Search Results

Search found 26214 results on 1049 pages for 'farm solution'.

Page 756/1049 | < Previous Page | 752 753 754 755 756 757 758 759 760 761 762 763  | Next Page >

• Is there any practical usage of Doubly Linked List, Queues and Stacks?

  - by Chouette

  I've been coding for quite sometime now. And my work pertains to solving real-world business scenarios. However, I have not really come across any practical usage of some of the data structures like the Linked List, Queues and Stacks etc. Not even at the business framework level. Of course, there is the ubiquitous HashTable, ArrayList and of late the List...but is there any practical usage of some of the other basic data structures? It would be great if someone gave a real-world solution where a Doubly Linked List "performs" better than the obvious easily usable counterpart.

  Read the article

• MySQL pivot tables - covert rows to columns

  - by user2723490

  This is the structure of my table: Then I run a query SELECT `date`,`index_name`,`results` FROM `mst_ind` WHERE `index_name` IN ('MSCI EAFE Mid NR USD', 'Alerian MLP PR USD') AND `time_period`='M1' and get a table like How can I convert "index_name" rows to columns like: date | MSCI EAFE Mid NR USD | Alerian MLP PR USD etc In other words I need each column to represent an index and rows to represent date-result. I understand that MySQL doesn't have pivot table functions. What is the easiest way of doing this? I've tried this code, but it generates an error: SELECT `date`, MAX(IF(index_name = 'Alerian MLP PR USD' AND `time_period`='M1', results, NULL)) AS res1, MAX(IF(index_name = 'MSCI EAFE Mid NR USD' AND `time_period`='M1', results, NULL)) AS res2 FROM `mst_ind` GROUP BY `date I need to make the conversion on the query level - not PHP. Please suggest a nice and elegant solution. Thanks!

  Read the article

• Broadcast message or file to nearby Bluetooth devices

  - by Medjeti

  Hiya, A client of ours is attending a business fair and would like to push some sort of "welcome message" to people visiting their space. I'm not too familiar with Bluetooth, so I have a few questions: What kind of content can you transfer via Bluetooth? (Is it files only or is it possible to send a simple text message?) Is it possible to push content only to recipients within a certain distance? (ie. based on signal strength or similar) Can anybody recommend a piece of software that can do some or all of the above? If necessary we could program a custom solution ourselves (.NET), but I'm sure there must be a program out there that can do the job. I've googled a bit and came across the 32feet.NET framework - does anybody have any experience with this framework? Thanks in advance for any suggestions!

  Read the article

• Deprecated: Function eregi() is deprecated, how to solve this error ?

  - by Jitendra Vyas

  I'm using this php code. but it's giving error Deprecated: Function eregi() is deprecated in C:\xampp\htdocs\fuel\emailcheck.php on line 7 <? include_once("mastersecure.php"); $emailcheck=$_POST["member_name"]; function isValidEmail($email){ $pattern = "^[_a-z0-9-]+(\.[_a-z0-9-]+)*@[a-z0-9-]+(\.[a-z0-9-]+)*(\.[a-z]{2,3})$"; if (eregi($pattern, $email)){ return true; } else { return false; } } if (!isValidEmail($_POST['member_name'])){ echo "The email is invalid!"; } else { $query="select email from fuel where email='$_POST[member_name]'"; $res=mysql_query($query); $rowcount=mysql_num_rows($res); if($rowcount!=0) { echo "This mail is already exits"; } } ?> Any solution for this?

  Read the article

• Call center workflow scenario with WF 4

  - by mossy

  I need to develop a workflow for a call center. A bot will ask some predefined questions to the caller. Based on the answers the workflow will decide the questions to ask and finally redirect the caller to a representative that has required skills. Based on the scenario above, I have several questions. How can I make the workflow "wait" between asking a question to the caller and receiving response from the caller? Do I have to use HandleExternalEvent? If so do I have to define an event for every question? Flowchart workflow seems to be the best solution but I can't imagine how to handle this waiting issue right now. Any help is appreciated.

  Read the article

• Communication between c++ objects.

  - by Pradyot

  This is an issue, that I have come acrosss earlier. Basically a c++ object has a member object that does some work, once the work is done , a notification needs to made to the parent. What is the most elegant solution to allow this communication. Does being in this position indicate a flaw with the design to begin with? To elaborate. class A { B member; void do_something(); } class B{ void talk_to_network(); }; void do_something() { //Conditional wait on a variable that will change when talk to network completes. //So need a way for B to inform A, that it is done. }

  Read the article

• How to get line count from variable (from MYSQL query)?

