 1", "LastModified": "10/1/2012, 9:30AM", "ShipTo_Name": "Dan North", "ShipTo_Address": "Dan North", "ShipTo_Terms": "Dan North", "ShipTo_DueDate": "Dan North", "Items 1": [ { "Item_Name": "Repairs", "Item_Description": "Repair Work" } ] }, { "AppName": "App 2", "AppLogo": "http://www.google.com/logo.png", "LastModified": "10/1/2012, 9:30AM", "BillTo_Name": "Steve North", "Items 1": [ { "Item_Name": "Repairs", "Item_Description": "Repair Work" } ] } ], "Records": [ { "AppName": "App 1", "LastModified": "10/1/2012, 9:30AM", "ShipTo_Name": "222", "ShipTo_Address": "333 ", "ShipTo_Terms": "444", "ShipTo_DueDate": "5555", "Items 1": [ { "Item_Name": "Repairs", "Item_Description": "Repair Work" } ] } ], Code I am using now function CreateComparisonTable (arr,level,k) { var dumped_text = ""; if(!level) level = 0; //The padding given at the beginning of the line. var level_padding = ""; for(var j=0;j<level+1;j++) level_padding = "--"; if(typeof(arr) == 'object') { //Array/Hashes/Objects for (var item in arr) { var value = arr[item]; if (typeof(value) == 'object') { //If it is an array, if(item !=0) { dumped_text += '<tr><td>' + item + '<br>'; dumped_text += CreateComparisonTable(value,level+1); dumped_text += '</td></tr>'; } else { dumped_text += CreateComparisonTable(value,level, value.length); } } else { dumped_text += '<tr><td>' + level_padding + item + '</td><td>' + value + '</td></tr>'; } } } return dumped_text; } Jsfiddle here

    Read the article

  • Debugging a basic OpenGL texture fail? (iphone)

    - by Ben
    Hey all, I have a very basic texture map problem in GL on iPhone, and I'm wondering what strategies there are for debugging this kind of thing. (Frankly, just staring at state machine calls and wondering if any of them is wrong or misordered is no way to live-- are there tools for this?) I have a 512x512 PNG file that I'm loading up from disk (not specially packed), creating a CGBitmapContext, then calling CGContextDrawImage to get bytes out of it. (This code is essentially stolen from an Apple sample.) I'm trying to map the texture to a "quad", with code that looks essentially like this-- all flat 2D stuff, nothing fancy: glEnable(GL_TEXTURE_2D); glTexEnvf(GL_TEXTURE_ENV, GL_TEXTURE_ENV_MODE, GL_MODULATE); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_WRAP_S, GL_REPEAT); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_WRAP_T, GL_REPEAT); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MAG_FILTER, GL_LINEAR); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MIN_FILTER, GL_LINEAR); glEnableClientState(GL_TEXTURE_COORD_ARRAY); GLfloat vertices[8] = { viewRect.origin.x, viewRect.size.height, viewRect.origin.x, viewRect.origin.y, viewRect.size.width, viewRect.origin.y, viewRect.size.width, viewRect.size.height }; GLfloat texCoords[8] = { 0, 1.0, 0, 0, 1.0, 0, 1.0, 1.0 }; glBindTexture(GL_TEXTURE_2D, myTextureRef); // This was previously bound to glVertexPointer(2, GL_FLOAT , 0, vertices); glTexCoordPointer(2, GL_FLOAT, 0, texCoords); glDrawArrays(GL_TRIANGLE_FAN, 0, 4); glDisableClientState(GL_TEXTURE_COORD_ARRAY); glDisable(GL_TEXTURE_2D); My supposedly textured area comes out just black. I see no debug output from the CG calls to set up the texture. glGetError reports nothing. If I simplify this code block to just draw the verts, but set up a pure color, the quad area lights up exactly as expected. If I clear the whole context immediately beforehand to red, I don't see the red-- which means something is being rendered there, but not the contents of my PNG. What could I be doing wrong? And more importantly, what are the right tools and techniques for debugging this sort of thing, because running into this kind of problem and not being able to "step through it" in a debugger in any meaningful way is a bummer. Thanks!

    Read the article

  • Flash caroussel xml parse html link

    - by Marvin
    Hello I am trying to modify a carousel script I have in flash. Its normal function is making some icons rotate and when clicked they zoom in, fade all others and display a little text. On that text I would like to have a link like a "read more". If I use CDATA it wont display a thing, if I use alt char like &#60;a href=&#34;www.google.com&#34;&#62; Read more + &#60;/a&#62; It just displays the text as: <a href="www.google.com"> Read more + </a>. The flash dynamic text box wont render it as html. I dont enough as2 to figure out how to add this. My code: var xml:XML = new XML(); xml.ignoreWhite = true; //definições do xml xml.onLoad = function() { var nodes = this.firstChild.childNodes; numOfItems = nodes.length; for(var i=0;i<numOfItems;i++) { var t = home.attachMovie("item","item"+i,i+1); t.angle = i * ((Math.PI*2)/numOfItems); t.onEnterFrame = mover; t.toolText = nodes[i].attributes.tooltip; t.content = nodes[i].attributes.content; t.icon.inner.loadMovie(nodes[i].attributes.image); t.r.inner.loadMovie(nodes[i].attributes.image); t.icon.onRollOver = over; t.icon.onRollOut = out; t.icon.onRelease = released; } } And the xml: <?xml version="1.0" encoding="UTF-8"?> <icons> <icon image="images/product.swf" tooltip="Product" content="Hello this is some random text &#60;a href=&#34;www.google.com&#34;&#62; Read More + &#60;/a&#62; "/> </icons> Any suggestions? Thanks.

