Search Results

Search found 20946 results on 838 pages for 'at command'.

Page 758/838 | < Previous Page | 754 755 756 757 758 759 760 761 762 763 764 765  | Next Page >

• "One or more breakpoints cannot be set and have been disabled. Execution will stop at the beginning

  - by sam

  I set a breakpoint in my code in Visual-C++, but when I run, I see the error mentioned in the title. I know this question has been asked before on Stack Overflow (http://stackoverflow.com/questions/657470/breakpoints-cannot-be-set-and-have-been-disabled-problem), but none of the answers there fully explained the problem I'm seeing. The closest I can see is something about the linker, but I don't understand that - so if someone could explain in more detail that would be great. In my case, I have 2 projects in Visual C++ - the production dsw, and the test code dsw. I have loaded and rebuilt both dsws in debug mode. I want a breakpoint in the production code, which is run via the test scripts. My issue is I get the error message when I run the test code, because the break point is in the production code, which isn't loaded up when the test starts. Near the beginning of the test script there is a mytest_initialize() command. I imagine this goes off and loads up the production dll. Once this line has executed, I can put the breakpoint in my production code and run until I hit it. But it's quite annoying to have to run to this line, set the breakpoint and continue every time I want to run the test. So I think the problem is Visual C++ doesn't realise the two projects are related. Is this a linker issue? What does the linker do and what settings should I change to make this work? Thanks in advance. Apologies if instead I should be appending this question to the existing one, this is my first post so not quite sure how this should work.

  Read the article

• UnicodeEncodeError: 'ascii' codec can't encode character [...]

  - by user1461135

  I have read the HOWTO on Unicode from the official docs and a full, very detailed article as well. Still I don't get it why it throws me this error. Here is what I attempt: I open an XML file that contains chars out of ASCII range (but inside allowed XML range). I do that with cfg = codecs.open(filename, encoding='utf-8, mode='r') which runs fine. Looking at the string with repr() also shows me a unicode string. Now I go ahead and read that with parseString(cfg.read().encode('utf-8'). Of course, my XML file starts with this: <?xml version="1.0" encoding="utf-8"?>. Although I suppose it is not relevant, I also defined utf-8 for my python script, but since I am not writing unicode characters directly in it, this should not apply here. Same for the following line: from __future__ import unicode_literals which also is right at the beginning. Next thing I pass the generated Object to my own class where I read tags into variables like this: xmldata.getElementsByTagName(tagName)[0].firstChild.data and assign it to a variable in my class. Now what perfectly works are those commands (obj is an instance of the class): for element in obj: print element And this command does work as well: print obj.__repr__() I defined __iter__() to just yield every variable while __repr__() uses the typical printf stuff: "%s" % self.varname Both commands print perfectly and can output the unicode character. What does not work is this: print obj And now I am stuck because this throws the dreaded UnicodeEncodeError: 'ascii' codec can't encode character u'\xfc' in position 47: So what am I missing? What am I doing wrong? I am looking for a general solution, I always want to handle strings as unicode, just to avoid any possible errors and write a compatible program. Edit: I also defined this: def __str__(self): return self.__repr__() def __unicode__(self): return self.__repr__() From documentation I got that this

  Read the article

• Creating a cocoa Application without nib files/fully pragmatic

  - by Moddy

  Yes, I know this goes against the whole MVC principle! However, I'm just trying to whip up a pretty trivial application - and I've pretty much implemented it pragmatically. However, I have a problem... I create an Empty Project, copy all the frameworks over and set the build settings - and I get errors about the executable.. or lack of executable. The build settings all appear fine, but it tells me there is no executable - it will build + run fine.. however it doesn't run. There is no error either - it just appears to run very fast and cleanly! Unless I try and run gdb which politely tells me I need to give it a file first.. Running… No executable file specified. Use the "file" or "exec-file" command. So I created a Cocoa Application, removed all the stuff I didn't need (i.e the MainMenu.xib file..) and now I can compile my code perfectly.. however it dies with complaining that its "Unable to load nib file: MainMenu, exiting" I have gone through the Project Symbols and see that the code actually relies upon the nib file heavily, even if you don't touch it code-wise. (MVC again I guess..) So my question is - is there a simple way to compile just what you code, no added nib files, just the code you write and the frameworks you add? I assume it would be a blank project but my experience tells me otherwise?!

