Search Results

Search found 2129 results on 86 pages for 'bound'.

Page 76/86 | < Previous Page | 72 73 74 75 76 77 78 79 80 81 82 83  | Next Page >

  • Error trying to run rails server

    - by David87
    I am trying to get a basic Rails application to run on my Mac OS X 10.6.5. I created a new app called demo (rails new demo), then went into the demo directory and tried to start the app with rails server. Here is the error message I received: "/Users/dpetrovi/.gem/ruby/1.8/gems/sqlite3-ruby-1.3.2/lib/sqlite3/sqlite3_native.bundle: [BUG] Segmentation fault ruby 1.8.7 (2010-12-23 patchlevel 330) [i686-darwin10] Abort trap" I checked bundle install in the demo folder: "Using rake (0.8.7) Using abstract (1.0.0) Using activesupport (3.0.3) Using builder (2.1.2) Using i18n (0.5.0) Using activemodel (3.0.3) Using erubis (2.6.6) Using rack (1.2.1) Using rack-mount (0.6.13) Using rack-test (0.5.6) Using tzinfo (0.3.23) Using actionpack (3.0.3) Using mime-types (1.16) Using polyglot (0.3.1) Using treetop (1.4.9) Using mail (2.2.13) Using actionmailer (3.0.3) Using arel (2.0.6) Using activerecord (3.0.3) Using activeresource (3.0.3) Using bundler (1.0.7) Using thor (0.14.6) Using railties (3.0.3) Using rails (3.0.3) Using sqlite3-ruby (1.3.2) Your bundle is complete! Use bundle show [gemname] to see where a bundled gem is installed." Ruby, RubyGems, and sqlite3 were installed using MacPorts. Then I used gem to try to install the sqlite3-ruby interface. (sudo gem install sqlite3-ruby). Here is where I first noticed something could be off: "Successfully installed sqlite3-ruby-1.3.2 1 gem installed Installing ri documentation for sqlite3-ruby-1.3.2... No definition for libversion Enclosing class/module 'mSqlite3' for class Statement not known Installing RDoc documentation for sqlite3-ruby-1.3.2... No definition for libversion Enclosing class/module 'mSqlite3' for class Statement not known " I had rails running well on my system a few months ago, so I figured maybe I had some duplicates and it was trying to use the wrong one. I ran: "for cmd in ruby irb gem rake; do which $cmd; done" and got: "/opt/local/bin/ruby /opt/local/bin/irb /opt/local/bin/gem /opt/local/bin/rake" Checking where sqlite3 also gets me: "/opt/local/bin/sqlite3" so they all seem to be in the right place. Obviously /opt/local/bin is in my system path. If I check gems server, it shows that I have installed sqlite3-ruby 1.3.2 gem. Not sure what the problem could be? I am using ruby 1.8.7 (2010-12-23 patchlevel 330) [i686-darwin10]. Macports claims this is the latest (although ive seen 1.9.1) One more thing-- in irb, I tried to check which version of sqlite3 my sqlite3-ruby is bound to, but I can only get this far: ":irb(main):001:0 require 'rubygems' = true irb(main):002:0 require 'sqlite3' /Users/dpetrovi/.gem/ruby/1.8/gems/sqlite3-ruby-1.3.2/lib/sqlite3/sqlite3_native.bundle: [BUG] Segmentation fault ruby 1.8.7 (2010-12-23 patchlevel 330) [i686-darwin10] Abort trap" Any suggestions? Im hoping I overlooked something obvious. Thanks

    Read the article

  • C# Detect Localhost Port Usage

    - by ThaKidd
    In advance, thank you for your advice. I am currently working on a program which uses Putty to create a SSH connection with a server that uses local port forwarding to enable a client, running my software, to access the service behind the SSH server via localhost. IE: client:20100 - Internet - Remote SSH server exposed via router/firewall - Local Intranet - Intranet Web POP3 Server:110. Cmd Line: "putty -ssh -2 -P 22 -C -L 20100:intranteIP:110 -pw sshpassword sshusername@sshserver" Client would use putty to create a SSH connection with the SSH server specifying in the connection string that it would like to tie port 110 of the Intranet POP3 Server to port 20100 on the client system. Therefore the client would be able to open up a mail client to localhost:20100 and interact with the Internal POP3 server over the SSH tunnel. The above is a general description. I already know what I am trying to do will work without a problem so am not looking for debate on the above. The question is this...How can I ensure the local port (I cannot use dynamic ports, so it must be static) on localhost is not being used or listened to by any other application? I am currently executing this code in my C# app: private bool checkPort(int port) { try { //Create a socket on the current IPv4 address Socket TestSocket = new Socket(AddressFamily.InterNetwork, SocketType.Stream, ProtocolType.Tcp); // Create an IP end point IPEndPoint localIP = new IPEndPoint(IPAddress.Parse("127.0.0.1"), port); // Bind that port TestSocket.Bind(localIP); // Cleanup TestSocket.Close(); return false; } catch (Exception e) { // Exception occurred. Port is already bound. return true; } } I am currently calling this function starting with a specific port in a for loop to get the 'false' return at the first available port. The first port I try is actually being listened to by uTorrent. The above code does not catch this and my connection fails. What is the best method to ensure a port is truly free? I do understand some other program may grab the port during/after I have tested it. I just need to find something that will ensure it is not currently in use AT ALL when the test is executed. If there is a way to truly reserve the localhost port during the test, I would love to hear about it.

    Read the article

  • How can I specify resources in an MVVM view model?

    - by gix
    Suppose I want to show list of objects where each object should have a name and a suitable image (for example MenuItems with Icons, or buttons with text and image). All examples and programs exposed the image in the viewmodel as a path to a PNG file and then bound the Source of an Image to that. But what if I want to use vector images (for example as a DrawingImage in a local ResourceDictionary)? Exposing the DrawingImage from the view model seems bad because I would have to store a reference to the application/window/user control/... (and it is advised to not expose such XAML objects from view models). So a better approach would be to use a string identifier in the view model and then somehow select the appropriate resource. If that identifier is the resource key this snippet looks tempting but does not work: <Image Source="{StaticResource {Binding Icon}}"/> I found two workarounds for that though they did not work for me. The first one was using a normal binding to the icon with a converter that looked up the resource in Application.Current. This does not work if the resource is stored somewhere else I think (and the situation where I initially bumped into this problem had no Application running yet since it was a Window choosing the Application to launch!). The second workaround was using a markup extension derived from StaticResourceExtension that fetched its ResourceKey from the passed binding: <Image Source="{local:BindableStaticResource {Binding Icon}"/> This one looks really neat because it could use local resources, also be used for other things. But when using it I always got an exception ("Resource named {FooIcon} could not be found.", showing the correct XAML file and position of the extension). Even an empty resource extension derived from StaticResourceExtension that just passed the resource key to the base constructor did not work and I cannot explain why. Just using StaticResourceExtension worked just fine. Any ideas how I could fix the second approach, or even better solutions? Edit I noticed that it does work when used directly like this: <Window> <Window.Resources> <DrawingImage x:Key="SomeIcon"/> </Window.Resources> <Image Source="{BindableStaticResource {Binding Icon}}"/> </Window> but fails for example in a DataTemplate. Though a normal StaticResourceExtension works on both occasions so I am puzzled what is going wrong.