    Read the article

  • Spring.Net Message Selectors with compound statements don't seem to be working

    - by Jonathan Beerhalter
    I'm using Spring.NET to connect to ActiveMQ and do some fairly simple pub sub routing. Everything works fine when my selector is a simple expression like Car='Honda' but if I try a compound expression like Car='Honda' AND Make='Pilot' I never get any matches on my subscription. Here's the code to generate the subscription, does anyone see where I might be doing something wrong? public bool AddSubscription(string topicName, Dictionary<string,string> selectorList, GDException exp) { try { ActiveMQTopic topic = new ActiveMQTopic(topicName); string selectorString = ""; if (selectorList.Keys.Count == 0) { // Select all items for this topic selectorString = "2>1"; } else { foreach (string key in selectorList.Keys) { selectorString += key + " = '" + selectorList[key] + "'" + " AND "; } selectorString = selectorString.Remove(selectorString.Length - 5, 5); } IMessageConsumer consumer = this._subSession.CreateConsumer(topic, selectorString, false); if (consumer != null) { _consumers.Add(consumer); consumer.Listener += new MessageListener(HandleRecieveMessage); return true; } else { exp.SetValues("Error adding subscription, null consumer returned"); return false; } } catch (Exception ex) { exp.SetValues(ex); return false; } } And then the code to send the message, which seems simple enough to me public void SendMessage(GDPubSubMessage messageToSend) { if (!this.isDisposed) { if (_producers.ContainsKey(messageToSend.Topic)) { IBytesMessage bytesMessage = this._pubSession.CreateBytesMessage(messageToSend.Payload); foreach (string key in messageToSend.MessageProperties.Keys) { bytesMessage.Properties.SetString(key, messageToSend.MessageProperties[key]); } _producers[messageToSend.Topic].Send(bytesMessage, false, (byte)255, TimeSpan.FromSeconds(1)); } else { ActiveMQTopic topic = new ActiveMQTopic(messageToSend.Topic); _producers.Add(messageToSend.Topic, this._pubSession.CreateProducer(topic)); IBytesMessage bytesMessage = this._pubSession.CreateBytesMessage(messageToSend.Payload); foreach (string key in messageToSend.MessageProperties.Keys) { bytesMessage.Properties.SetString(key, messageToSend.MessageProperties[key]); } _producers[messageToSend.Topic].Send(bytesMessage); } } else { throw new ObjectDisposedException(this.GetType().FullName); } } 07/102009: Update Ok, found the problem bytesMessage.Properties.SetString(key, messageToSend.MessageProperties[key]); This justs sets a single property, so my messages are only being tagged with a single property, hence the combo subscription never gets hit. Anyone know how to add more properties? You'd think bytesMessage.Properties would have a Add method, but it doesn't.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • apply style to range of text with javascript in uiwebview

    - by drawnonward
    I am displaying some simple styled text as html in a UIWebView on iPhone. It is basically a series of paragraphs with the occasional strong or emphasized phrase. At runtime I need to apply styles to ranges of text. There are a few similar scenarios, one of which is highlighting search results. If the user has searched for "something" I would like to change the background color behind occurrences of the word, then later restore the original background. Is it possible to apply styles to ranges of text using javascript? A key part of this is also being able to unset the styles. There seem to be two likely paths to follow. One would be modifying some html in Objective-C and passing it through javascript as the new innerHTML of some container. The other would be to use javascript to directly manipulate DOM nodes. I could manipulate html, but that sounds tedious in Objective-C so I would rather manipulate the DOM if that is a reasonable approach. I am not that familiar with javascript and DOM so I do not know if it is a reasonable approach. I wrote some routines to translate between text ranges and node ranges with offsets. So if I start with text range 100-200 and that starts in one paragraph and ends in a third, I can get the text nodes and the offsets within the nodes that represent the given text range. I just need a way to split a text node at an offset in the text. Currently I just apply styles to the paragraphs containing the text range. A few notes: straight javascript please, no external frameworks like jquery. the changes never need to be written to disk. the changes should be undoable or at least removable. the styles to apply already exist in a css file. it needs to work in iPhone 3.0 and forward. all the source files are shipped with the app. please be verbose. Thanks for any suggestions.

    Read the article

  • JavaFX2: Drag Event start and end coordinates

    - by user
    I have one node(ImageView) that displays an image and another node(rectangle) that resides on top of it. The behavior I need is that when the mouse is dragged(press-drag-release gesture) over the rectangle, both the nodes should move coherently. My thought process goes in the following direction: • Move both the nodes by the same distance in the direction of the drag. For this option(maybe there are more options) I need the distance between the start and end of the mouse drags. I tried capturing the start and end coordinates of the drag but have been unsuccessful. I think I am getting lost in which handlers to implement. The code I have is below: import javafx.event.EventHandler; import javafx.geometry.Rectangle2D; import javafx.scene.image.ImageView; import javafx.scene.input.MouseEvent; public class MyView { double mouseDragStartX; double mouseDragEndX; double mouseDragStartY; double mouseDragEndY; ImageView imageView; public MyView() { imageView = new ImageView("C:\\temp\\test.png"); } private void setRectangleEvents(final MyObject myObject) { myObject.getRectangle().setOnMousePressed(new EventHandler<MouseEvent>() { @Override public void handle(MouseEvent mouseEvent) { mouseDragStartX = mouseEvent.getX(); mouseDragStartY = mouseEvent.getY(); mouseEvent.consume(); } }); myObject.getRectangle().setOnMouseReleased(new EventHandler<MouseEvent>() { public void handle(MouseEvent mouseEvent) { mouseDragEndX = mouseEvent.getX(); mouseDragEndY = mouseEvent.getY(); myObjectDraggedHandler(); } }); } private void myObjectDraggedHandler() { Rectangle2D viewport = this.imageView.getViewport(); double newX = this.imageView.getImage().getWidth() + (mouseDragEndX - mouseDragStartX); double newY = this.imageView.getImage().getHeight() + (mouseDragEndY - mouseDragStartY); this.imageView.setViewport(new Rectangle2D(newX, newY, viewport.getWidth(), viewport .getHeight())); } } P.S: This code is just for indicating what I am trying to implement and will not compile correctly. Or maybe my question should just have been: How to capture the length or span of a mouse drag?