  Read the article

• ISBNs are used as primary key, now I want to add non-book things to the DB - should I migrate to EAN

  - by fish2000

  I built an inventory database where ISBN numbers are the primary keys for the items. This worked great for a while as the items were books. Now I want to add non-books. some of the non-books have EANs or ISSNs, some do not. It's in PostgreSQL with django apps for the frontend and JSON api, plus a few supporting python command-line tools for management. the items in question are mostly books and artist prints, some of which are self-published. What is nice about using ISBNs as primary keys is that in on top of relational integrity, you get lots of handy utilities for validating ISBNs, automatically looking up missing or additional information on the book items, etcetera, many of which I've taken advantage. some such tools are off-the-shelf (PyISBN, PyAWS etc) and some are hand-rolled -- I tried to keep all of these parts nice and decoupled, but you know how things can get. I couldn't find anything online about 'private ISBNs' or 'self-assigned ISBNs' but that's the sort of thing I was interested in doing. I doubt that's what I'll settle on, since there is already an apparent run on ISBN numbers. should I retool everything for EAN numbers, or migrate off ISBNs as primary keys in general? if anyone has any experience with working with these systems, I'd love to hear about it, your advice is most welcome.

  Read the article

• Php script running as scheduled task hangs - help!

  - by Ali

  Hi guys, I've built a php script that runs from the command line. It opens a connection into a pop3 email account and downloads all the emails and writes them to a database, and deletes them once downloaded. I have this script being called from the commandline by a bat file. in turn I have created a scheduled task which invokes the bat file every 5 minutes. The thing is that I have set the time out to zero for the fact that at times there could be emails with large attachments and the script actually downloads the attachments and stores them as raw files offline and the no timeout is so that the script doesnt die out during downloading. I've found that the program hangs sometimes and its a bit annoying at that - it always hangs are one point i.e. when negotiating the connection and getting connected to the mail server. And because the timeout is set to zero it seems to stay stuck up in taht position. And because of that the task is not run as its technically hung up. I want that the program should not timeout when downloading emails - however at the points where it is negotiating a connection or trying to connect to the mailserver there should be a timeout only at that point itself and not the rest of the program execution. How do I do this :(

  Read the article

• start-stop-daemon quoted arguments misinterpreted

  - by Martin Westin

  Hi, I have been trying to make an init script using start-stop-daemon. I am stuck on the arguments to the daemon. I want to keep these in a variable at the top of the script but I can't get the quotations to filter down correctly. I'll use ls here so we don't have to look at binaries and arguments that most people wont know or care about. The end result I am looking for is for start-stop... to run ls -la "/folder with space/" DAEMON=/usr/bin/ls DAEMON_OPTS='-la "/folder with space/"' start-stop-daemon --start --make-pidfile --pidfile $PID --exec $DAEMON -- $DAEMON_OPTS Double escaping the options and trying innumerable variations of quotations do not help... Then they end up at the daemon they are always messed up. Enclosing $DAEMON_OPTS in quotes changes things... then they are seen as one since quote... never the right number though :) Echoing the command-line (start-stop...) prints exactly the right stuff to screen. But the daemon (the real one, not ls) complains about the wrong number of arguments. How do I specify a variable so that quotes inside it are brought along to the daemon correctly? Thanks, Martin

  Read the article

• Perl: remove relative path components but leave symlinks alone?

  - by jnylen

  I need to get Perl to remove relative path components from a Linux path. I've found a couple of functions that almost do what I want, but: File::Spec->rel2abs does too little. It does not resolve ".." into a directory properly. Cwd::realpath does too much. It resolves all symbolic links in the path, which I do not want. Perhaps the best way to illustrate how I want this function to behave is to post a bash log where FixPath is a hypothetical command that gives the desired output: '/tmp/test'$ mkdir -p a/b/c1 a/b/c2 '/tmp/test'$ cd a '/tmp/test/a'$ ln -s b link '/tmp/test/a'$ ls b link '/tmp/test/a'$ cd b '/tmp/test/a/b'$ ls c1 c2 '/tmp/test/a/b'$ FixPath . # rel2abs works here ===> /tmp/test/a/b '/tmp/test/a/b'$ FixPath .. # realpath works here ===> /tmp/test/a '/tmp/test/a/b'$ FixPath c1 # rel2abs works here ===> /tmp/test/a/b/c1 '/tmp/test/a/b'$ FixPath ../b # realpath works here ===> /tmp/test/a/b '/tmp/test/a/b'$ FixPath ../link/c1 # neither one works here ===> /tmp/test/a/link/c1 '/tmp/test/a/b'$ FixPath missing # should work for nonexistent files ===> /tmp/test/a/b/missing