    Read the article

  • Overwrite values when using gridview Edit?

    - by sah302
    I am using a GridView which is bound to a LinqDataSource and using the automatic edit and delete buttons. However, I don't want the user to edit two of the columns manually, but done automatically. Specifically username who last updated the entry, and the date it was updated. The gridview only contains 3 columns: Name, Date modified, last updated by. Right now when the user clicks the edit button they can only edit the name column (other two set to read-only). Upon clicking the update button, I want the other 2 fields to update as well based on some extra code. I thought this was done in the code behind within the event rowUpdating, but it doesn't seem to work. My gridview: <asp:GridView ID="gvNewsSources" runat="server" AutoGenerateColumns="False" DataSourceID="ldsNewsSource" AutoGenerateDeleteButton="True" AutoGenerateEditButton="True" CellPadding="4" ForeColor="#333333" GridLines="None" DataKeyNames="Id"> <RowStyle BackColor="#F7F6F3" ForeColor="#333333" /> <Columns> <asp:BoundField DataField="Name" HeaderText="Name" SortExpression="Name" /> <asp:BoundField DataField="LastUpdatedBy" HeaderText="Last Updated By" SortExpression="LastUpdatedBy" ReadOnly="True" /> <asp:BoundField DataField="DatedModified" HeaderText="Dated Modified" SortExpression="DatedModified" ReadOnly="True" /> </Columns> <FooterStyle BackColor="#5D7B9D" Font-Bold="True" ForeColor="White" /> <PagerStyle BackColor="#284775" ForeColor="White" HorizontalAlign="Center" /> <SelectedRowStyle BackColor="#E2DED6" Font-Bold="True" ForeColor="#333333" /> <HeaderStyle BackColor="#5D7B9D" Font-Bold="True" ForeColor="White" /> <EditRowStyle BackColor="#999999" /> <AlternatingRowStyle BackColor="White" ForeColor="#284775" /> </asp:GridView> My code behind: Partial Class _Default Inherits System.Web.UI.Page Protected Sub gvNewsSources_RowUpdating(ByVal sender As Object, ByVal e As System.Web.UI.WebControls.GridViewUpdateEventArgs) Handles gvNewsSources.RowUpdating e.NewValues("LastUpdatedBy") = GetUser.GetUserName e.NewValues("DateModified") = Date.Now() lblOutput.Text = e.NewValues("DateModified").ToString() End Sub End Class Yet when I run through this, I get no errors, but the values aren't being updated in the database or in the gridview. I ran through debug mode and the new values dictionary starts at 1 and ends up being 3 by the end of the rowUpdating event and the value is being set (tested by output the newValue of Datemodified), but it isn't saving. What am I doing wrong?

    Read the article

  • JavaFX - question regarding binding button's disabled state

    - by jamiebarrow
    I'm trying to create a dummy application that maintains a list of tasks. For now, all I'm trying to do is add to the list. I enter a task name in a text box, click on the add task button, and expect the list to be updated with the new item and the task name input to be cleared. I only want to be able to add tasks if the task name is not empty. The below code is my implementation, but I have a question regarding the binding. I'm binding the textbox's text variable to a string in my view model, and the button's disable variable to a boolean in my view model. I have a trigger to update the disabled state when the task name changes. When the binding of the task name happens the boolean is updated accordingly, but the button still appears disabled. But then when I mouse over the button, it becomes enabled. I believe this is due to JavaFX 1.3's binding being lazy - only updates the bound variable when it is read. Also, when I've added the task, I clear the task name in the model, but the textbox's text doesn't change - even though I'm using bind with inverse. Is there a way to make the textbox's text and the button's disabled state update automatically via the binding as I was expecting? Thanks, James AddTaskViewModel.fx: package jamiebarrow; import java.lang.System; public class AddTaskViewModel { function logChange(prop:String,oldValue,newValue):Void { println("{System.currentTimeMillis()} : {prop} [{oldValue}] to [{newValue}] "); } public var newTaskName: String on replace old { logChange("newTaskName",old,newTaskName); isAddTaskDisabled = (newTaskName == null or newTaskName.trim().length() == 0); }; public var isAddTaskDisabled: Boolean on replace old { logChange("isAddTaskDisabled",old,isAddTaskDisabled); }; public var taskItems = [] on replace old { logChange("taskItems",old,taskItems); }; public function addTask() { insert newTaskName into taskItems; newTaskName = ""; } } Main.fx: package jamiebarrow; import javafx.scene.control.Button; import javafx.scene.control.TextBox; import javafx.scene.control.ListView; import javafx.scene.Scene; import javafx.scene.layout.VBox; import javafx.stage.Stage; import javafx.scene.layout.HBox; def viewModel = AddTaskViewModel{}; var txtName: TextBox = TextBox { text: bind viewModel.newTaskName with inverse onKeyTyped: onKeyTyped }; function onKeyTyped(event): Void { txtName.commit(); // ensures model is updated cmdAddTask.disable = viewModel.isAddTaskDisabled;// the binding only occurs lazily, so this is needed } var cmdAddTask = Button { text: "Add" disable: bind viewModel.isAddTaskDisabled with inverse action: onAddTask }; function onAddTask(): Void { viewModel.addTask(); } var lstTasks = ListView { items: bind viewModel.taskItems with inverse }; Stage { scene: Scene { content: [ VBox { content: [ HBox { content: [ txtName, cmdAddTask ] }, lstTasks ] } ] } }

    Read the article

  • Unable to add item to dataset in Linq to SQL

    - by Mike B
    I am having an issue adding an item to my dataset in Linq to SQL. I am using the exact same method in other tables with no problem. I suspect I know the problem but cannot find an answer (I also suspect all i really need is the right search term for Google). Please keep in mind this is a learning project (Although it is in use in a business) I have posted my code and datacontext below. What I am doing is: Create a view model (Relevant bits are shown) and a simple wpf window that allows editing of 3 properties that are bound to the category object. Category is from the datacontext. Edit works fine but add does not. If I check GetChangeSet() just before the db.submitChanges() call there are no adds, edits or deletes. I suspect an issue with the fact that a Category added without a Subcategory would be an orphan but I cannot seem to find the solution. Command code to open window: CategoryViewModel vm = new CategoryViewModel(); AddEditCategoryWindow window = new AddEditCategoryWindow(vm); window.ShowDialog(); ViewModel relevant stuff: public class CategoryViewModel : ViewModelBase { public Category category { get; set; } // Constructor used to Edit a Category public CategoryViewModel(Int16 categoryID) { db = new OITaskManagerDataContext(); category = QueryCategory(categoryID); } // Constructor used to Add a Category public CategoryViewModel() { db = new OITaskManagerDataContext(); category = new Category(); } } The code for saving changes: // Don't close window unless all controls are validated if (!vm.IsValid(this)) return; var changes = vm.db.GetChangeSet(); // DEBUG try { vm.db.SubmitChanges(ConflictMode.ContinueOnConflict); } catch (ChangeConflictException) { vm.db.ChangeConflicts.ResolveAll(RefreshMode.KeepChanges); vm.db.SubmitChanges(); } The Xaml (Edited fror brevity): <TextBox Text="{Binding category.CatName, Mode=TwoWay, ValidatesOnDataErrors=True, UpdateSourceTrigger=PropertyChanged}" /> <TextBox Text="{Binding category.CatDescription, ValidatesOnDataErrors=True, UpdateSourceTrigger=PropertyChanged}" /> <CheckBox IsChecked="{Binding category.CatIsInactive, Mode=TwoWay}" /> IssCategory in the Issues table is the old, text based category. This field is no longer used and will be removed from the database as soon as this is working and pushed live.