    Read the article

  • Image_tag .blank? - paperclip - Ruby on rails

    - by bgadoci
    I have just installed paperclip into my ruby on rails blog application. Everything is working great...too great. I am trying to figure out how to tell paperclip not to output anything if there is no record in the table so that I don't have broken image links everywhere. How, and where, do I do this? Here is my code: class Post < ActiveRecord::Base has_attached_file :photo, :styles => { :small => "150x150"} validates_presence_of :body, :title has_many :comments, :dependent => :destroy has_many :tags, :dependent => :destroy has_many :ugtags, :dependent => :destroy has_many :votes, :dependent => :destroy belongs_to :user after_create :self_vote def self_vote # I am assuming you have a user_id field in `posts` and `votes` table. self.votes.create(:user => self.user) end cattr_reader :per_page @@per_page = 10 end View <% div_for post do %> <div id="post-wrapper"> <div id="post-photo"> <%= image_tag post.photo.url(:small) %> </div> <h2><%= link_to_unless_current h(post.title), post %></h2> <div class="light-color"> <i>Posted <%= time_ago_in_words(post.created_at) %></i> ago </div> <%= simple_format truncate(post.body, :length => 600) %> <div id="post-options"> <%= link_to "Read More >>", post %> | <%= link_to "Comments (#{post.comments.count})", post %> | <%= link_to "Strings (#{post.tags.count})", post %> | <%= link_to "Contributions (#{post.ugtags.count})", post %> | <%= link_to "Likes (#{post.votes.count})", post %> </div> </div> <% end %>

    Read the article

  • Serialize problem with cookie

    - by cagin
    Hi there, I want use cookie in my web project. I must serialize my classes. Although my code can seralize an int or string value, it cant seralize my classes. This is my seralize and cookie code : public static bool f_SetCookie(string _sCookieName, object _oCookieValue, DateTime _dtimeExpirationDate) { bool retval = true; try { if (HttpContext.Current.Request[_sCookieName] != null) { HttpContext.Current.Request.Cookies.Remove(_sCookieName); } BinaryFormatter bf = new BinaryFormatter(); MemoryStream ms = new MemoryStream(); bf.Serialize(ms, _oCookieValue); byte[] bArr = ms.ToArray(); MemoryStream objStream = new MemoryStream(); DeflateStream objZS = new DeflateStream(objStream, CompressionMode.Compress); objZS.Write(bArr, 0, bArr.Length); objZS.Flush(); objZS.Close(); byte[] bytes = objStream.ToArray(); string sCookieVal = Convert.ToBase64String(bytes); HttpCookie cook = new HttpCookie(_sCookieName); cook.Value = sCookieVal; cook.Expires = _dtimeExpirationDate; HttpContext.Current.Response.Cookies.Add(cook); } catch { retval = false; } return retval; } And here is one of my classes: [Serializable] public class Tahlil { #region Props & Fields public string M_KlinikKodu{ get; set; } public DateTime M_AlinmaTarihi { get; set; } private List<Test> m_Tesler; public List<Test> M_Tesler { get { return m_Tesler; } set { m_Tesler = value; } } #endregion public Tahlil() {} Tahlil(DataRow _rwTahlil){} } I m calling my Set Cookie method: Tahlil t = new Tahlil(); t.M_AlinmaTarihi = DateTime.Now; t.M_KlinikKodu = "2"; t.M_Tesler = new List<Test>(); f_SetCookie("Tahlil", t, DateTime.Now.AddDays(1)); I cant see cookie in Cookie folder and Temporary Internet Files but if i will call method like that: f_SetCookie("TRY", 5, DateTime.Now.AddDays(1)); I can see cookie. What is the problem? I dont understand. Thank you for your helps.

    Read the article

  • zlib gzgets extremely slow?