  Read the article

• curl cookie not creating on success

  - by Bin

  Hi I'm using cUrl(PHP) to post a login request and store response in cookie file. In my second request I'm passing cookie in header and post data to verify it. Issue is that cookie file is not created in first succesful request results in failure for second request. Please suggest me where I'm doing wrong. $cookiefile="/var/www/html/dimdim/cook.txt"; $url_log="http://my.dimdim.com/api/auth/login"; $p_log='request={"account":"bin6k","password":"password","group":"all"}'; $url_ver="http://my.dimdim.com/api/auth/verify"; $p_ver='request={"account":"bin6k","password":"password","group":"all"}'; $ch = curl_init(); //curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1); curl_setopt($ch, CURLOPT_COOKIEJAR, $cookiefile); curl_setopt($ch, CURLOPT_URL,$url_log); curl_setopt($ch, CURLOPT_POST, 1); curl_setopt($ch, CURLOPT_POSTFIELDS, $p_log); ob_start(); // prevent any output $retval=curl_exec ($ch); // execute the curl command ob_end_clean(); // stop preventing output curl_close ($ch); //print_r($retval); unset($ch); $ch = curl_init(); curl_setopt($ch, CURLOPT_RETURNTRANSFER,1); curl_setopt($ch, CURLOPT_COOKIEFILE, $cookiefile); curl_setopt($ch, CURLOPT_URL,$url_ver); curl_setopt($ch, CURLOPT_POST, 1); curl_setopt($ch, CURLOPT_POSTFIELDS, $p_log); $buf2 = curl_exec ($ch); curl_close ($ch); echo "".htmlentities($buf2);

  Read the article

• How can I run Ruby specs and/or tests in MacVim without locking up MacVim?

  - by Henry

  About 6 months ago I switched from TextMate to MacVim for all of my development work, which primarily consists of coding in Ruby, Ruby on Rails and JavaScript. With TextMate, whenever I needed to run a spec or a test, I could just command+R on the test or spec file and another window would open and the results would be displayed with the 'pretty' format applied. If the spec or test was a lengthy one, I could just continue working with the codebase since the test/spec was running in a separate process/window. After the test ran, I could click through the results directly to the corresponding line in the spec file. Tim Pope's excellent rails.vim plugin comes very close to emulating this behavior within the MacVim environment. Running :Rake when the current buffer is a test or spec runs the file then splits the buffer to display the results. You can navigate through the results and key through to the corresponding spot in the file. The problem with the rails.vim approach is that it locks up the MacVim window while the test runs. This can be an issue with big apps that might have a lot of setup/teardown built into the tests. Also, the visual red/green html results that TextMate displays (via --format pretty, I'm assuming) is a bit easier to scan than the split window. This guy came close about 18 mos ago: http://cassiomarques.wordpress.com/2009/01/09/running-rspec-files-from-vim-showing-the-results-in-firefox/ The script he has worked with a bit of hacking, but the tests still ran within MacVim and locked up the current window. Any ideas on how to fully replicate the TextMate behavior described above in MacVim? Thanks!

  Read the article

• PHP curl timing mismatch

  - by JonoB

  I am running a php script that: queries a local database to retrieve an amount executes a curl statement to update an external database with the above amount + x queries the local database again to insert a new row reflecting that the curl statement has been executed. One of the problems that I am having is that the curl statement takes 2-4 seconds to execute, so I have two different users from the same company running the same script at the same time, the execution time of the curl command can cause a mismatch in what should be updated in the external database. This is the because the curl statement has not yet returned from the first user...so the second user is working off incorrect figures. I am not sure of the best options here, but basically I need to prevent two or more curl statements being run at the same time. I thought of storing a value in the database that indicates that the curl statement is being executed at that time, and prevent any other curl statements being run until its completed. Once the first curl statement has been executed, then the database flag is updated and the next one can run. If this field is 'locked', then I could loop through the code and sleep for (5) seconds, and then check again if the flag has been reset. If after (3) loops, then reset the flag automatically (i've never seen the curl take longer than 5 seconds) and continue processing. Are there any other (more elegant) ways of approaching this?