    Read the article

  • RMI applet is making requests on random ports and blocked consequently

    - by Dan
    /// I have set up RMI system successfully on local ubuntu srver. Registry port 1099 and remote object export on 1100(fixed by calling super(1100)) Now I am trying to make it work on Ubuntu over internet with a public IP. I could bind service properly with public ip.But the client applet is trying to connect to ubuntu server at random ports. Below is the error thrown by client applet: // Exception network: Connecting public-ip:1100 with proxy=DIRECT network: Connecting public-ip/cgi-bin/java-rmi.cgi?forward=1099 with proxy=DIRECT network: Connecting public-ip:3733 with proxy=DIRECT network: Connecting public-ip:3721 with proxy=DIRECT // java.rmi.ConnectException: Connection refused to host: public-ip; nested exception is: java.net.ConnectException: Connection refused: connect at sun.rmi.transport.tcp.TCPEndpoint.newSocket(Unknown Source)Source) at java.net.AbstractPlainSocketImpl.connectToAddress(Unknown Source) ... // // I have only 2 ports open on server, i.e., 1099(registry) and 1100(export). How can I fix ports in applet requests such that it does always connect server on same open port? // // Another issue.As I have bound service on public IP i.e. //public-ip:1099/ServiceName, a job running on server to send message to clinets is not able to make request to RMI service. public-ip URL does not work on same machine,i.e., server.Do you think I should use fixed socket factory?If so please give me code snippet and guide me how i can set it up. //Exception java.rmi.ConnectException: Connection refused to host: public-ip; nested exception is: java.net.ConnectException: Connection refused at sun.rmi.transport.tcp.TCPEndpoint.newSocket(TCPEndpoint.java:619) at sun.rmi.transport.tcp.TCPChannel.createConnection(TCPChannel.java:216) at sun.rmi.transport.tcp.TCPChannel.newConnection(TCPChannel.java:202) at sun.rmi.server.UnicastRef.invoke(UnicastRef.java:128) at java.rmi.server.RemoteObjectInvocationHandler.invokeRemoteMethod(RemoteObjectInvocationHandler.java:194) at java.rmi.server.RemoteObjectInvocationHandler.invoke(RemoteObjectInvocationHandler.java:148) at $Proxy5.getUserID(Unknown Source) at rmi.source.xxxxxx$JobScheduler.run(xxxxServerImpl.java:293) at java.util.TimerThread.mainLoop(Timer.java:555) at java.util.TimerThread.run(Timer.java:505) Caused by: java.net.ConnectException: Connection refused at java.net.PlainSocketImpl.socketConnect(Native Method) at java.net.AbstractPlainSocketImpl.doConnect(AbstractPlainSocketImpl.java:337) at java.net.AbstractPlainSocketImpl.connectToAddress(AbstractPlainSocketImpl.java:198) at java.net.AbstractPlainSocketImpl.connect(AbstractPlainSocketImpl.java:180) at java.net.SocksSocketImpl.connect(SocksSocketImpl.java:391) at java.net.Socket.connect(Socket.java:579) at java.net.Socket.connect(Socket.java:528) at java.net.Socket.(Socket.java:425) at java.net.Socket.(Socket.java:208) at sun.rmi.transport.proxy.RMIDirectSocketFactory.createSocket(RMIDirectSocketFactory.java:40) at sun.rmi.transport.proxy.RMIMasterSocketFactory.createSocket(RMIMasterSocketFactory.java:146) at sun.rmi.transport.tcp.TCPEndpoint.newSocket(TCPEndpoint.java:613) ... 9 more Coould you please help me? Thanks a lot in advance. Dan

    Read the article

  • How to replace all id attributes of a child collection of complex types using jQuery in ASP.net MVC

    - by TJB
    Here's my situation: I'm writing an ASP.net MVC 1 website and I have a create/edit form that uses the default model binding to parse the form into a strongly typed complex object. The object I'm posting has a child collection of another complex type and the way I format my id's for the model binder is as follows: <div class="childContainer" > <!-- There's one of these for each property for each child collection item --> <%= Html.TextBox("ChildCollectionName[0].ChildPropertyName", /* blah blah */ ) %> <%= Html.TextBox("ChildCollectionName[0].OtherChildPropertyName", /* blah blah */ ) %> <!-- ... --> </div> This gets rendered as <div class="childContainer" > <input id="ChildCollectionName[0]_ChildPropertyName" ... /> <input id="ChildCollectionName[0]_OtherChildPropertyName" ... /> ... </div> <div class="childContainer" > <input id="ChildCollectionName[1]_ChildPropertyName" ... /> <input id="ChildCollectionName[1]_OtherChildPropertyName" ... /> ... </div> For each entry in the chlid collection. This collection is dynamically created in the form using jQuery, so entries can be added, removed etc. and whenever there's an operation on the collection I need to update the indexes so that it's bound correctly on the server side. What's the best way to replace all the html input id's when I'm updating the index within the child e.g. replace all [*] -- [N] where N is the correct index. using jQuery / JavaScript ? I have something coded now, but its buggy and I think there is a simpler solution. Also, if you have an easier way to identify the child collection I'll take any advice on that as well. Thanx!