    - by monkeyking
    I'm doing stuff related to parsing huge globs of textfiles, and was testing what input method to use. There is not much of a difference using c++ std::ifstreams vs c FILE, According to the documentation of zlib, it supports uncompressed files, and will read the file without decompression. I'm seeing a difference from 12 seconds using non zlib to more than 4 minutes using zlib.h This I've tested doing multiple runs, so its not a disk cache issue. Am I using zlib in some wrong way? thanks #include <zlib.h> #include <cstdio> #include <cstdlib> #include <fstream> #define LENS 1000000 size_t fg(const char *fname){ fprintf(stderr,"\t-> using fgets\n"); FILE *fp =fopen(fname,"r"); size_t nLines =0; char *buffer = new char[LENS]; while(NULL!=fgets(buffer,LENS,fp)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } size_t is(const char *fname){ fprintf(stderr,"\t-> using ifstream\n"); std::ifstream is(fname,std::ios::in); size_t nLines =0; char *buffer = new char[LENS]; while(is. getline(buffer,LENS)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } size_t iz(const char *fname){ fprintf(stderr,"\t-> using zlib\n"); gzFile fp =gzopen(fname,"r"); size_t nLines =0; char *buffer = new char[LENS]; while(0!=gzgets(fp,buffer,LENS)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } int main(int argc,char**argv){ if(atoi(argv[2])==0) fg(argv[1]); if(atoi(argv[2])==1) is(argv[1]); if(atoi(argv[2])==2) iz(argv[1]); }

    Read the article

  • Forced closed only when put alphabetical string in edit text

    - by Abdullah Al Mubarok
    So, I make a checker if an id is in the database or not, the id is in numerical string, the type in database is char(6) though. So this is my code public class input extends Activity{ /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.input); final EditText edittext = (EditText)findViewById(R.id.editText1); Button button = (Button)findViewById(R.id.button1); button.setOnClickListener(new OnClickListener(){ @Override public void onClick(View arg0) { // TODO Auto-generated method stub String nopel = edittext.getText().toString(); if(nopel.length() == 0){ Toast.makeText(getApplicationContext(), "error", Toast.LENGTH_SHORT).show(); }else{ List<NameValuePair> pairs = new ArrayList<NameValuePair>(); pairs.add(new BasicNameValuePair("nopel", nopel)); JSON json_dp = new JSON(); JSONObject jobj_dp = json_dp.getJSON("http://10.0.2.2/KP/pdam/nopel.php", pairs); try { if(jobj_dp.getInt("row") == 0){ Toast.makeText(getApplicationContext(), "error", Toast.LENGTH_SHORT).show(); }else{ String snopel = jobj_dp.getString("nopel"); String snama = jobj_dp.getString("nama"); String salamat = jobj_dp.getString("alamat"); String sgolongan = jobj_dp.getString("golongan"); Intent i = new Intent(input.this, list.class); i.putExtra("nopel", snopel); i.putExtra("nama", snama); i.putExtra("alamat", salamat); i.putExtra("golongan", sgolongan); startActivity(i); } } catch (JSONException e) { // TODO Auto-generated catch block e.printStackTrace(); } } } }); } } the first check is to check if an input is null, it's going right for now, the second check is to check if an id in the database, and it's the problem. When I try some id in numerical value like "0001" or "02013" it's fine, and can run. but when I just got to put "abushd" it forced close. anyone know why I got this?

    Read the article

  • writing XML with Xerces 3.0.1 and C++ on windows

    - by Jon
    Hi, i have the following function i wrote to create an XML file using Xerces 3.0.1, if i call this function with a filePath of "foo.xml" or "../foo.xml" it works great, but if i pass in "c:/foo.xml" then i get an exception on this line XMLFormatTarget *formatTarget = new LocalFileFormatTarget(targetPath); can someone explain why my code works for relative paths, but not absolute paths please? many thanks. const int ABSOLUTE_PATH_FILENAME_PREFIX_SIZE = 9; void OutputXML(xercesc::DOMDocument* pmyDOMDocument, std::string filePath) { //Return the first registered implementation that has the desired features. In this case, we are after a DOM implementation that has the LS feature... or Load/Save. DOMImplementation *implementation = DOMImplementationRegistry::getDOMImplementation(L"LS"); // Create a DOMLSSerializer which is used to serialize a DOM tree into an XML document. DOMLSSerializer *serializer = ((DOMImplementationLS*)implementation)->createLSSerializer(); // Make the output more human readable by inserting line feeds. if (serializer->getDomConfig()->canSetParameter(XMLUni::fgDOMWRTFormatPrettyPrint, true)) serializer->getDomConfig()->setParameter(XMLUni::fgDOMWRTFormatPrettyPrint, true); // The end-of-line sequence of characters to be used in the XML being written out. serializer->setNewLine(XMLString::transcode("\r\n")); // Convert the path into Xerces compatible XMLCh*. XMLCh *tempFilePath = XMLString::transcode(filePath.c_str()); // Calculate the length of the string. const int pathLen = XMLString::stringLen(tempFilePath); // Allocate memory for a Xerces string sufficent to hold the path. XMLCh *targetPath = (XMLCh*)XMLPlatformUtils::fgMemoryManager->allocate((pathLen + ABSOLUTE_PATH_FILENAME_PREFIX_SIZE) * sizeof(XMLCh)); // Fixes a platform dependent absolute path filename to standard URI form. XMLString::fixURI(tempFilePath, targetPath); // Specify the target for the XML output. XMLFormatTarget *formatTarget = new LocalFileFormatTarget(targetPath); //XMLFormatTarget *myFormTarget = new StdOutFormatTarget(); // Create a new empty output destination object. DOMLSOutput *output = ((DOMImplementationLS*)implementation)->createLSOutput(); // Set the stream to our target. output->setByteStream(formatTarget); // Write the serialized output to the destination. serializer->write(pmyDOMDocument, output); // Cleanup. serializer->release(); XMLString::release(&tempFilePath); delete formatTarget; output->release(); }