  Read the article

• Ant telnet is hanging on a simple task

  - by Sagar

  <?xml version="1.0" ?> <project name="test" default="root"> <target name="telnet"> <telnet server="10.1.1.1"> <read>login:</read> <write>root</write> <read>password:</read> <write>${PASSWORD}</write> <read>#</read> <write>ls</write> <read>#</read> </telnet> </target> </project> That is the code I have in a build.xml file. When I run ant (version 1.8, in bash) (I have downloaded and copied over the jars for commons-net-2.0 and jakarta-oro-2.0.8 already), this is the output I get: Buildfile: /home/sagar/build.xml telnet: and then it just sits there. When I do a "who" on my server, I can see "System" waiting on login. But there is no progress after this. I can telnet into the server using normal telnet means (putty, bash, etc). I even tried the full telnet command instead of read/write: <telnet server="10.1.1.1" userid="root" password="root"> Any help is much appreciated! Note: JRE 1.5, Ant 1.8, commons-net version 2.0, jakarta version 2.0.8

  Read the article

• How to tie a Hudson job to a user who has access to run MSIExec

  - by Andrew

  Hi All, I have a batch file that calls "MSIExec /X {MyGUID} /qn". This runs successfully when run with my admin user. When I run it as a Window Batch command from a Hudson job it fails with "T?h?e? ?i?n?s?t?a?l?l?a?t?i?o?n? ?s?o?u?r?c?e? ?f?o?r? ?t?h?i?s? ?p?r?o?d?u?c?t? ?i?s? ?n?o?t? ?a?v?a?i?l?a?b?l?e?.? ? ?V?e?r?i?f?y? ?t?h?a?t? ?t?h?e? ?s?o?u?r?c?e? ?e?x?i?s?t?s? ?a?n?d? ?t?h?a?t? ?y?o?u? ?c?a?n? ?a?c?c?e?s?s? ?i?t?.? " I am inclined to think that the issue is that the job is started by the "anonymous" user rather than my admin user. How in hudson do I "tie" the job to be run under the admin user? Thanks in advance. Regards, Andrew

  Read the article

• Python 3, urllib ... Reset Connection Possible?

  - by Rhys

  In the larger scale of my program the goal of the below code is to filter out all dynamic html in a web-page source code code snippet: try: deepreq3 = urllib.request.Request(deepurl3) deepreq3.add_header("User-Agent","etc......") deepdata3 = urllib.request.urlopen(deepurl3).read().decode("utf8", 'ignore') The following code is looped 3 times in order to identify whether the target web-page is Dynamic (source code is changed at intervals) or not. If the page IS dynamic, the above code loops another 15 times and attempts to filter out the dynamic content. QUESTION: While this filtering method works 80% of the time, some pages will reload ALL 15 times and STILL contain dynamic code. HOWEVER. If I manually close down the Python Shell and re-execute my program, the dynamic html that my 'refresh-page method' could not shake off is no longer there ... it's been replaced with new dynamic html that my 'refresh-page method' cannot shake off. So I need to know, what is going on here? How is re-running my program causing the dynamic content of a page to change. AND, is there any way, any 'reset connection' command I can use to recreate this ... without manually restarting my app. Thanks for your response.

  Read the article

• How to get a list of all Subversion commit author usernames?

  - by Quinn Taylor

  I'm looking for an efficient way to get the list of unique commit authors for an SVN repository as a whole, or for a given resource path. I haven't been able to find an SVN command specifically for this (and don't expect one) but I'm hoping there may be a better way that what I've tried so far in Terminal (on OS X): svn log --quiet | grep "^r" | awk '{print $3}' svn log --quiet --xml | grep author | sed -E "s:</?author>::g" Either of these will give me one author name per line, but they both require filtering out a fair amount of extra information. They also don't handle duplicates of the same author name, so for lots of commits by few authors, there's tons of redundancy flowing over the wire. More often than not I just want to see the unique author usernames. (It actually might be handy to infer the commit count for each author on occasion, but even in these cases it would be better if the aggregated data were sent across instead.) I'm generally working with client-only access, so svnadmin commands are less useful, but if necessary, I might be able to ask a special favor of the repository admin if strictly necessary or much more efficient. The repositories I'm working with have tens of thousands of commits and many active users, and I don't want to inconvenience anyone.