  - by Mint

  My problematic code: testMYSQL=`mysql -u $mysqlUser -p$mysqlPass -h $mysqlHost --skip-column-names --batch -D $mysqlDB -e "SELECT $select FROM $mysqlTable WHERE nameTXT='test';"` $testMYSQL now contains: test test test Then I do: TEST=$(echo $testMYSQL | wc -l) echo "$TEST" I would of thought that would work, but it doesn't, it returns 1 But if I put this into $testMYSQL: "test\ntest\ntest" it will say 3… Whats going on here? does MYSQL not use new lines? PS, I know I can use a for loop to loop though the lines then count up the lines that way, but I was hoping for a simpler solution like wc

  Read the article

• Load big XML files to mySQL database (PHP)

  - by Kees

  Hello There, For a new project I need to load big XML files (200MB+) to a mySQL database. There are +- 20 feeds i need to match with that (not all fields are the same). Now when i want to catch the XML I get this error: Fatal error: Allowed memory size of 134217728 bytes exhausted (tried to allocate 171296569 bytes) in E:\UsbWebserver\Root\****\application\libraries\MY_xml.php on line 21 Is there an easy solution for this? It's not possible to get te feed in parts of a few MB's each. Thank you very much! P.s. has somebody an idea to match xml-feeds easy?

  Read the article

• Sending emails from Django App

  - by Will M.

  We are a growing Django app that is currently using Google Apps to send email. We are hitting the maximum limits of email sending and need a better solution. We prefer not to have to manage our own email servers and the easier the better. What is the best, easiest, and cheapest way to send a large amount of email? We have looked at Postageapp but they require you to use your own SMTP server. We are considering App Engine to send email but it will require a lot of configuration to get it to work correctly. What can we use to quickly fix this problem?

  Read the article

• The best way to store username and password without a database

  - by Mokuchan

  Hello everyone, I want to build a simple single user login "library" in PHP, but I'm facing the following dilemma: how should I store username and password if I'm not using a database? A simple plain text file could be easily read and then the password could be easily decripted so that's not an option. If I create a php file with just <?php $Username= "username"; $Password= "password"; ?> then no one should be able to read it and I could simply include this file where I need it, but I'm not really sure you can't find a better way to do this! So what's, in your opinion, the best solution to this problem (and why)? Thanks

  Read the article

• jquery integrate form parameter in one object

  - by jesse

  There are many forms in my page. I want to merge them in one object and submit them in one object. But I find serializeArray() or serialize() do not match my request, the serializeArray function will generate a array object and serialize is used by get model, it is not an object. is there a jquery or local function can merge them in one object. I have one solution but it is not perfect, loop the array object generated by serializeArray, use $.extend to merge them in one object. is there a better method? kindly help, thanks.

  Read the article

• Wordpress Custom Type permalink containing Taxonomy slug

  - by treznik

  I'm trying to create a permalink pattern for a Custom Type, that includes one of its taxonomies. The taxonomy name is known from the start (so I'm not trying to add or mix all of its taxonomies, just a specific one), but the value will by dynamic, of course. Normally, the Custom Type permalink is built using the rewrite arg with the slug param, but I don't see how I could add a dynamic variable in there. http://codex.wordpress.org/Function_Reference/register_post_type I'm guessing a custom solution is required, but I'm not sure what the best unintrusive approach would be. Is there a known practice for this or has anyone built something similar recently? I'm using WP 3.2.1 btw.

  Read the article

• Symfony on virtual host (document root problem)

  - by Martin Sikora

  Hello, I'm developing an application in Symfony and on localhost (XAMPP) I want to simulate the same conditions as on the webserver. The web server is configured as follows: /www => mydomain.com /foo => foo.mydomain.com /bar => bar.mydomain.com ... I'm going to put my Symfony application into /www direcotry so there'll be: /www /www/apps /www/apps/frontend /www/apps/frontend/... /www/apps/backend /www/apps/backend/... /www/cache /www/config ... and so on... /www/web The thing is that the document root is still set to the /www directory but Symfony expects it in the /www/web. Of course it will work if I call http://mydomain.com/web but I guess you understand this is quiet stupid solution. So my question is: Is there any way how can I change/bypass the default document root setting using .htaccess or whatever?

  Read the article

• web-development: how do you usually handle the "under costruction" page"?

  - by Patrick

  hi, I was wondering what's the best way to switch a website to a temporary "under costruction" page and switch it back to the new version. For example, in a website, my customer decided to switch from Joomla to Drupal and I had to create a subfolder for the new CMS, and then move all the content to the root folder. 1) Moving all the content back to the root folder always create some problems with file permissions, links, etc... 2) Creating a rewrite rule in .htaccess or forward with php is not a solution because another url is shown including the top folder. 3) Many host services do not allow to change the root directory, so this is not an option since I don't have access to apache config file. Thanks

  Read the article

• best method in jquery for replacing rows in a table after server side processing such as mysql sorti

  - by Kevin J

  What is the 'best practice' when returning dynamic data for a table (server side sorting, filtering etc from a db) ? Do you return just the data in json, and repeatedly clone a row element, replacing the values in each row (thus decreasing the size of the ajax call, but increasing the client side processing), or return the full html, and replace with .html or .append? Or is there another method I'm missing? This is a frequent situation in my app, and in some cases a bottleneck, and I am unsure if what I am doing is the best solution. Currently, I return the row html and use a single .append call, after emptying all the rows except the header.

  Read the article

• Is it possible to exclude folders from a web application project in vs 2010?