    Read the article

  • Simple Modal with Autocomplete in ASP.NET

    - by DanielJaymes
    Hello, I am quite new to this so any help is very much appreciated. I am generating a modal pop using Simple Modal, this works ok. I now want to add jquery autocomplete to the element txtEmail. When I run the page outside of Simple Modal I can use Autocomplete, however when the page is loaded through Simple Modal it does not work. I have checked to ensure the element is loaded, and it is allowing me to change the text color, but I can not add autocomplete to it. The code is /** * @author Daniel */ jQuery(function($) { $("input.ema, a.ema").click(function(e) { e.preventDefault(); $("#osx-modal-content").modal({ appendTo: 'form', overlayId: 'osx-overlay', containerId: 'osx-container', closeHTML: '<div class="close"><a href="#" class="simplemodal-close">X</a></div>', minHeight: 80, opacity: 65, position: ['0', ], overlayClose: true, onOpen: OSX.open, onClose: OSX.close, onShow: OSX.show }); }); var OSX = { container: null, open: function(d) { var self = this; $.ajax({ url: "/Message/UserMessage/", type: 'GET', dataType: 'html', // <-- to expect an html response success: function(result) { var data = "Core Selectors Attributes Traversing Manipulation CSS Events Effects Ajax Utilities".split(" "); $('div#osx-modal-data').html(result).find("#txtEmail").css('color', '#c00'); if ($('div#osx-modal-data').find("#txtEmail").length) { // implies *not* zero $('div#osx-modal-data').find("#txtEmail").autocomplete(data); alert('We found img elements on the page using "img"'); } else { alert('No txtEmail elements found'); } } }); self.container = d.container[0]; d.overlay.fadeIn('slow', function() { $("#osx-modal-content", self.container).show(); $('div#osx-modal-title').html("Send Email"); var title = $("#osx-modal-title", self.container); title.show(); d.container.slideDown('slow', function() { setTimeout(function() { var h = $("#osx-modal-data", self.container).height() + title.height() + 20; // padding d.container.animate({ height: h }, 200, function() { $("div.close", self.container).show(); $("#osx-modal-data", self.container).show(); }); }, 300); }); }) }, close: function(d) { var self = this; d.container.animate({ top: "-" + (d.container.height() + 20) }, 500, function() { self.close(); // or $.modal.close(); }); }, show: function(d) { // $('div#osx-modal-data').find("#txtEmail").css('color', '#ccc') } }; });

    Read the article

  • Duplicate Blob field with foreach

    - by JGSilva
    I have some fields (blob) where I have uploaded some images. The images display correctly and I can open it without problem in Photoshop for example. I created a button where user can duplicate the product and everything works fine, but when it comes to duplicate the image entry I got some errors, like 1064 and others ones that I can't remember cause I am working 3 days inside this. Because de original product have 3 or more images I select then and gave an foreach. What I notice when a print de blob is that in the end it eats the next array, like if don't have an end. In other words, the next item got inside that utf-8 character in the print. That gave me some clue. The next approach was to save it in somewhere, and reupload it. The problem is that only the first one works. When I download the image saved, it opens normally so, it is not a saving in disk problem. When I gave a print in the $result, the same happens, is like the image is hungry and ate the next one. Here is the code. Notice = I created the [$count] to see if was not an rewrite in array error. Even tried to , in beging of the foreach, kind of clean the vars… $count=0; foreach ($original_image as $key => $val) { $count++; //$arquivo = ''; //$image = ''; //$file = ''; //$this->image = ''; //$return = ''; $arquivo[$count] = $val['pi_id'].'.'.$val['pi_type']; $image[$count] = $caminho_url.$arquivo[$count]; if (file_exists($image[$count])) { $this->image = Image::factory($image[$count]); $this->image->save($image[$count]); $file[$count]=mysql_real_escape_string(addslashes(fread(fopen($image[$count], "r"), filesize($image[$count])))); $return[$count] = Product::add_image($id_prod, $file[$count], $val['pi_type'],$val['pi_main']); }else { die('no'); } }

    Read the article

  • disable dates using jquery inside gridview control

    - by bladerunner
    Hi there, I have a gridview which contains a textbox control. I need to show the calendar for the user to pick the date and certain dates are to be disabled using jquery. I found a post on stackoverflow that talked about how to disable certain dates. I am done with that part, except not sure how to pass the textbox control to this jquery function. Here is the code. <script type="text/javascript" language="javascript"> function pageLoad(sender, args) { var enabledDays = ['09/21/2011', '10/05/2011', '10/19/2011', '11/02/2011', '11/16/2011']; /* utility functions */ function editDays(date) { for (var i = 0; i < enabledDays.length; i++) { if (new Date(enabledDays[i]).toString() == date.toString()) { return [true]; } } return [false]; } /* create datepicker */ $(document).ready(function() { $('#<%= txtInHomeDate.ClientID %>').datepicker({ beforeShow: springDate, beforeShowDay: editDays, dateFormat: 'mm/dd/yy', buttonImage: 'images/cal.gif', buttonText: 'Choose date', firstDay: 1, buttonImageOnly: true, showOn: 'both', showAnim: 'fadeIn', onSelect: function() { $(this).trigger("onchange", null); } }); function springDate() { var defaultMin = new Date(); var defaultMax = new Date(); var Min = defaultMin; var Max = defaultMax; // make valid date from hiddenfied value format is MM/dd/yyyy dateMin = $('#<%= hfStDate.ClientID %>').val(); dateMin = new Date(dateMin); dateMax = $('#<%= hfEndDate.ClientID %>').val(); dateMax = new Date(dateMax); if (dateMin && dateMax) { Min = new Date(dateMin.getFullYear(), dateMin.getMonth(), dateMin.getDate()); Max = new Date(dateMax.getFullYear(), dateMax.getMonth(), dateMax.getDate()); } return { minDate: Min, maxDate: Max }; } }); } <.... <asp:TemplateField HeaderText="In-Home Date"> <ItemStyle HorizontalAlign="Center" /> <ItemTemplate> <asp:HiddenField ID="hfStDate" runat="server" Value="09/01/2011" /> <asp:HiddenField ID="hfEndDate" runat="server" Value="11/30/2011" /> <asp:TextBox ID="txtInHomeDate" runat="server" /> </ItemTemplate> </asp:TemplateField> Currently, it errors out since the jquery function won't find the txtInHomeDate. Could I get some help as I am pretty close to get this done? Thanks!!