    Read the article

  • ASP.NET Repeater and DataBinder.Eval

    - by Fernando
    I've got a <asp:Repeater> in my webpage, which is bound to a programatically created dataset. The purpose of this repeater is to create an index from A-Z, which, when clicked, refreshes the information on the page. The repeater has a link button like so: <asp:LinkButton ID="indexLetter" Text='<%#DataBinder.Eval(Container.DataItem,"letter")%>' runat="server" CssClass='<%#DataBinder.Eval(Container.DataItem, "cssclass")%>' Enabled='<%#DataBinder.Eval(Container.DataItem,"enabled")%>'></asp:LinkButton> The dataset is created the following way: protected DataSet getIndex(String index) { DataSet ds = new DataSet(); ds.Tables.Add("index"); ds.Tables["index"].Columns.Add("letter"); ds.Tables["index"].Columns.Add("cssclass"); ds.Tables["index"].Columns.Add("enabled"); char alphaStart = Char.Parse("A"); char alphaEnd = Char.Parse("Z"); for (char i = alphaStart; i <= alphaEnd; i++) { String cssclass="", enabled="true"; if (index == i.ToString()) { cssclass = "selected"; enabled = "false"; } ds.Tables["index"].Rows.Add(new Object[3] {i.ToString(),cssclass,enabled }); } return ds; } However, when I run the page, a "Specified cast is not valid exception" is thrown in Text='<%#DataBinder.Eval(Container.DataItem,"letter")'. I have no idea why, I have tried manually casting to String with (String), I've tried a ToString() method, I've tried everything. Also, if in the debugger I add a watch for DataBinder.Eval(Container.DataItem,"letter"), the value it returns is "A", which according to me, should be fine for the Text Property. EDIT: Here is the exception: System.InvalidCastException was unhandled by user code Message="Specified cast is not valid." Source="App_Web_cmu9mtyc" StackTrace: at ASP.savecondition_aspx._DataBinding_control7(Object sender, EventArgs e) in e:\Documents and Settings\Fernando\My Documents\Visual Studio 2008\Projects\mediTrack\mediTrack\saveCondition.aspx:line 45 at System.Web.UI.Control.OnDataBinding(EventArgs e) at System.Web.UI.Control.DataBind(Boolean raiseOnDataBinding) at System.Web.UI.Control.DataBind() at System.Web.UI.Control.DataBindChildren() InnerException: Any advice will be greatly appreciated, thank you EDIT 2: Fixed! The problem was not in the Text or CSS tags, but in the Enabled tag, I had to cast it to a Boolean value. The problem was that the exception was signaled at the Text tag, I don't know why

    Read the article

  • In Google Glass, Menu Items are not shown after XE 17.2 Update, any Solutions?

    - by Amalan Dhananjayan
    This worked when the Glass in on XE12, I have opened the solution after about 2 Months and now with XE17 the menu items are not shown when tapped on the Live card, instead the live card is disappearing. I have updated the GDK, I have changed the code to support the latest GDK sneak peek version 2 changes according to this (https://developers.google.com/glass/release-notes#xe12) This is the code public class MenuActivity extends Activity { private static final String TAG = MenuActivity.class.getSimpleName(); private VisionService.VisionBinder mVisionService; private ServiceConnection mConnection = new ServiceConnection() { @Override public void onServiceConnected(ComponentName name, IBinder service) { if (service instanceof VisionService.VisionBinder) { mVisionService = (VisionService.VisionBinder) service; openOptionsMenu(); } // No need to keep the service bound. unbindService(this); } @Override public void onServiceDisconnected(ComponentName name) { } }; private boolean mResumed; @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); bindService(new Intent(this, VisionService.class), mConnection, 0); } @Override protected void onResume() { super.onResume(); mResumed = true; openOptionsMenu(); } @Override protected void onPause() { super.onPause(); mResumed = false; } @Override public void openOptionsMenu() { if (mResumed && mConnection != null) { super.openOptionsMenu(); } } @Override public boolean onCreateOptionsMenu(Menu menu) { getMenuInflater().inflate(R.menu.menu, menu); return true; } @Override public boolean onOptionsItemSelected(MenuItem item) { int id = item.getItemId(); if (id == R.id.action_send) { mVisionService.requestWorkOrderCard(); finish(); return true; } else if (id == R.id.action_refresh) { mVisionService.requestTopWorkOrders(); finish(); return true; } else if (id == R.id.action_finish) { stopService(new Intent(this, VisionService.class)); finish(); return true; } else { return super.onOptionsItemSelected(item); } } @Override public void onOptionsMenuClosed(Menu menu) { super.onOptionsMenuClosed(menu); } } It would be great if any body could help on this. Thank You

    Read the article

  • ASP.NET MVC 2: Linq to SQL entity w/ ForeignKey relationship and Default ModelBinder strangeness

    - by Simon
    Once again I'm having trouble with Linq to Sql and the MVC Model Binder. I have Linq to Sql generated classes, to illustrate them they look similar to this: public class Client { public int ClientID { get; set; } public string Name { get; set; } } public class Site { public int SiteID { get; set; } public string Name { get; set; } } public class User { public int UserID { get; set; } public string Name { get; set; } public int? ClientID { get; set; } public EntityRef<Client> Client { get; set; } public int? SiteID { get; set; } public EntityRef<Site> Site { get; set; } } The 'User' has a relationship with the 'Client' and 'Site . The User class has nullable ClientIDs and SiteIDs because the admin users are not bound to a Client or Site. Now I have a view where a user can edit a 'User' object, the view has fields for all the 'User' properties. When the form is submitted, the appropiate 'Save' action is called in my UserController: public ActionResult Save(User user, FormCollection form) { //form['SiteID'] == 1 //user.SiteID == 1 //form['ClientID'] == 1 //user.ClientID == null } The problem here is that the ClientID is never set, it is always null, even though the value is in the FormCollection. To figure out whats going wrong I set breakpoints for the ClientID and SiteID getters and setters in the Linq to Sql designer generated classes. I noticed the following: SiteID is being set, then ClientID is being set, but then the Client EntityRef property is being set with a null value which in turn is setting the ClientID to null too! I don't know why and what is trying to set the Client property, because the Site property setter is never beeing called, only the Client setter is being called. Manually setting the ClientID from the FormCollection like this: user.ClientID = int.Parse(form["ClientID"].ToString()); throws a 'ForeignKeyReferenceAlreadyHasValueException', because it was already set to null before. The only workaround I have found is to extend the generated partial User class with a custom method: Client = default(EntityRef<Client>) but this is not a satisfying solution. I don't think it should work like this? Please enlighten me someone. So far Linq to Sql is driving me crazy! Best regards

    Read the article

  • GridView's ItemContainerStyle and selection states

    - by Roberto Casadei
    I'm trying to change the appearance of gridview items when they are selected. (Before, I used a trick with an IsSelected property in the ViewModel object bound to the containing grid and a bool-to-color converter, but I recognize that it is bad) To do so, I do: <GridView ItemContainerStyle="{StaticResource GridViewItemContainerStyle}" ...> ... and <Style x:Key="GridViewItemContainerStyle" TargetType="GridViewItem"> <Setter Property="Background" Value="Red" /> <Setter Property="Template"> <Setter.Value> <ControlTemplate TargetType="GridViewItem"> <Grid> <VisualStateManager.VisualStateGroups> <VisualStateGroup x:Name="CommonStates"> <VisualState x:Name="Normal"> <Storyboard> <ObjectAnimationUsingKeyFrames Storyboard.TargetProperty="(Grid.Background)" Storyboard.TargetName="itemGrid"> <DiscreteObjectKeyFrame KeyTime="0" Value="Black"/> </ObjectAnimationUsingKeyFrames> </Storyboard> </VisualState> </VisualStateGroup> <VisualStateGroup x:Name="SelectionStates"> <VisualState x:Name="UnselectedSwiping"/> <VisualState x:Name="UnselectedPointerOver"/> <VisualState x:Name="Selecting"/> <VisualState x:Name="Selected"> <Storyboard> <ObjectAnimationUsingKeyFrames Storyboard.TargetProperty="(Grid.Background)" Storyboard.TargetName="itemGrid"> <DiscreteObjectKeyFrame KeyTime="0" Value="White"/> </ObjectAnimationUsingKeyFrames> </Storyboard> </VisualState> <VisualState x:Name="SelectedSwiping"/> <VisualState x:Name="Unselecting"/> <VisualState x:Name="Unselected"/> <VisualState x:Name="SelectedUnfocused"/> </VisualStateGroup> </VisualStateManager.VisualStateGroups> <Grid ... x:Name="itemGrid"> <!-- HERE MY DATA TEMPLATE --> </Grid> </Grid> </ControlTemplate> </Setter.Value> </Setter> </Style> When I run the app, the items are Black (as in the "normal" state). But selecting them does not turn them into White. Where am I wrong? Moreover, it there a way to set "ItemContainerStyle" without having it to "overwrite" the "ItemTemplate" ???