  Read the article

• How can I make keyword order more relevant in my search?

  - by Atomiton

  In my database, I have a keywords field that stores a comma-delimited list of keywords. For example, a Shrek doll might have the following keywords: ogre, green, plush, hero, boys' toys A "Beanie Baby" doll ( that happens to be an ogre ) might have: beanie baby, kids toys, beanbag toys, soft, infant, ogre (That's a completely contrived example.) What I'd like to do is if the consumer searches for "ogre" I'd like the "Shrek" doll to come up higher in the search results. My content administrator feels that if the keyword is earlier in the list, it should get a higher ranking. ( This makes sense to me and it makes it easy for me to let them control the search result relevance ). Here's a simplified query: SELECT p.ProductID AS ContentID , p.ProductName AS Title , p.ProductCode AS Subtitle , 100 AS Rank , p.ProductKeywords AS Keywords FROM Products AS p WHERE FREETEXT( p.ProductKeywords, @SearchPredicate ) I'm thinking something along the lines of replacing the RANK with: , 200 - INDEXOF(@SearchTerm) AS Rank This "should" rank the keyword results by their relevance I know INDEXOF isn't a SQL command... but it's something LIKE that I would like to accomplish. Am I approaching this the right way? Is it possible to do something like this? Does this make sense?

  Read the article

• Problems installing PIL after OSX 10.9

  - by user2632417

  I installed Mac OSX 10.9 the day it came out. Afterwards I decided I needed to install PIL. I'd installed it before, but it appeared the update had broken that. When I try to use pip to install PIL, it fails when building _imaging. It appears the root cause is this. /usr/include/sys/cdefs.h:655:2: error: Unsupported architecture Theres also a similar error here: /usr/include/machine/limits.h:8:2: error: architecture not supported and here: /usr/include/machine/_types.h:34:2: error: architecture not supported Then there's a whole list of missing types. /usr/include/sys/_types.h:94:9: error: unknown type name '__int64_t' typedef __int64_t __darwin_blkcnt_t; /* total blocks */ ^ /usr/include/sys/_types.h:95:9: error: unknown type name '__int32_t' typedef __int32_t __darwin_blksize_t; /* preferred block size */ ^ /usr/include/sys/_types.h:96:9: error: unknown type name '__int32_t' typedef __int32_t __darwin_dev_t; /* dev_t */ ^ /usr/include/sys/_types.h:99:9: error: unknown type name '__uint32_t' typedef __uint32_t __darwin_gid_t; /* [???] process and group IDs */ ^ /usr/include/sys/_types.h:100:9: error: unknown type name '__uint32_t' typedef __uint32_t __darwin_id_t; /* [XSI] pid_t, uid_t, or gid_t*/ ^ /usr/include/sys/_types.h:101:9: error: unknown type name '__uint64_t' typedef __uint64_t __darwin_ino64_t; /* [???] Used for 64 bit inodes */ Needless to say I don't know where to go from here. I've got a couple of guesses, but I don't even know how to check. Wrong include probably as a result of a badly configured environment variable Problem with Xcode's installation/ missing command line tools Messed up header files If anyone has any suggestions either to check one of those possibilities or for one of their own I'm all ears.

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• Core Data: migrating entities with self-referential properties