    Read the article

  • Writing to a xml file in java

    - by user243680
    import java.io.*; import javax.xml.parsers.*; import javax.xml.transform.*; import javax.xml.transform.dom.*; import javax.xml.transform.stream.*; import org.w3c.dom.*; public class CreatXMLFile { public static void main(String[] args) throws Exception { BufferedReader bf = new BufferedReader(new InputStreamReader(System.in)); // System.out.print("Enter number to add elements in your XML file: "); // String str = bf.readLine(); int no=2; // System.out.print("Enter root: "); String root = "SMS"; DocumentBuilderFactory documentBuilderFactory =DocumentBuilderFactory.newInstance(); DocumentBuilder documentBuilder =documentBuilderFactory.newDocumentBuilder(); Document document = documentBuilder.newDocument(); Element rootElement = document.createElement(root); document.appendChild(rootElement); // for (int i = 1; i <= no; i++) // System.out.print("Enter the element: "); // String element = bf.readLine(); String element ="Number"; System.out.print("Enter the Number: "); String data = bf.readLine(); Element em = document.createElement(element); em.appendChild(document.createTextNode(data)); rootElement.appendChild(em); String element1 ="message"; System.out.print("Enter the SMS: "); String data1 = bf.readLine(); Element em1 = document.createElement(element1); em1.appendChild(document.createTextNode(data1)); rootElement.appendChild(em1); TransformerFactory transformerFactory = TransformerFactory.newInstance(); Transformer transformer = transformerFactory.newTransformer(); DOMSource source = new DOMSource(document); StreamResult result = new StreamResult(System.out); transformer.transform(source, result); } } i am working on the above code and it gives the following output run: Enter the Number: 768678 Enter the SMS: ytu <?xml version="1.0" encoding="UTF-8" standalone="no"?><SMS><Number>768678</Number><message>ytu</message></SMS>BUILD SUCCESSFUL (total time: 8 seconds) Now i want to write the output generated(<?xml version="1.0" encoding="UTF-8" standalone="no"?><SMS><Number>768678</Number><message>ytu</message></SMS>) to a XML file on the hard disk.How do i do it?

    Read the article

  • Inserting a string array as a row into an Excel document using the Open XML SDK 2.0

    - by Sam
    The code runs, but corrupts my excel document. Any help would be mucho appreciated! I used this as a reference. public void AddRow(string fileName, string[] values) { using (SpreadsheetDocument doc = SpreadsheetDocument.Open(fileName, true)) { SharedStringTablePart sharedStringPart = GetSharedStringPart(doc); WorksheetPart worksheetPart = doc.WorkbookPart.WorksheetParts.First(); uint rowIdx = AppendRow(worksheetPart); for (int i = 0; i < values.Length; ++i) { int stringIdx = InsertSharedString(values[i], sharedStringPart); Cell cell = InsertCell(i, rowIdx, worksheetPart); cell.CellValue = new CellValue(stringIdx.ToString()); cell.DataType = new EnumValue<CellValues>( CellValues.SharedString); worksheetPart.Worksheet.Save(); } } } private SharedStringTablePart GetSharedStringPart( SpreadsheetDocument doc) { if (doc.WorkbookPart. GetPartsCountOfType<SharedStringTablePart>() > 0) return doc.WorkbookPart. GetPartsOfType<SharedStringTablePart>().First(); else return doc.WorkbookPart. AddNewPart<SharedStringTablePart>(); } private uint AppendRow(WorksheetPart worksheetPart) { SheetData sheetData = worksheetPart.Worksheet. GetFirstChild<SheetData>(); uint rowIndex = (uint)sheetData.Elements<Row>().Count(); Row row = new Row() { RowIndex = rowIndex }; sheetData.Append(row); return rowIndex; } private int InsertSharedString(string s, SharedStringTablePart sharedStringPart) { if (sharedStringPart.SharedStringTable == null) sharedStringPart.SharedStringTable = new SharedStringTable(); int i = 0; foreach (SharedStringItem item in sharedStringPart.SharedStringTable. Elements<SharedStringItem>()) { if (item.InnerText == s) return i; ++i; } sharedStringPart.SharedStringTable.AppendChild( new Text(s)); sharedStringPart.SharedStringTable.Save(); return i; } private Cell InsertCell(int i, uint rowIdx, WorksheetPart worksheetPart) { SheetData sheetData = worksheetPart.Worksheet. GetFirstChild<SheetData>(); string cellReference = AlphabetMap.Instance[i] + rowIdx; Cell cell = new Cell() { CellReference = cellReference }; Row row = sheetData.Elements<Row>().ElementAt((int)rowIdx); row.InsertAt(cell, i); worksheetPart.Worksheet.Save(); return cell; }