    Read the article

  • web service filling gridview awfully slow, as is paging/sorting

    - by nat
    Hi I am making a page which calls a web service to fill a gridview this is returning alot of data, and is horribly slow. i ran the svcutil.exe on the wsdl page and it generated me the class and config so i have a load of strongly typed objects coming back from each request to the many service functions. i am then using LINQ to loop around the objects grabbing the necessary information as i go, but for each row in the grid i need to loop around an object, and grab another list of objects (from the same request) and loop around each of them.. 1 to many parent object child one.. all of this then gets dropped into a custom datatable a row at a time.. hope that makes sense.... im not sure there is any way to speed up the initial load. but surely i should be able to page/sort alot faster than it is doing. as at the moment, it appears to be taking as long to page/sort as it is to load initially. i thought if when i first loaded i put the datasource of the grid in the session, that i could whip it out of the session to deal with paging/sorting and the like. basically it is doing the below protected void Page_Load(object sender, EventArgs e) { //init the datatable //grab the filter vars (if there are any) WebServiceObj WS = WSClient.Method(args); //fill the datatable (around and around we go) foreach (ParentObject po in WS.ReturnedObj) { var COs = from ChildObject c in WS.AnotherReturnedObj where c.whatever.equals(...) ...etc foreach(ChildObject c in COs){ myDataTable.Rows.Add(tlo.this, tlo.that, c.thisthing, c.thatthing, etc......); } } grdListing.DataSource = myDataTable; Session["dt"] = myDataTable; grdListing.DataBind(); } protected void Listing_PageIndexChanging(object sender, GridViewPageEventArgs e) { grdListing.PageIndex = e.NewPageIndex; grdListing.DataSource = Session["dt"] as DataTable; grdListing.DataBind(); } protected void Listing_Sorting(object sender, GridViewSortEventArgs e) { DataTable dt = Session["dt"] as DataTable; DataView dv = new DataView(dt); string sortDirection = " ASC"; if (e.SortDirection == SortDirection.Descending) sortDirection = " DESC"; dv.Sort = e.SortExpression + sortDirection; grdListing.DataSource = dv.ToTable(); grdListing.DataBind(); } am i doing this totally wrongly? or is the slowness just coming from the amount of data being bound in/return from the Web Service.. there are maybe 15 columns(ish) and a whole load of rows.. with more being added to the data the webservice is querying from all the time any suggestions / tips happily received thanks

    Read the article

  • asp:Button is not calling server-side function

    - by Richard Neil Ilagan
    Hi guys, I know that there has been much discussion here about this topic, but none of the threads I got across helped me solve this problem. I'm hoping that mine is somewhat unique, and may actually merit a different solution. I'm instantiating an asp:Button inside a data-bound asp:GridView through template fields. Some of the buttons are supposed to call a server-side function, but for some weird reason, it doesn't. All the buttons do when you click them is fire a postback to the current page, doing nothing, effectively just reloading the page. Below is a fragment of the code: <asp:GridView ID="gv" runat="server" AutoGenerateColumns="false" CssClass="l2 submissions" ShowHeader="false"> <Columns> <asp:TemplateField> <ItemTemplate><asp:Panel ID="swatchpanel" CssClass='<%# Bind("status") %>' runat="server"></asp:Panel></ItemTemplate> <ItemStyle Width="50px" CssClass="sw" /> </asp:TemplateField> <asp:BoundField DataField="description" ReadOnly="true"> </asp:BoundField> <asp:BoundField DataField="owner" ReadOnly="true"> <ItemStyle Font-Italic="true" /> </asp:BoundField> <asp:BoundField DataField="last-modified" ReadOnly="true"> <ItemStyle Width="100px" /> </asp:BoundField> <asp:TemplateField> <ItemTemplate> <asp:Button ID="viewBtn" cssclass='<%# Bind("sid") %>' runat="server" Text="View" OnClick="viewBtnClick" /> </ItemTemplate> </asp:TemplateField> </Columns> </asp:GridView> The viewBtn above should call the viewBtnClick() function on server-side. I do have that function defined, along with a proper signature (object,EventArgs). One thing that may be of note is that this code is actually inside an ASCX, which is loaded in another ASCX, finally loaded into an ASPX. Any help or insight into the matter will be SO appreciated. Thanks! (oh, and please don't mind my trashy HTML/CSS semantics - this is still in a very,very early stage :p)

    Read the article

  • Debugging a basic OpenGL texture fail? (iphone)

    - by Ben
    Hey all, I have a very basic texture map problem in GL on iPhone, and I'm wondering what strategies there are for debugging this kind of thing. (Frankly, just staring at state machine calls and wondering if any of them is wrong or misordered is no way to live-- are there tools for this?) I have a 512x512 PNG file that I'm loading up from disk (not specially packed), creating a CGBitmapContext, then calling CGContextDrawImage to get bytes out of it. (This code is essentially stolen from an Apple sample.) I'm trying to map the texture to a "quad", with code that looks essentially like this-- all flat 2D stuff, nothing fancy: glEnable(GL_TEXTURE_2D); glTexEnvf(GL_TEXTURE_ENV, GL_TEXTURE_ENV_MODE, GL_MODULATE); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_WRAP_S, GL_REPEAT); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_WRAP_T, GL_REPEAT); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MAG_FILTER, GL_LINEAR); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MIN_FILTER, GL_LINEAR); glEnableClientState(GL_TEXTURE_COORD_ARRAY); GLfloat vertices[8] = { viewRect.origin.x, viewRect.size.height, viewRect.origin.x, viewRect.origin.y, viewRect.size.width, viewRect.origin.y, viewRect.size.width, viewRect.size.height }; GLfloat texCoords[8] = { 0, 1.0, 0, 0, 1.0, 0, 1.0, 1.0 }; glBindTexture(GL_TEXTURE_2D, myTextureRef); // This was previously bound to glVertexPointer(2, GL_FLOAT , 0, vertices); glTexCoordPointer(2, GL_FLOAT, 0, texCoords); glDrawArrays(GL_TRIANGLE_FAN, 0, 4); glDisableClientState(GL_TEXTURE_COORD_ARRAY); glDisable(GL_TEXTURE_2D); My supposedly textured area comes out just black. I see no debug output from the CG calls to set up the texture. glGetError reports nothing. If I simplify this code block to just draw the verts, but set up a pure color, the quad area lights up exactly as expected. If I clear the whole context immediately beforehand to red, I don't see the red-- which means something is being rendered there, but not the contents of my PNG. What could I be doing wrong? And more importantly, what are the right tools and techniques for debugging this sort of thing, because running into this kind of problem and not being able to "step through it" in a debugger in any meaningful way is a bummer. Thanks!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Accessing parent-level controls from inside a ComboBox's child controls