  - by Dan

  My Core Data model contains an entity, Shape, that has two self-referential relationships, which means four properties. One pair is a one-to-many relationship (Shape.containedBy <- Shape.contains) and the another is a many-to-many relationship (Shape.nextShapes <<- Shape.previousShapes). It all works perfectly in the application, so I don't think self-referencing relationships is a problem in general. However, when it comes to migrating the model to a new version, then Xcode fails to compile the automatically generated mapping model, with this error message: 2009-10-30 17:10:09.387 mapc[18619:607] *** Terminating app due to uncaught exception 'NSInvalidArgumentException', reason: 'Unable to parse the format string "FUNCTION($manager ,'destinationInstancesForSourceRelationshipNamed:sourceInstances:' , 'contains' , $source.contains) == 1"' *** Call stack at first throw: ( 0 CoreFoundation 0x00007fff80d735a4 __exceptionPreprocess + 180 1 libobjc.A.dylib 0x00007fff83f0a313 objc_exception_throw + 45 2 Foundation 0x00007fff819bc8d4 _qfqp2_performParsing + 8412 3 Foundation 0x00007fff819ba79d +[NSPredicate predicateWithFormat:arguments:] + 59 4 Foundation 0x00007fff81a482ef +[NSExpression expressionWithFormat:arguments:] + 68 5 Foundation 0x00007fff81a48843 +[NSExpression expressionWithFormat:] + 155 6 XDBase 0x0000000100038e94 -[XDDevRelationshipMapping valueExpressionAsString] + 260 7 XDBase 0x000000010003ae5c -[XDMappingCompilerSupport generateCompileResultForMappingModel:] + 2828 8 XDBase 0x000000010003b135 -[XDMappingCompilerSupport compileSourcePath:options:] + 309 9 mapc 0x0000000100001a1c 0x0 + 4294973980 10 mapc 0x0000000100001794 0x0 + 4294973332 ) terminate called after throwing an instance of 'NSException' Command /Developer/usr/bin/mapc failed with exit code 6 The 'contains' is the name of one of the self-referential properties. Anyway, the really big problem is that I can't even look at this Mapping Property as Xcode crashes as soon as I select the entity mapping when viewing the mapping model. So I'm a bit lost really where to go from here. I really can't remove the self-referential properties, so I'm thinking I've got manually create a mapping model that compiles? Any ideas? Cheers

  Read the article

• Checkstyle not working

  - by user330060

  Hi, I am new to maven and chekstyle, so need to ask some question... I want to use checkstyle in my maven based project, so in my pom.xml I have add the dependency <dependency> <groupId>checkstyle</groupId> <artifactId>checkstyle</artifactId> <version>2.4</version> </dependency> and also I have added the entry in plugin tag: <plugin> <groupId>org.apache.maven.plugins</groupId> <artifactId>maven-checkstyle-plugin</artifactId> <version>2.4</version> <configuration> <enableRulesSummary>true</enableRulesSummary> <configLocation>checkstyle.xml</configLocation> </configuration> </plugin> But when I run my maven build with command mvn clean install, checkstyle doesn't do anything. And as I dont have any checkstyle.xml in my system yet, shouldn't it complains me about the error? What else configuration am I missing?

  Read the article

• Problem in Building mplsh-run in lshkit

  - by Yijinsei

  Hi guy, been trying out this for quite some time but I'm still unable to built mplsh-run from lshkit Not sure if this would help to explain my situation during the building process /tmp/cc17kth4.o: In function `lshkit::MultiProbeLshRecallTable::reset(lshkit::MultiProbeLshModel, unsigned int, double, double)': mplsh-run.cpp:(.text._ZN6lshkit24MultiProbeLshRecallTable5resetENS_18MultiProbeLshModelEjdd[lshkit::MultiProbeLshRecallTable::reset(lshkit::MultiProbeLshModel, unsigned int, double, double)]+0x230): undefined reference to `lshkit::MultiProbeLshModel::recall(double) const' /tmp/cc17kth4.o: In function `void lshkit::MultiProbeLshIndex<unsigned int>::query_recall<lshkit::TopkScanner<lshkit::Matrix<float>::Accessor, lshkit::metric::l2sqr<float> > >(float const*, float, lshkit::TopkScanner<lshkit::Matrix<float>::Accessor, lshkit::metric::l2sqr<float> >&) const': mplsh-run.cpp:(.text._ZNK6lshkit18MultiProbeLshIndexIjE12query_recallINS_11TopkScannerINS_6MatrixIfE8AccessorENS_6metric5l2sqrIfEEEEEEvPKffRT_[void lshkit::MultiProbeLshIndex<unsigned int>::query_recall<lshkit::TopkScanner<lshkit::Matrix<float>::Accessor, lshkit::metric::l2sqr<float> > >(float const*, float, lshkit::TopkScanner<lshkit::Matrix<float>::Accessor, lshkit::metric::l2sqr<float> >&) const]+0x2c4): undefined reference to `lshkit::MultiProbeLsh::genProbeSequence(float const*, std::vector<unsigned int, std::allocator<unsigned int> >&, unsigned int) const' /tmp/cc17kth4.o: In function `void lshkit::MultiProbeLshIndex<unsigned int>::query<lshkit::TopkScanner<lshkit::Matrix<float>::Accessor, lshkit::metric::l2sqr<float> > >(float const*, unsigned int, lshkit::TopkScanner<lshkit::Matrix<float>::Accessor, lshkit::metric::l2sqr<float> >&)': mplsh-run.cpp:(.text._ZN6lshkit18MultiProbeLshIndexIjE5queryINS_11TopkScannerINS_6MatrixIfE8AccessorENS_6metric5l2sqrIfEEEEEEvPKfjRT_[void lshkit::MultiProbeLshIndex<unsigned int>::query<lshkit::TopkScanner<lshkit::Matrix<float>::Accessor, lshkit::metric::l2sqr<float> > >(float const*, unsigned int, lshkit::TopkScanner<lshkit::Matrix<float>::Accessor, lshkit::metric::l2sqr<float> >&)]+0x4a): undefined reference to `lshkit::MultiProbeLsh::genProbeSequence(float const*, std::vector<unsigned int, std::allocator<unsigned int> >&, unsigned int) const' collect2: ld returned 1 exit status the command that i used to built mplsh-run is g++ -I./lshkit/include -L/usr/lib -lm -lgsl -lgslcblas -lboost_program_options-mt mplsh-run.cpp Do you guys have any clue on how I could solve this?