    Read the article

  • Finding open contiguous blocks of time for every day of a month, fast

    - by Chris
    I am working on a booking availability system for a group of several venues, and am having a hard time generating the availability of time blocks for days in a given month. This is happening server-side in PHP, but the concept itself is language agnostic -- I could be doing this in JS or anything else. Given a venue_id, month, and year (6/2012 for example), I have a list of all events occurring in that range at that venue, represented as unix timestamps start and end. This data comes from the database. I need to establish what, if any, contiguous block of time of a minimum length (different per venue) exist on each day. For example, on 6/1 I have an event between 2:00pm and 7:00pm. The minimum time is 5 hours, so there's a block open there from 9am - 2pm and another between 7pm and 12pm. This would continue for the 2nd, 3rd, etc... every day of June. Some (most) of the days have nothing happening at all, some have 1 - 3 events. The solution I came up with works, but it also takes waaaay too long to generate the data. Basically, I loop every day of the month and create an array of timestamps for each 15 minutes of that day. Then, I loop the time spans of events from that day by 15 minutes, marking any "taken" timeslot as false. Remaining, I have an array that contains timestamp of free time vs. taken time: //one day's array after processing through loops (not real timestamps) array( 12345678=>12345678, // <--- avail 12345878=>12345878, 12346078=>12346078, 12346278=>false, // <--- not avail 12346478=>false, 12346678=>false, 12346878=>false, 12347078=>12347078, // <--- avail 12347278=>12347278 ) Now I would need to loop THIS array to find continuous time blocks, then check to see if they are long enough (each venue has a minimum), and if so then establish the descriptive text for their start and end (i.e. 9am - 2pm). WHEW! By the time all this looping is done, the user has grown bored and wandered off to Youtube to watch videos of puppies; it takes ages to so examine 30 or so days. Is there a faster way to solve this issue? To summarize the problem, given time ranges t1 and t2 on day d, how can I determine the remaining time left in d that is longer than the minimum time block m. This data is assembled on demand via AJAX as the user moves between calendar months. Results are cached per-page-load, so if the user goes to July a second time, the data that was generated the first time would be reused. Any other details that would help, let me know. Edit Per request, the database structure (or the part that is relevant here) *events* id (bigint) title (varchar) *event_times* id (bigint) event_id (bigint) venue_id (bigint) start (bigint) end (bigint) *venues* id (bigint) name (varchar) min_block (int) min_start (varchar) max_start (varchar)

    Read the article

  • Using drawAtPoint with my CIImage not doing anything on screen

    - by Adam
    Stuck again. :( I have the following code crammed into a procedure invoked when I click on a button on my application main window. I'm just trying to tweak a CIIMage and then display the results. At this point I'm not even worried about exactly where / how to display it. I'm just trying to slam it up on the window to make sure my Transform worked. This code seems to work down through the drawAtPoint message. But I never see anything on the screen. What's wrong? Thanks. Also, as far as displaying it in a particular location on the window ... is the best technique to put a frame of some sort on the window, then get the coordinates of that frame and "draw into" that rectangle? Or use a specific control from IB? Or what? Thanks again. // earlier I initialize a NSImage from JPG file on disk. // then create NSBitmapImageRep from the NSImage. This all works fine. // then ... CIImage * inputCIimage = [[CIImage alloc] initWithBitmapImageRep:inputBitmap]; if (inputCIimage == Nil) NSLog(@"could not create CI Image"); else { NSLog (@"CI Image created. working on transform"); CIFilter *transform = [CIFilter filterWithName:@"CIAffineTransform"]; [transform setDefaults]; [transform setValue:inputCIimage forKey:@"inputImage"]; NSAffineTransform *affineTransform = [NSAffineTransform transform]; [affineTransform rotateByDegrees:3]; [transform setValue:affineTransform forKey:@"inputTransform"]; CIImage * myResult = [transform valueForKey:@"outputImage"]; if (myResult == Nil) NSLog(@"Transformation failed"); else { NSLog(@"Created transformation successfully ... now render it"); [myResult drawAtPoint: NSMakePoint ( 0,0 ) fromRect: NSMakeRect ( 0,0,128,128 ) operation: NSCompositeSourceOver fraction: 1.0]; //100% opaque [inputCIimage release]; } }

    Read the article

  • JSon/Jquery request with a setTimeout always returns a "null" result? (for Twitter Search API)

    - by supermogx
    I make a call to the twitter API. 100 posts are retreived + a properties that tells me what the next page to call is. So I wait 5 sec. and call that next page, but the JSon results in the callback function is always null the second time... I think it's probably a JQuery problem... Here's a complete sample HTML code : <html> <head> <script type="text/javascript" src="./jquery-1.4.2.min.js"></script> <script> function test() { var rqUrl = "http://search.twitter.com/search.json?q=%23apple+OR+%23ipad&rpp=100&callback=?" callTwitterSearchApi(rqUrl); } function callTwitterSearchApi(tiwtterRequestUrl) { debug("request to twitter : " + tiwtterRequestUrl); // *** FIRST CALL WORKS GREAT... *** $.getJSON(tiwtterRequestUrl, callTwitterSearchApi_callback); } function callTwitterSearchApi_callback(jsonPostsResults) { debug("callback"); if (jsonPostsResults == null) { debug("Why is jsonPostsResults null? If I copy paste the request inside a browser, I get something =("); return; } if (jsonPostsResults.error != undefined && jsonPostsResults.error != "") { debug("twitter api error"); } var posts = new Array(); $(jsonPostsResults.results).each(function() { posts.push(this); }); debug("Number of posts : " + posts.length); if (jsonPostsResults.next_page != undefined && jsonPostsResults.next_page.trim() != "") { debug("calling next request in 5 sec..."); // *** WHEN COMMING BACK FROM THAT LINE, JSON RESULTS == NULL?! **** setTimeout("callTwitterSearchApi(\"http://search.twitter.com/search.json" + jsonPostsResults.next_page + "\")", 5000); } } function debug(message) { document.getElementById('debug').innerHTML = message + "\n" + document.getElementById('debug').innerHTML; } </script> </head> <body> <input type="button" onclick="test();" value="test" /><br /> <textarea id="debug" cols="80" rows="20"></textarea> </body> </html> at line 18, at the second callback (back from the setTimeout), the parameter "jsonPostsResults" is always returned as null... I have no idea why. If I copy paste that 2nd request in a browser, it returns 100 results. Anybody had a problem like that with the Ajax JQuery functions when calling it with a setTimeout?