    - by eponymous23
    I have XAML similar to this: <ListBox ItemsSource="{Binding SearchCriteria, Source={StaticResource model}}" SelectionChanged="cboSearchCriterionType_SelectionChanged"> <ListBox.ItemTemplate> <DataTemplate> <StackPanel Name="spCriterion" Orientation="Horizontal" Height="20"> <ComboBox Name="cboSearchCriterionType" Width="120" SelectionChanged="cboSearchCriterionType_SelectionChanged"> <ComboBox.Items> <ComboBoxItem IsSelected="True" Content="Anagram Match" /> <ComboBoxItem Content="Pattern Match" /> <ComboBoxItem Content="Subanagram Match" /> <ComboBoxItem Content="Length" /> <ComboBoxItem Content="Number of Vowels" /> <ComboBoxItem Content="Number of Anagrams" /> <ComboBoxItem Content="Number of Unique Letters" /> </ComboBox.Items> </ComboBox> <TextBox x:Name="SearchSpec" Text="{Binding SearchSpec}" /> <TextBox x:Name="MinValue" Text="{Binding MinValue}" Visibility="Collapsed" /> <TextBox x:Name="MaxValue" Text="{Binding MaxValue}" Visibility="Collapsed" /> </StackPanel> </DataTemplate> </ListBox.ItemTemplate> As you can tell from the markup, I have a listbox that is bound to a collection of SearchCriterion objects (collectively contained in a SearchCriteria object). The idea is that the user can add/remove criterion items from the criteria, each criterion is represented by a listbox item. Inside the listbox item I have a combobox and three textboxes. What I'm trying to do is change the visibility of the TextBox controls depending on the item that is selected in the ComboBox. For example, if the user selects "Pattern Match" then I want to show only the first textbox and hide the latter two; conversely, if the user selects "Length" or any of the "Number of..." items, then I want to hide the first TextBox and show the latter two. What is the best way to achieve this? I was hoping to do something simple in the SelectionChanged event handler for the listbox but the textbox controls are presumably out of the SelectionChanged event's scope. Do I have to programmatically traverse the control hierarchy and find the controls?

    Read the article

  • WPF multibound textblock not updating

    - by Superstringcheese
    I want to create a program which calculates how long it will take to repeat a process a certain number of times. I've scaled this down a lot for this example. So, I have some textboxes which are bound to properties in a class: Count: <TextBox x:Name="txtCount" Text="{Binding Count, Mode=TwoWay}" Width="50"/> Days: <TextBox x:Name="txtDays" Text="{Binding Days, Mode=TwoWay}" Width="50"/> and a textblock which is multibound like so: <TextBlock x:Name="tbkTotal"> <TextBlock.Text> <MultiBinding StringFormat="Days: {0}, Count: {1}"> <Binding Path="Days" /> /* This isn't updating */ <Binding Path="Count" /> </MultiBinding> </TextBlock.Text> </TextBlock> My DataContext is set in the Window1.xaml.cs file. public Window1() { InitializeComponent(); Sample sample = new Sample(); this.DataContext = sample; } I can update the multibound textblock with the Count property just fine, but the Days property always shows 0, even though the Days input accurately reflects changes. I believe that this is because my accessors are different for Days - namely, the Set method. This class is in a different file. public class Sample : INotifyPropertyChanged { private int _count; private TimeSpan _span; public int Count { get { return _count; } set { _count = value; NotifyPropertyChanged("Count"); /* Doesn't seem to be needed, actually */ } } public TimeSpan Span { get { return _span; } } /* The idea is to provide a property for Days, Hours, Minutes, etc. as conveniences to the inputter */ public double Days { get { return _span.Days; } set { TimeSpan ts = new TimeSpan(); double val = value > 0 ? value : 0; ts = TimeSpan.FromDays(val); _span.Add(ts); NotifyPropertyChanged("Span"); /* Here I can only get it to work if I notify that Span has changed - doesn't seem to be aware that the value behind Days has changed. */ } } private void NotifyPropertyChanged(string property) { if (null != this.PropertyChanged) { PropertyChanged(this, new PropertyChangedEventArgs(property)); } } public Sample() { _count = 0; _span = new TimeSpan(); } public event PropertyChangedEventHandler PropertyChanged; }

    Read the article

  • How to assign WPF resources to other resource tags

    - by Tom
    This is quite obscure, I may just be missing something extremely simple. Scenario 1 Lets say I create a gradient brush, like this in my <Window.Resources> section: <LinearGradientBrush x:Key="GridRowSelectedBackBrushGradient" StartPoint="0,0" EndPoint="0,1"> <GradientStop Color="#404040" Offset="0.0" /> <GradientStop Color="#404040" Offset="0.5" /> <GradientStop Color="#000000" Offset="0.6" /> <GradientStop Color="#000000" Offset="1.0" /> </LinearGradientBrush> Then much later on, I want to override the HighlightBrushKey for a DataGrid. I have basically done it like this (horrible); <LinearGradientBrush x:Key="{x:Static SystemColors.HighlightBrushKey}" GradientStops="{Binding Source={StaticResource GridRowSelectedBackBrushGradient}, Path=GradientStops}" StartPoint="{Binding Source={StaticResource GridRowSelectedBackBrushGradient}, Path=StartPoint}" EndPoint="{Binding Source={StaticResource GridRowSelectedBackBrushGradient}, Path=EndPoint}" /> This is obviously not the most slick way of referencing a resource. I also came up with the following problem, which is almost identical. Scenario 2 Say I created two colors in my <Window.Resources> markup, like so: <SolidColorBrush x:Key="DataGridRowBackgroundBrush" Color="#EAF2FB" /> <SolidColorBrush x:Key="DataGridRowBackgroundAltBrush" Color="#FFFFFF" /> Then later on, I want to supply them in an Array, which feeds the ConverterParameter on a Binding so I can supply the custom Converter with my static resource instances: <Setter Property="Background"> <Setter.Value> <Binding RelativeSource="{RelativeSource Mode=Self}" Converter="{StaticResource BackgroundBrushConverter}"> <Binding.ConverterParameter> <x:Array Type="{x:Type Brush}"> <SolidColorBrush Color="{Binding Source={StaticResource DataGridRowBackgroundBrush}, Path=Color}" /> <SolidColorBrush Color="{Binding Source={StaticResource DataGridRowBackgroundAltBrush}, Path=Color}" /> </x:Array> </Binding.ConverterParameter> </Binding> </Setter.Value> </Setter> What I've done is attempt to rereference an existing resource, but in my efforts I've actually recreated the resource, and bound the properties so they match. Again, this is not ideal. Because I've now hit this problem at least twice, is there a better way? Thanks, Tom

    Read the article

  • What web platform is right for me?