  Read the article

• Low Level Console Input

  - by Soulseekah

  I'm trying to send commands to to the input of a cmd.exe application using the low level read/write console functions. I have no trouble reading the text (scraping) using the ReadConsole...() and WriteConsole() functions after having attached to the process console, but I've not figured out how to write for example "dir" and have the console interpret it as a sent command. Here's a bit of my code: CreateProcess(NULL, "cmd.exe", NULL, NULL, FALSE, CREATE_NEW_CONSOLE, NULL, NULL, &si, &pi); AttachConsole(pi.dwProcessId); strcpy(buffer, "dir"); WriteConsole(GetStdHandle(STD_INPUT_HANDLE), buffer, strlen(buffer), &charRead, NULL); STARTUPINFO attributes of the process are all set to zero, except, of course, the .cb attribute. Nothing changes on the screen, however I'm getting an Error 6: Invalid Handle returned from WriteConsole to STD_INPUT_HANDLE. If I write to (STD_OUTPUT_HANDLE) I do get my dir written on the screen, but nothing of course happens. I'm guessing SetConsoleMode() might be of help, but I've tried many mode combinations, nothing helped. I've also created a quick console application that waits for input (scanf()) and echoes back whatever goes in, didn't work. I've also tried typing into the scanf() promp and then peek into the input buffer using PeekConsoleInput(), returns 0, but the INPUT_RECORD array is empty. I'm aware that there is another way around this using WriteConsoleInput() to directly inject INPUT_RECORD structured events into the console, but this would be way too long, I'll have to send each keypress into it. I hope the question is clear. Please let me know if you need any further information. Thanks for your help.

  Read the article

• Cursor returns zero rows from query to table

  - by brockoli

  I've created an SQLiteDatabase in my app and populated it with some data. I can connect to my AVD with a terminal and when I issue select * from articles; I get a list of all the rows in my table and everything looks fine. However, in my code when I query my table, I get a cursor back that has my tables columns, but zero rows of data. Here is my code.. mDbHelper.open(); Cursor articles = mDbHelper.fetchAllArticles(); startManagingCursor(articles); Cursor feeds = mDbHelper.fetchAllFeeds(); startManagingCursor(feeds); mDbHelper.close(); int titleColumn = articles.getColumnIndex("title"); int feedIdColumn = articles.getColumnIndex("feed_id"); int feedTitleColumn = feeds.getColumnIndex("title"); /* Check if our result was valid. */ if (articles != null) { int count = articles.getCount(); /* Check if at least one Result was returned. */ if (articles.moveToFirst()) { In the above code, my Cursor articles returns with my 4 columns, but when I call getCount() it returns zero, even though I can see hundreds of rows of data in that table from command line. Any idea what I might be doing wrong here? Also.. here is my code for fetchAllArticles.. public Cursor fetchAllArticles() { return mDb.query(ARTICLES_TABLE, new String[] {ARTICLE_KEY_ROWID, ARTICLE_KEY_FEED_ID, ARTICLE_KEY_TITLE, ARTICLE_KEY_URL}, null, null, null, null, null); } Rob W.