  - by JL

  I had previously asked this question. At the time I was working with VS 2008. To restate the question. I have a web application that generates 1000's of small xml files in a certain directory. I would like to exclude this directory from the web application project in visual studio 2010. With vs 2008 it was not possible. Has anything changed? Besides the general wait for VS to iterate through this directory and add an item in the solution explorer for each file, it also strains my system resources, so I would like to exclude it from the project, but the dir and files need to physically exist on disk, because they are part of the application. Any OOB VS 2010 solutions, or any good workarounds? Thanks Update: This also sums up the issue nicely http://forums.asp.net/t/1179077.aspx

  Read the article

• Question in Flex (parser)

  - by shkk

  Hello... I want to ask you a question about Flex, the program for parsing code. Supposing I have an instruction like this one, in the rules part: "=" BEGIN(attribution); <attribution>{var_name} { fprintf(yyout, "="); ECHO; } <attribution>";" BEGIN(INITIAL); {var_name} is a regular expression that matches a variable's name, and all I want to do is to copy at the output all the attribution instructions, such as a = 3; or b = a; My rule though cannot write with fprintf the left member of the attribution, but only = 3; or =a; One solution for that might be that, after I make the match "=" and I am in the attribution state, to go 2 positions back as to get the left operand as well. How can I do that in Flex?

  Read the article

• lookup datasource in context every time, Is it right?

  - by Srikanth Dyapa

  In my application i configured more than one datasource (for diff databases). Whenever user sends a request depends upon user category i need to look up for the respective datasource in the context and get a connection from that datasource to execute queries which are assigned to that user. Is it right way to achieve my requirement? I am using tomcat 6, struts 1.3. The databases may be oracle or mysql or both. Give me an optimized solution. Thanks in advance.

  Read the article

• Using "as" and expecting a null return

  - by DrLazer

  For example. Lets say we have a stackpanel on a form. Its full of both Grids and Labels. I want to loop through all the Grids and do some operation on them but leave the Lables intact. At the moment I am doing it this way. foreach(UIElement element in m_stacker.Children) { Grid block = element as Grid; if(block != null) { //apply changes here } } So i'm using the fact that "as" returns null if it cannot cast into the required type. Is this an ok thing to do or is there a better solution to this problem?

  Read the article

• JQuery get element from a string problem

  - by SLC

  Sorry for such a simple question but I can't seem to find the solution. I am trying to fade in and out some divs. Divs have an ID of "div1", "div2", "div3". My code is: var Divs = new Array("div1", "div2", "div3"); I want to fade out one div and then fade in the next on top of it. I have a setinterval that runs every 5 seconds and checked it works. Inside it is this code: $(Divs[1]).fadeOut(1000); $(Divs[2]).fadeIn(1000); However nothing happens when the timer method is ran. Any ideas?

  Read the article

• How should I make up for the lack of static initializers in PHP?

  - by kahoon

  I'm thinking about putting every class into a separate file and doing the static initialization outside of the class definition. The problem with this is the fact that the initialization will happen before the said class is actually needed (it will happen when the file which contains the class is included for the first time). It's a problem, because it may happen that the class won't be used at all, hence the initialization is unnecessary. And I think the practice of including the used files not in the beginning of your code is simply a dirty technique. If anybody has a viable solution to this problem, I would greatly appreciate it.

  Read the article

• Interesting XSL Dilemma

  - by bobber205

  I've got this issue. A template called "checkbox" that's called from while inside a table HTML element and also outside of it. To solve an issue, I've added tags to "checkbox" input control. Here's what I'd like to do to but I'm not sure if it's possible or not. When I hit my "row" (part of the custom table markup) template, I would set some variable or pass some parameter, that for each template applied afterwards, would know it was in a "row" and do something special based on this information. I know I can't add parameters to apply-templates. I may be able to add a row "mode" but I can't make changes to each template and have one copy with the mod parameter and one without. Thanks for any suggestions. I know the ideal solution would to be to make changes to the XML but I'm not sure if I can do that as this point. That's a "content" issue. :P Thanks!

  Read the article

• Best way to integrate searching with pagination

  - by Vijay Choudhary

  I have a web application build on cakephp 2.x. I have integrated pagination on my data. Now i want to implement searching on that data also, and pagination should work according to search result. Now my question is: Should i use a form to post my search string. If so, then which method should i use, GET or POST. OR, should i use javascript window.location method, and append the search string to it. If we use this method then search string can append more than once to url. Or any other best way to implement this. Can anybody give the best solution for this as it is a common task for each application to have.

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Merging $.get and $.ready

  - by cwolves

  Put simply I have an ajax call that sometimes completes before the page is loaded, so I tried wrapping the callback in $( fn ), but the callback doesn't fire if the page is loaded... Anyone have a good solution to this? $.get( '/foo.json', function( data ){ $( function(){ // won't get here if page ready beats the ajax call // process data $( '.someDiv' ).append( someData ); } ); } ); And yes, I know that if I flipped the order of those it would always work, but then my ajax calls would be needlessly deferred until the document is ready.

  Read the article

< Previous Page | 752 753 754 755 756 757 758 759 760 761 762 763  | Next Page >