    - by egervari
    I've been looking at web frameworks like Rails, Grails, etc. I'm used to doing applications in Spring Framework with Hibernate... and I want something more productive. One of the things I realized is that while some of the things in Grails is sexy, there are some serious problems with it. Grails' controllers: 1) are implemented awfully. They don't seem to be able to extend from super classes at runtime. I tried this to add base actions and helper methods, and this seems to cause grails to blow up. 2) are based on an obsolete request parameters model (rather than form backing objects, which are much nicer). 3) are hard to test. Command objects are treated totally differently... and it's actually MUCH harder to write the test than it is to write the controller code. 4) Command objects operate totally differently. They are pre-validated and bound, which causes a lot of inconsistencies than basic parameter model. 5) Command objects are not reusable, and it's a pain in the rear to reuse most of the stuff from the domain classes, like constraints and fields. This is TRIVIAL to do in basic Spring. Why the hell was it not trivial to do in Grails? 6) The scaffolding that is generated is pure crap. It doesn't generalize inserts and updates... and it actually copy/pastes a pile of code in two views: create.gsp and edit.gsp. The views themselves are gargantuan piles of doggie do-do. This is further compounded by the fact that it uses low-level parameters and not objects. Integration tests are 30x slower than a Spring integration test. It is disgusting. Some mocking tests are so hard to write and aren't guaranteed to work when it's deployed, that I think it discourages fast, tdd test cycles. Most things seem to screw up grails while it's running, like adding a taglib, or anything really. The server restart problem wasn't solved at all. I'm starting to think going with Spring/Hibernate/Java is the only way to go. While there is a pretty big cost at startup, I know it'll eventually smooth out. It sucks I can't use a language like Scala... because idiomatically, it is so incompatible with Hibernate. This app is also not a run-of-the-mill UI over a database. It's got some of that, but it's not going to be a slouch. I am deathly scared of Grails now because of how crap it is in the Controller layer. Suggestions on what I can do?

    Read the article

  • WFP Textblock in Listbox not clipping properly

    - by Tobias Funke
    Her's what I want: A listbox whose items consist of a stackpanel with two textblocks. The textblocks need to support wrapping, the listbox should not expand, and there should be no horizontal scrollbar. Here's the code I have so far. Copy and paste it into XamlPad and you'll see what I'm talking about. <ListBox Height="300" Width="300" x:Name="tvShows"> <ListBox.Items> <ListBoxItem> <StackPanel> <TextBlock Width="{Binding ElementName=tvShows, Path=ActualWidth}" TextWrapping="Wrap">Lost is an American live-action television series. It follows the lives of plane crash survivors on a mysterious tropical island.</TextBlock> <TextBlock Width="{Binding ElementName=tvShows, Path=ActualWidth}" TextWrapping="Wrap">Lost is an American live-action television series. It follows the lives of plane crash survivors on a mysterious tropical island.</TextBlock> </StackPanel> </ListBoxItem> <ListBoxItem> <StackPanel> <TextBlock Width="{Binding ElementName=tvShows, Path=ActualWidth}" TextWrapping="Wrap">Lost is an American live-action television series. It follows the lives of plane crash survivors on a mysterious tropical island.</TextBlock> <TextBlock Width="{Binding ElementName=tvShows, Path=ActualWidth}" TextWrapping="Wrap">Lost is an American live-action television series. It follows the lives of plane crash survivors on a mysterious tropical island.</TextBlock> </StackPanel> </ListBoxItem> </ListBox.Items> </ListBox> This seems to be doing the job of keeping the textblocks from growing, but there's one problem. The textblocks seem to be slightly larger than the listbox, causing the horizontal scrollbar to appear. This is strange because their widths are bound to the lisbox's ActualWidth. Also, if you add a few more items to the listbox (just cut and paste in XamlPad) causing the vertical scrollbar to appear, the width of the textblocks do not resize to the vertical scrollbar. How do I keep the textblocks inside the listbox, with or without the vertical scrollbar?

    Read the article

  • Flex Drag & Drop: Detecting when all data has been moved from source to destination

    - by Adam Tuttle
    I have two mx:TileList controls that I'm using to allow editing of objects in batch. The first contains a collection of all available data, and the 2nd contains the current batch. Both are bound to ArrayCollections, and using the native drag-n-drop functionality of the TileList control the data is moved from one ArrayCollection to the other when an object is dragged between them. I need to change the currentState to show & reset the batch manipulation controls when the batch count goes from 0 to n or n to 0 items. Based on the documentation, I would have thought that I should listen to the dragComplete event, but my testing shows that instead of firing after the data has been removed from the source ArrayCollection and added to the destination ArrayCollection, it fires (consistently) between these two actions. Both lists are similar to this: <mx:TileList id="srcList" dragEnabled="true" dropEnabled="true" dragMoveEnabled="true" dataProvider="{images}" dragComplete="handleDragComplete(event)" allowMultipleSelection="true" /> And here's the source of the handleDragComplete function: private function handleDragComplete(e:DragEvent):void{ trace(e.dragInitiator.name + '.dragComplete: batch.length=' + batch.length.toString()); trace(e.dragInitiator.name + '.dragComplete: images.length=' + images.length.toString()); if (batch.length > 0){ currentState = 'show'; }else{ currentState = ''; } } And lastly, here's some example output from running the code. These are all run one after the other. Case 1: The application loads with 10 objects in the first list and the batch is empty. I dragged 1 object from the source list to the batch list. srcList.dragComplete: batch.length=1 srcList.dragComplete: images.length=10 (Expected: 1,9) Clearly, the object has been added to the batch ArrayCollection but not removed from the source. Case 2: Now, I'll drag a 2nd object into the batch. srcList.dragComplete: batch.length=2 srcList.dragComplete: images.length=9 (Expected: 2,8) Firstly, we can see that images.length has changed, showing that the object that I dragged from the source list to the batch list was removed AFTER the dragComplete event fired. The same thing happens this time: The new object is added to the batch ArrayCollection (batch.length=2), the dragComplete event fires (running these traces), and then the object is removed from the source ArrayCollection. Case 3: Now, I'll drag both images from the batch list back to their original location in the source list. batchList.dragComplete: batch.length=2 batchList.dragComplete: images.length=10 (Expected: 0,10) We can see that batch.length hasn't gone down, but the source images array is back at its original length of 10. QUESTION: Am I doing something wrong? Is there another event I could listen for? (Note: I tried both DragExit and DragDrop, just to be sure, and those behave as expected, but are not what I need.) Or is there another way to get the data that I want? Or... have I found a bug in the SDK?

    Read the article

  • Issue with blocking the UI during a onchange request - prevents other event from firing.