  Read the article

• Garbled text when constructing emails with vmime

  - by Klaus Fiedler

  Hey, my Qt C++ program has a part where it needs to send the first 128 characters or so of the output of a bash command to an email address. The output from the tty is captured in a text box in my gui called textEdit_displayOutput and put into my message I built using the Message Builder ( the object m_vmMessage ) Here is the relevant code snippet: m_vmMessage.getTextPart()->setCharset( vmime::charsets::US_ASCII ); m_vmMessage.getTextPart()->setText( vmime::create < vmime::stringContentHandler > ( ui->textEdit_displayOutput->toPlainText().toStdString() ) ); vmime::ref < vmime::message > msg = m_vmMessage.construct(); vmime::utility::outputStreamAdapter out( std::cout ); msg->generate( out ); Giving bash 'ls /' and a newline makes vmime give terminal output like this: ls /=0Abin etc=09 initrd.img.old mnt=09 sbin=09 tmp=09 vmlinuz.o= ld=0Aboot farts=09 lib=09=09 opt=09 selinux usr=0Acdrom home=09 = lost+found=09 proc srv=09 var=0Adev initrd.img media=09 root = Whereas it should look more like this: ls / bin etc initrd.img.old mnt sbin tmp vmlinuz.old boot farts lib opt selinux usr cdrom home lost+found proc srv var dev initrd.img media root sys vmlinuz 18:22> How do I encode the email properly? Does vmime just display it like that on purpose and the actual content of the email is ok?

  Read the article

• jQuery Hover Panes Flickering on child

  - by Dirge2000

  OK. Here's my basic HTML structure: <ul class="tabNavigation"> <li> <a href="#">Main Button</a> <div class="hoverTab"> <a href="#">Link Within Div</a> </div> </li> </ul> And here's my jQuery command: $('ul.tabNavigation li').mouseenter(function() { $('ul.tabNavigation div.hoverTab').hide(); $(this).children('div.hoverTab').stop(false, true).fadeIn('fast'); }); $('ul.tabNavigation li').mouseleave(function() { $('ul.tabNavigation div.hoverTab').hide(); $(this).children('div.hoverTab').stop(false, true).show().fadeOut('fast'); }); When you mouseenter/mouseleave the LI, the child div is supposed to appear/disappear, but the problem is the A tag within the hoverTab div causes the tab to flicker - as if, by rolling over the link, the mouse has left the LI... Any suggestions?

  Read the article

• Eclipse PDT "tips" ?

  - by Pascal MARTIN

  Hi ! (Yes, this is a quite opened and general and subjective question -- it's by design, cause I want tips you think are great !) I'm using Eclipse PDT 2.1 to work in PHP, either for small and/or big projects -- I've been doing so for quite some times, now, actually (since before 1.0 stable, if I remember well)... I was wondering if any of you did know "tips" to be more efficient. Let met explain more in details : I know about things like plugins like Aptana (better editor for JS/CSS), Subversive (for SVN access), RSE, Filesync, integrating Xdebug's debugger, ... What I mean by "tips" is more some little things you discovered one day and since use all the time -- and allow you to be more efficient in your PHP projects. Some examples of "tips" that come to my mind, and that already know and use : ctrl+space to open the list of suggestions for functions / variables names ctrl+shift+R (navigate > open resource) to open a popup which show only files which names contain what you type ; ie, quick opening of files this one might be the perfect example : I know this one is not often known by coworkers and they find it as useful as I do ; so, I guess there might be lots of other things like this one I don't know myself ^^ ctrl+M to switch to full-screen view for the editor (instead of double-click on tabs bar) shift+F2 while on a function name, to open it's page if the PHP manual in a browser Attention Mac Users use Command instead Control. I guess you get the point ; but I'm really open to any suggestion (be it eclipse-related in general, of more PHP/PDT-specific) that can help be be more efficient :-) Anyway, thanks in advance for your help !

  Read the article

< Previous Page | 754 755 756 757 758 759 760 761 762 763 764 765  | Next Page >