    Read the article

  • Image loader cant load my live image url

    - by Bindhu
    In my application i need to load the images in list view, when using locale(ip ported url) then no problem all images are loading properly, But when using live url then the images are not loading, My image loader class: public class ImageLoader { MemoryCache memoryCache = new MemoryCache(); FileCache fileCache; private Map<ImageView, String> imageViews = Collections .synchronizedMap(new WeakHashMap<ImageView, String>()); ExecutorService executorService; public ImageLoader(Context context) { fileCache = new FileCache(context); executorService = Executors.newFixedThreadPool(5); } final int stub_id = R.drawable.appointeesample; public void DisplayImage(String url, ImageView imageView) { imageViews.put(imageView, url); Bitmap bitmap = memoryCache.get(url); if (bitmap != null) imageView.setImageBitmap(bitmap); else { Log.d("stub", "stub" + stub_id); queuePhoto(url, imageView); imageView.setImageResource(stub_id); } } private void queuePhoto(String url, ImageView imageView) { PhotoToLoad p = new PhotoToLoad(url, imageView); executorService.submit(new PhotosLoader(p)); } private Bitmap getBitmap(String url) { File f = fileCache.getFile(url); // from SD cache Bitmap b = decodeFile(f); if (b != null) return b; // from web try { Bitmap bitmap = null; URL imageUrl = new URL(url); HttpURLConnection conn = (HttpURLConnection) imageUrl .openConnection(); conn.setConnectTimeout(30000); conn.setReadTimeout(30000); conn.setInstanceFollowRedirects(true); InputStream is = conn.getInputStream(); BufferedInputStream bis = new BufferedInputStream(is, 81960); BitmapFactory.Options opts = new BitmapFactory.Options(); opts.inJustDecodeBounds = true; OutputStream os = new FileOutputStream(f); Utils.CopyStream(bis, os); os.close(); bitmap = decodeFile(f); Log.d("bitmap", "Bit map" + bitmap); return bitmap; } catch (Exception ex) { ex.printStackTrace(); return null; } } // decodes image and scales it to reduce memory consumption private Bitmap decodeFile(File f) { try { try { BitmapFactory.Options o = new BitmapFactory.Options(); o.inJustDecodeBounds = true; BitmapFactory.decodeStream(new FileInputStream(f), null, o); final int REQUIRED_SIZE = 200; int scale = 1; while (o.outWidth / scale / 2 >= REQUIRED_SIZE && o.outHeight / scale / 2 >= REQUIRED_SIZE) scale *= 2; BitmapFactory.Options o2 = new BitmapFactory.Options(); o2.inSampleSize = scale; return BitmapFactory.decodeStream(new FileInputStream(f), null, o2); } catch (FileNotFoundException e) { } finally { System.gc(); } return null; } catch (Exception e) { } return null; } // Task for the queue private class PhotoToLoad { public String url; public ImageView imageView; public PhotoToLoad(String u, ImageView i) { url = u; imageView = i; } } class PhotosLoader implements Runnable { PhotoToLoad photoToLoad; PhotosLoader(PhotoToLoad photoToLoad) { this.photoToLoad = photoToLoad; } @Override public void run() { if (imageViewReused(photoToLoad)) return; Bitmap bmp = getBitmap(photoToLoad.url); memoryCache.put(photoToLoad.url, bmp); if (imageViewReused(photoToLoad)) return; BitmapDisplayer bd = new BitmapDisplayer(bmp, photoToLoad); Activity a = (Activity) photoToLoad.imageView.getContext(); a.runOnUiThread(bd); } } boolean imageViewReused(PhotoToLoad photoToLoad) { String tag = imageViews.get(photoToLoad.imageView); if (tag == null || !tag.equals(photoToLoad.url)) return true; return false; } // Used to display bitmap in the UI thread class BitmapDisplayer implements Runnable { Bitmap bitmap; PhotoToLoad photoToLoad; public BitmapDisplayer(Bitmap b, PhotoToLoad p) { bitmap = b; photoToLoad = p; } public void run() { if (imageViewReused(photoToLoad)) return; if (bitmap != null) photoToLoad.imageView.setImageBitmap(bitmap); else photoToLoad.imageView.setImageResource(stub_id); } } public void clearCache() { memoryCache.clear(); fileCache.clear(); } My Live Image url for Example: https://goappointed.com/images_upload/3330Torana_Logo.JPG I have referred google but no solution is working, Thanks a lot in advance.

    Read the article

< Previous Page | 749 750 751 752 753 754 755 756 757 758 759 760  | Next Page >