    - by jfrobishow
    I am having issues with jQuery blockUI plugins and firing two events that are (I think, unless I am loosing it) unrelated. Basically I have textboxes with onchange events bound to them. The event is responsible for blocking the UI, doing the ajax call and on success unblocking the UI. The ajax is saving the text in memory. The other control is a button with on onclick event which also block the UI, fire an ajax request saving what's in memory to the database and on success unblock the UI. Both of these work fine separately. The issue arise when I trigger the onchange by clicking on the button. Then only the onchange is fired and the onclick is ignored. I can change the text in the checkbox, click on the link and IF jQuery.blockUI() is present the onchange alone is fired and the save is never called. If I remove the blockUI both function are called. Here's a fully working example where you can see the issue. Please note the setTimeout are there when I was trying to simulate the ajax delay but the issue is happening without it. <html> <head> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script> <script src="http://github.com/malsup/blockui/raw/master/jquery.blockUI.js?v2.31"></script> <script> function doSomething(){ $.blockUI(); alert("doing something"); //setTimeout(function(){ $.unblockUI(); //},500); } function save(){ $.blockUI(); //setTimeout(function(){ alert("saving"); $.unblockUI(); //}, 1000); } </script> </head> <body> <input type="text" onchange="doSomething();"> <a href="#" onclick="save()">save</a> </body> </html>

    Read the article

  • ListBox content does not resize when window is made smaller

    - by DamonGant
    I'm using .NET 4.0 (not .NET 4.0 CP) and have run into this kinda unique issue. I created a ListBox to display bound elements, first off here is (a part) of my XAML. <Grid Grid.Row="2" Background="#EEEEEE"> <Border Margin="6,10,10,10" BorderBrush="#666666" BorderThickness="1"> <ListBox ItemsSource="{Binding}" Name="appList" BorderThickness="0" HorizontalContentAlignment="Stretch" HorizontalAlignment="Stretch"> <ItemsControl.ItemTemplate> <DataTemplate> <Grid> <Grid.ColumnDefinitions> <ColumnDefinition Width="80" /> <ColumnDefinition Width="*" /> </Grid.ColumnDefinitions> <Border Grid.Column="0" Margin="5" BorderThickness="3" CornerRadius="2" BorderBrush="Black" HorizontalAlignment="Left" VerticalAlignment="Top" x:Name="ItemBorder"> <Image Width="64" Height="64" Source="{Binding Path=IconUri}" Stretch="UniformToFill" /> </Border> <StackPanel Margin="0,5,5,5" Grid.Column="1" Orientation="Vertical" HorizontalAlignment="Stretch"> <TextBlock FontSize="18" Text="{Binding Path=DisplayName}" /> <Grid> <Grid.ColumnDefinitions> <ColumnDefinition Width="*" /> <ColumnDefinition Width="60"/> </Grid.ColumnDefinitions> <ProgressBar Grid.Column="0" Height="24" HorizontalAlignment="Stretch" IsIndeterminate="{Binding Path=IsDiscovering}" Value="{Binding Path=PercentageDownloaded}" /> <TextBlock Grid.Column="1" HorizontalAlignment="Center" VerticalAlignment="Center"><TextBlock x:Name="percentageDownloaded" /><TextBlock x:Name="percentageMeter">%</TextBlock></TextBlock> </Grid> </StackPanel> </Grid> <DataTemplate.Triggers> <DataTrigger Binding="{Binding Path=IsDiscovering}"> <DataTrigger.Value>True</DataTrigger.Value> <Setter TargetName="percentageDownloaded" Property="Text" Value="N/A" /> <Setter TargetName="percentageMeter" Property="Visibility" Value="Collapsed" /> </DataTrigger> <DataTrigger Binding="{Binding Path=IsDiscovering}"> <DataTrigger.Value>False</DataTrigger.Value> <Setter TargetName="percentageDownloaded" Property="Text" Value="{Binding Path=PercentageDownloaded}" /> <Setter TargetName="percentageMeter" Property="Visibility" Value="Visible" /> </DataTrigger> </DataTemplate.Triggers> </DataTemplate> </ItemsControl.ItemTemplate> </ListBox> </Border> </Grid> Sizing the window up stretches the ListBox content just fine, but when I size it down, it retains it's width and spawns vertical scrollbars.

    Read the article

  • DataGridView validating old value insted of new value.

    - by Scott Chamberlain
    I have a DataGridView that is bound to a DataTable, it has a column that is a double and the values need to be between 0 and 1. Here is my code private void dgvImpRDP_InfinityRDPLogin_CellValidating(object sender, DataGridViewCellValidatingEventArgs e) { if (e.ColumnIndex == dtxtPercentageOfUsersAllowed.Index) { double percentage; if(dgvImpRDP_InfinityRDPLogin[e.ColumnIndex, e.RowIndex].Value.GetType() == typeof(double)) percentage = (double)dgvImpRDP_InfinityRDPLogin[e.ColumnIndex, e.RowIndex].Value; else if (!double.TryParse(dgvImpRDP_InfinityRDPLogin[e.ColumnIndex, e.RowIndex].Value.ToString(), out percentage)) { e.Cancel = true; dgvImpRDP_InfinityRDPLogin[e.ColumnIndex, e.RowIndex].ErrorText = "The value must be between 0 and 1"; return; } if (percentage < 0 || percentage > 1) { e.Cancel = true; dgvImpRDP_InfinityRDPLogin[e.ColumnIndex, e.RowIndex].ErrorText = "The value must be between 0 and 1"; } } } However my issue when dgvImpRDP_InfinityRDPLogin_CellValidating fires dgvImpRDP_InfinityRDPLogin[e.ColumnIndex, e.RowIndex].Value will contain the old value before the edit, not the new value. For example lets say the old value was .1 and I enter 3. The above code runs when you exit the cell and dgvImpRDP_InfinityRDPLogin[e.ColumnIndex, e.RowIndex].Value will be .1 for that run, the code validates and writes 3 the data to the DataTable. I click on it a second time, try to leave, and this time it behaves like it should, it raises the error icon for the cell and prevents me from leaving. I try to enter the correct value (say .7) but the the Value will still be 3 and there is now no way out of the cell because it is locked due to the error and my validation code will never push the new value. Any recommendations would be greatly appreciated. EDIT -- New version of the code based off of Stuart's suggestion and mimicking the style the MSDN article uses. Still behaves the same. private void dgvImpRDP_InfinityRDPLogin_CellValidating(object sender, DataGridViewCellValidatingEventArgs e) { if (e.ColumnIndex == dtxtPercentageOfUsersAllowed.Index) { dgvImpRDP_InfinityRDPLogin[e.ColumnIndex, e.RowIndex].ErrorText = String.Empty; double percentage; if (!double.TryParse(dgvImpRDP_InfinityRDPLogin[e.ColumnIndex, e.RowIndex].FormattedValue.ToString(), out percentage) || percentage < 0 || percentage > 1) { e.Cancel = true; dgvImpRDP_InfinityRDPLogin[e.ColumnIndex, e.RowIndex].ErrorText = "The value must be between 0 and 1"; return; } } }

    Read the article

< Previous Page | 72 73 74 75 76 77 78 79 80 81 82 83  | Next Page >